ID: 1165743761

View in Genome Browser
Species Human (GRCh38)
Location 19:38218472-38218494
Sequence GACTGAGGTCAGACTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 231}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165743755_1165743761 11 Left 1165743755 19:38218438-38218460 CCCTGCAGGCCGCTCTGGGGATT 0: 1
1: 0
2: 1
3: 13
4: 143
Right 1165743761 19:38218472-38218494 GACTGAGGTCAGACTGTGGCAGG 0: 1
1: 0
2: 4
3: 22
4: 231
1165743756_1165743761 10 Left 1165743756 19:38218439-38218461 CCTGCAGGCCGCTCTGGGGATTC 0: 1
1: 0
2: 1
3: 8
4: 128
Right 1165743761 19:38218472-38218494 GACTGAGGTCAGACTGTGGCAGG 0: 1
1: 0
2: 4
3: 22
4: 231
1165743747_1165743761 18 Left 1165743747 19:38218431-38218453 CCCCCACCCCTGCAGGCCGCTCT 0: 1
1: 0
2: 2
3: 43
4: 455
Right 1165743761 19:38218472-38218494 GACTGAGGTCAGACTGTGGCAGG 0: 1
1: 0
2: 4
3: 22
4: 231
1165743754_1165743761 12 Left 1165743754 19:38218437-38218459 CCCCTGCAGGCCGCTCTGGGGAT 0: 1
1: 0
2: 1
3: 21
4: 223
Right 1165743761 19:38218472-38218494 GACTGAGGTCAGACTGTGGCAGG 0: 1
1: 0
2: 4
3: 22
4: 231
1165743751_1165743761 15 Left 1165743751 19:38218434-38218456 CCACCCCTGCAGGCCGCTCTGGG 0: 1
1: 0
2: 4
3: 43
4: 362
Right 1165743761 19:38218472-38218494 GACTGAGGTCAGACTGTGGCAGG 0: 1
1: 0
2: 4
3: 22
4: 231
1165743758_1165743761 2 Left 1165743758 19:38218447-38218469 CCGCTCTGGGGATTCAATGAGGT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1165743761 19:38218472-38218494 GACTGAGGTCAGACTGTGGCAGG 0: 1
1: 0
2: 4
3: 22
4: 231
1165743749_1165743761 16 Left 1165743749 19:38218433-38218455 CCCACCCCTGCAGGCCGCTCTGG 0: 1
1: 0
2: 6
3: 36
4: 282
Right 1165743761 19:38218472-38218494 GACTGAGGTCAGACTGTGGCAGG 0: 1
1: 0
2: 4
3: 22
4: 231
1165743748_1165743761 17 Left 1165743748 19:38218432-38218454 CCCCACCCCTGCAGGCCGCTCTG 0: 1
1: 1
2: 5
3: 40
4: 430
Right 1165743761 19:38218472-38218494 GACTGAGGTCAGACTGTGGCAGG 0: 1
1: 0
2: 4
3: 22
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165743761 Original CRISPR GACTGAGGTCAGACTGTGGC AGG Intronic
900394656 1:2448283-2448305 GTCTGAGGTCAGGGTGTGGGTGG + Intronic
901808588 1:11752845-11752867 CAATGAGGTCAGAAGGTGGCTGG + Intronic
901828100 1:11875585-11875607 TACTGCAGTCAGACAGTGGCTGG - Intergenic
903855565 1:26336116-26336138 GACTGAGGTCGGAAGGAGGCGGG + Exonic
904170265 1:28586893-28586915 GGCTGAGGTCACACTGTAGCAGG + Intergenic
904235898 1:29116887-29116909 GTCTGAAGTCTGACTATGGCAGG - Exonic
904677814 1:32209079-32209101 GACTGAGGATACACTATGGCAGG + Exonic
904938303 1:34147431-34147453 GGCTGTGGCCAGACTGTGGAAGG + Intronic
906215087 1:44033927-44033949 GACTGAGGACAGACTGGGGCAGG + Intergenic
907668462 1:56453270-56453292 GAGTGAGGTCAACCTGGGGCTGG + Intergenic
909464123 1:75953706-75953728 GGCTGAGGACGGAGTGTGGCAGG - Intergenic
909516311 1:76511268-76511290 GACTGAGGTCAGACACTTGAGGG - Intronic
910105295 1:83625515-83625537 CACTGAGGTCAGTCTATTGCAGG + Intergenic
911573065 1:99541359-99541381 GACTAAAATCAAACTGTGGCAGG - Intergenic
915236739 1:154489009-154489031 GACTGAAGTCACACTGGGGCGGG + Intronic
916248376 1:162710802-162710824 GACTGAGGTCAAGTTGGGGCAGG - Intronic
916302685 1:163293650-163293672 GAATGAGTTAAGACTTTGGCAGG - Intronic
917840851 1:178976338-178976360 CACTGATGTCATACTGTGTCTGG - Intergenic
918229741 1:182516752-182516774 AACTGAAGTCAAACTGTGGGAGG - Intronic
919639211 1:200033092-200033114 GACTGAGGTCTGAGTGGGGTGGG + Intronic
920669709 1:207993891-207993913 CACTGAGGTGAGCCTGGGGCTGG + Intergenic
922796213 1:228341057-228341079 GGCTGCGGTCAGCCTGTGGTGGG - Intronic
924384372 1:243488176-243488198 GACTGAGGGCAGCCAGAGGCCGG + Intronic
1064886105 10:20114247-20114269 GGCTGAGGTCAGATGGTGGAAGG - Intronic
1069784878 10:70981497-70981519 GACTCGGGTCAGGCTGAGGCTGG + Intergenic
1069934038 10:71902784-71902806 AACAGAGGTTAGAATGTGGCAGG - Intergenic
1070728394 10:78808063-78808085 GACTGGGGTAAGCCTGTGGAGGG - Intergenic
1072305915 10:94107075-94107097 GAGTGAGTTCTGACTGTTGCTGG + Intronic
1075532762 10:123243981-123244003 GACTGAGACCACACTGTGGCTGG - Intergenic
1075935750 10:126339767-126339789 GACAAGGCTCAGACTGTGGCGGG + Intronic
1076072668 10:127503993-127504015 GACTGAGGTATGACTGTGTGAGG - Intergenic
1077293714 11:1814084-1814106 GTCTGAGATCAACCTGTGGCAGG + Intergenic
1077344432 11:2039747-2039769 GACTGAGGTCAGAACCAGGCAGG + Intergenic
1077481236 11:2815650-2815672 GACTGGGGTCAGCCTGGGGCTGG - Intronic
1078452182 11:11448751-11448773 GTCTGAGGTCAGGCAGGGGCCGG + Exonic
1081652017 11:44830529-44830551 GAATGTGGCCAGACTGTGGCTGG - Intronic
1083595277 11:63916008-63916030 GACTGAGGTCTGGCTGGAGCAGG - Intronic
1083922960 11:65790265-65790287 ACCTGAGGACAGACTGAGGCTGG + Intronic
1084238343 11:67802518-67802540 GGCCAAGGTCAGGCTGTGGCTGG + Intergenic
1084533372 11:69742560-69742582 GACAGGGGTCAGTGTGTGGCTGG + Intergenic
1084586728 11:70066789-70066811 GACTGTGGTCAGGTTGTGCCAGG - Intergenic
1084834070 11:71790312-71790334 GGCCAAGGTCAGGCTGTGGCTGG - Intronic
1084938108 11:72597929-72597951 GCCTAAGGTCAGATTGTAGCAGG - Intronic
1084961137 11:72717316-72717338 GACTGAGGTCTGACTGGCCCTGG - Intronic
1085464902 11:76716694-76716716 GTCAGAGGCCAGACTGAGGCTGG - Intergenic
1086145625 11:83548168-83548190 GCCAGAGGGCAGACTGTGGTAGG + Intronic
1089739892 11:120575245-120575267 CACTTAGCTCAGTCTGTGGCGGG + Intronic
1090180577 11:124695661-124695683 GACTGAGGTGATTCTCTGGCTGG + Exonic
1090200187 11:124848534-124848556 GAGTGAGGTTAGAGTGAGGCTGG + Intergenic
1202827418 11_KI270721v1_random:94936-94958 GACTGAGGTCAGAACCAGGCAGG + Intergenic
1091398683 12:170001-170023 GACTCAGGGCCGACTGTGGCGGG - Intronic
1092102849 12:5900667-5900689 GATTGTGGTCAGGCTGTGCCAGG - Intronic
1092209552 12:6637510-6637532 GGCTGAGGTAGGAGTGTGGCTGG + Intergenic
1092409030 12:8240154-8240176 GGCCAAGGTCAGGCTGTGGCTGG + Intergenic
1093657686 12:21715609-21715631 GAGTGAGGTCAAAACGTGGCAGG - Intronic
1094232974 12:28129005-28129027 GCCTGAGGTCAAACTGGGGGTGG + Intergenic
1095158076 12:38882735-38882757 GCCAGGGGTCAGAATGTGGCAGG - Intronic
1095975070 12:47934778-47934800 GACTGATGTGAGAATCTGGCAGG - Intronic
1095984075 12:47988215-47988237 TACTGAGAACAGACTGGGGCCGG - Intronic
1098516801 12:71386859-71386881 GCCTGAGGGTAGACTGTGGTAGG + Intronic
1100289177 12:93197859-93197881 GAATGAGGTAAGACTGGGACTGG - Intergenic
1101377649 12:104184660-104184682 GCCTGAAGTCAGCCTGTGGTGGG - Intergenic
1101819412 12:108172363-108172385 GTCTGTGGTCACACAGTGGCAGG + Intronic
1103932816 12:124459556-124459578 GACTGAGGCCAGACTCAGTCAGG - Intronic
1108405613 13:50099016-50099038 GACTGAAGGTAGACTGTGGTAGG + Intronic
1110604445 13:77415368-77415390 GACTGAGGTGAGACTCTGGAAGG + Intergenic
1111987159 13:95077149-95077171 GAATGAGGCCATACTGGGGCAGG + Intronic
1112652831 13:101416880-101416902 GCGTGAGGTCAGACTGTGCACGG + Intergenic
1113138101 13:107116414-107116436 GACTGAGGTCAGACAGGGAAAGG - Intergenic
1116896856 14:50324364-50324386 TACTGAGGGCTTACTGTGGCAGG - Intronic
1119899496 14:78247932-78247954 GCATGAAGTCAGCCTGTGGCAGG + Intronic
1120872678 14:89352148-89352170 GACACAGGTCAGAGTCTGGCTGG + Intronic
1121112009 14:91318968-91318990 TACTGAGGCATGACTGTGGCAGG - Intronic
1121254307 14:92520078-92520100 TACTGAGGTCAAATTGGGGCAGG - Intronic
1122931494 14:104934715-104934737 GGCTGAGTTCACAGTGTGGCAGG - Exonic
1122931913 14:104937039-104937061 GGCTGAGTTCACAGTGTGGCAGG - Exonic
1124473244 15:30007496-30007518 GAGCGAGGTCAGGCTGAGGCAGG - Intergenic
1127880898 15:63157687-63157709 GCCTGAGGCCAGAATCTGGCTGG + Exonic
1130034087 15:80342001-80342023 GAATGGGGACAGACTGTGGTGGG + Intergenic
1131437426 15:92434572-92434594 GACTGGGGCCAGGCGGTGGCAGG + Intronic
1132800798 16:1751996-1752018 GGCGGGGGTCAGAGTGTGGCTGG - Intronic
1132826948 16:1909872-1909894 AACTGAGGCCAGACTCAGGCAGG - Intergenic
1133019715 16:2961983-2962005 GACTGAGGCCAGACTGGGGCAGG - Intergenic
1133349997 16:5094962-5094984 GGCCAAGGTCAGGCTGTGGCTGG + Intronic
1133391139 16:5411132-5411154 GCCAGAGGGCAGACTGTGGTGGG + Intergenic
1133920848 16:10151852-10151874 GTCGGAGGTCAGACAGAGGCTGG - Intronic
1135075614 16:19390845-19390867 GAATGGGGTCACACTGTGTCCGG + Intergenic
1139532979 16:67552524-67552546 GACTGAGGTCAGACTGGTGGAGG + Intergenic
1140473774 16:75228663-75228685 GAGTGAGGGCAGATTGGGGCAGG - Intronic
1141116968 16:81316827-81316849 CATTGAGGTCACACTGTGGTTGG - Intronic
1143471503 17:7178587-7178609 GACTGAGTCAAGACTGAGGCTGG + Exonic
1144794589 17:17882514-17882536 GATTGTGGTCAGGCTGTGGTGGG - Intronic
1145380273 17:22383209-22383231 GACTGAGCTGGGACTGGGGCTGG + Intergenic
1145907381 17:28523984-28524006 GCGTGACGTCAGACTGCGGCGGG - Exonic
1147538318 17:41335133-41335155 GAGTGGGGGCAGAGTGTGGCTGG + Intergenic
1151393390 17:73802990-73803012 GGCTGCAGTCAGACAGTGGCTGG + Intergenic
1151670750 17:75570504-75570526 GCCTGAGGTGAGGCTGCGGCCGG + Intronic
1156478028 18:37418603-37418625 GACCTAGGTCACACTGTGGGAGG - Intronic
1159060805 18:63512106-63512128 GACTCAGCTCAGACTGAGCCGGG - Intergenic
1160855926 19:1217801-1217823 GATGGAGCCCAGACTGTGGCAGG - Intronic
1162029829 19:7912547-7912569 GACTGAGGACAGAGAGTGGGGGG + Exonic
1162417218 19:10545041-10545063 GCCTGACCTCGGACTGTGGCTGG + Exonic
1163176427 19:15566890-15566912 GACGGAGGAGAGACTGTGCCAGG - Intergenic
1163931148 19:20393273-20393295 GACCTTGGCCAGACTGTGGCTGG + Intergenic
1163941467 19:20498804-20498826 GACCTCTGTCAGACTGTGGCTGG + Intergenic
1164727220 19:30474225-30474247 GACTAGGGCCAGACTGTGGAAGG + Intronic
1165743761 19:38218472-38218494 GACTGAGGTCAGACTGTGGCAGG + Intronic
1165778081 19:38416737-38416759 GGCTGAGGTCAGAAAGTGGCAGG - Intronic
1166092465 19:40519283-40519305 TTCTGAGGTCACACAGTGGCTGG + Intronic
1166811390 19:45516490-45516512 AACTGAGGTCAGGCAGGGGCTGG + Intronic
1166906463 19:46113323-46113345 GCCTGAAGTCAGACTGTTGTTGG + Intergenic
1167612915 19:50515787-50515809 GACAGAGGTCAGACTGGACCAGG - Intergenic
1168012630 19:53545608-53545630 GACTGATCTAGGACTGTGGCTGG - Intronic
1168056410 19:53867459-53867481 GAGTGAGGTGAGACGGGGGCGGG + Intronic
1168072228 19:53959616-53959638 TGCTGAGGTCAGGCTGGGGCTGG - Intergenic
925532089 2:4875425-4875447 GACTGAGATCTGAATGTGGACGG + Intergenic
928314800 2:30236818-30236840 GAGGGAGGGCAGACTGGGGCTGG + Intronic
929239619 2:39640260-39640282 GACAGAGCCCAGACTCTGGCAGG - Intergenic
930235949 2:48889132-48889154 GACTGAGGTCAGGTGGTTGCAGG - Intergenic
930486500 2:52017774-52017796 GACTGAGCTCAGACTCTGCTTGG + Intergenic
931654885 2:64501991-64502013 GACTGAGATCAGCTTGTGGAAGG - Intergenic
934555023 2:95282516-95282538 GACTGAGGACAGGCATTGGCTGG + Intronic
935386922 2:102509510-102509532 GACAGACGGCAGACTGTGGTAGG - Intronic
937045036 2:118846713-118846735 GACAGAGGCCAGACTGCCGCAGG - Exonic
938293308 2:130161673-130161695 GACTGAGGTCACACTATGTGTGG + Intronic
938370641 2:130766268-130766290 GACTGGGGCCAGATTGAGGCCGG - Exonic
939026032 2:137014744-137014766 AACGGAGGTCTGACTGTGGAGGG - Intronic
940237549 2:151527245-151527267 GACTGAGTTCTGACTGAGGCTGG - Intronic
940290526 2:152074043-152074065 GACTGAGTTCAGAATAAGGCAGG + Intronic
941562820 2:167069985-167070007 GGCTGAGGTCAGATTGTGCAAGG - Intronic
945923256 2:215777917-215777939 GAGTGAGGTAAGAATGGGGCAGG + Intergenic
946045043 2:216813990-216814012 GAGTGGGGTGAGACTGTGGCTGG + Intergenic
947074649 2:226329326-226329348 TTCTGAGGACAGACTGCGGCAGG - Intergenic
947542483 2:230988509-230988531 CCCTGAGGTCACACTGAGGCTGG + Intergenic
947963559 2:234260033-234260055 GACTGAGGTGAGGCTGAGGCTGG - Intergenic
947963564 2:234260056-234260078 GGCTGAGGTGAGGCTGAGGCTGG - Intergenic
1168772940 20:427741-427763 GACTGGGGTCAGACTGGCCCAGG - Intronic
1170476825 20:16723206-16723228 GAATTCAGTCAGACTGTGGCAGG - Intergenic
1171017704 20:21556896-21556918 GTCTGAGGACAGCCTGTGTCAGG - Intergenic
1171494168 20:25543448-25543470 GACTGAGGTAGGAGTGAGGCAGG + Intronic
1172839658 20:37894665-37894687 GGCTGAAGTCACACAGTGGCTGG - Intergenic
1173087664 20:39939759-39939781 GAGTGAGGTTAGATTGTGTCAGG - Intergenic
1173437567 20:43046604-43046626 GACTGAGGTCGGGCTGTGGTGGG + Intronic
1174363104 20:50040617-50040639 GCCTGAGGTCACACCGTAGCAGG - Intergenic
1175479538 20:59301490-59301512 GACTGTGAAGAGACTGTGGCTGG + Exonic
1175645157 20:60664717-60664739 GACTGTGGTCAGAGAGGGGCTGG - Intergenic
1175850253 20:62086779-62086801 GACTGGGGTCACACAGAGGCGGG + Intergenic
1176208413 20:63903983-63904005 GGCTGAGGTCAGGCTGAGGTGGG + Intronic
1177140520 21:17353116-17353138 GTCTGAGCTCAGACTCTGCCTGG - Intergenic
1179121572 21:38550602-38550624 GTCTGAGATCAGAGTGTAGCAGG - Intronic
1182233365 22:28856181-28856203 GACTGAGATCAGTATGTGGTTGG + Intergenic
1182499278 22:30733771-30733793 GACAGAGGTGAGAGTGTGACTGG + Intronic
1182676658 22:32044129-32044151 CACTTATGACAGACTGTGGCAGG + Intronic
1182726351 22:32449144-32449166 GTCTGAAGTCAGACTGAGGAGGG - Intronic
1183825985 22:40387997-40388019 GACTGAGGTGTGACTGTGTAAGG - Intronic
1183839676 22:40488328-40488350 GACTAGGGTCAGACTGTGAAGGG + Intronic
1185110022 22:48895578-48895600 GACACAGGTCAGGATGTGGCAGG + Intergenic
949539446 3:5020652-5020674 GACTGAGGTGGGGCAGTGGCAGG - Intergenic
949877883 3:8638479-8638501 GACTCCGGTCAAAATGTGGCAGG - Intronic
950465459 3:13150764-13150786 GCCTGGGGTCAGGCTGTGCCAGG - Intergenic
950948707 3:16977350-16977372 GTCTGAGTTCAGGCTGTGGGAGG - Intronic
951728968 3:25789952-25789974 GGCTGAGGTCAGACCGTGGGAGG - Intronic
952135519 3:30414475-30414497 GACTGAGGTTGGACTGTAGTGGG + Intergenic
952462220 3:33540027-33540049 GGCTGAGGTGAGGCTGAGGCTGG - Intronic
952482489 3:33775931-33775953 GACTGAGGACATACTTTGGTAGG - Intergenic
952835603 3:37599358-37599380 GGCTGAGGTGACAGTGTGGCTGG + Intronic
953383192 3:42489691-42489713 GTCTGAGGCCAGACTAGGGCTGG - Intronic
953912429 3:46899756-46899778 GTCAGAGGTCAGCCTGGGGCTGG + Intronic
958485212 3:94697224-94697246 GACTGAGTTCAGAGTGGGGGTGG + Intergenic
960943301 3:122948432-122948454 GACTTAGGTCAGACCTTGGCAGG - Intronic
961300543 3:125919394-125919416 GGCCAAGGTCAGGCTGTGGCTGG - Intergenic
961318659 3:126057464-126057486 GCCTGAGGGCAGGCTGGGGCAGG + Intronic
967868904 3:194213293-194213315 GACTGAGGTCTGACTCTGTCAGG - Intergenic
967943045 3:194780908-194780930 GACTCAAGTCAGCTTGTGGCTGG - Intergenic
968428395 4:537808-537830 GGCTGAGGTGAGGCTGTGGAGGG + Intronic
968584274 4:1408722-1408744 GGCTGAGGTCAGGCCGTGGCAGG - Intergenic
968926267 4:3550008-3550030 CCCTGAGGCCAGCCTGTGGCAGG + Intergenic
969756909 4:9156051-9156073 GGCCAAGGTCAGCCTGTGGCTGG - Intergenic
969816869 4:9693627-9693649 GGCCAAGGTCAGGCTGTGGCTGG - Intergenic
969964988 4:10984817-10984839 GTCTGAGGTCAGACACTGACTGG - Intergenic
970764594 4:19532320-19532342 GACTGAGGGCAGATTGCAGCAGG - Intergenic
978370187 4:108022337-108022359 TACTGAGGGCTGACTGTGCCGGG + Intronic
980150187 4:129037277-129037299 GACAGAGGCCAGAATGTGGAAGG - Intronic
985784841 5:1888031-1888053 GCCTGGGGTCAGACTAGGGCTGG + Intergenic
986347733 5:6850289-6850311 GAGTGGGGACAGACTGTGGGTGG + Intergenic
986972480 5:13353215-13353237 TGCTGCAGTCAGACTGTGGCTGG - Intergenic
987563586 5:19555622-19555644 TTCTGAGCTCAGACTTTGGCAGG - Intronic
987778035 5:22394975-22394997 GGCTGAGGTTAGACTGTGATAGG + Intronic
990374171 5:55152651-55152673 GTCAGAGTTCAAACTGTGGCAGG - Intronic
990418472 5:55608897-55608919 ACCTGGGCTCAGACTGTGGCAGG + Intergenic
992653565 5:78885803-78885825 AACGGAGGGCAGACTTTGGCAGG - Exonic
993492826 5:88572524-88572546 GAAAGAGGTCAGACTGAGGAAGG - Intergenic
993841414 5:92884556-92884578 GAATGAATTCAGACTGTAGCTGG - Intergenic
994668941 5:102743401-102743423 GGCTGAGATCAGAATGTGGAGGG + Intergenic
996062338 5:119046017-119046039 GACTGAGTTAAGACAGTGACAGG - Intronic
996196140 5:120610005-120610027 AACTGGGATTAGACTGTGGCAGG - Intronic
998060562 5:139115474-139115496 CCCTGAGGTCAGAGTGGGGCTGG - Intronic
998250786 5:140550825-140550847 GACTGAGGTCAGTCAGTGGATGG - Exonic
1000683706 5:164220392-164220414 AGCTGAGGTCAGAAAGTGGCTGG - Intergenic
1001406249 5:171479683-171479705 GACTGAAGTCAGACTACTGCTGG - Intergenic
1002358456 5:178650180-178650202 TAATGAGGGCAGACTGTGCCAGG + Intergenic
1002662706 5:180802640-180802662 GACGGAGGTCAGACCGGGGGAGG - Intronic
1003324953 6:5084641-5084663 GGCTGCGGCCAGACTGGGGCGGG - Exonic
1003831021 6:10011586-10011608 GACTGAGGCCAGACTGTCTGAGG - Intronic
1004558565 6:16724905-16724927 GACTGAGCTCAGGCCATGGCGGG - Intronic
1004603204 6:17170477-17170499 GAATGAGGTCAGACTATAGTTGG + Intergenic
1005696342 6:28355939-28355961 GCCTGAGGACAGGCTGTGGGTGG - Intronic
1005811160 6:29517543-29517565 GTCTGAGGTCACACAGTGGCAGG - Intergenic
1007138184 6:39543235-39543257 AACAGAGCTCAGACTGGGGCTGG + Intronic
1009868255 6:69424890-69424912 GACTCTGGTCTGAATGTGGCAGG - Intergenic
1015189557 6:130457857-130457879 GACTGGGTGAAGACTGTGGCTGG - Intergenic
1016635996 6:146290947-146290969 AACAGAGGGCAGACTGTGGTAGG + Intronic
1019492742 7:1322731-1322753 CGCTGAGGTCAGACTATGGCTGG + Intergenic
1020905668 7:14061436-14061458 AGCTGAGGTGAGACTTTGGCAGG - Intergenic
1022807985 7:33842367-33842389 TCCTGAGGTAAGACTGGGGCAGG + Intergenic
1023991212 7:45129980-45130002 GAAGGGGGTCAGGCTGTGGCAGG - Intergenic
1026698157 7:72614340-72614362 GACAGAGGTCAGACTGGGCATGG + Intronic
1027388751 7:77684074-77684096 AACAGAGGTCAGATTGTGGAAGG - Intergenic
1033304387 7:140213743-140213765 GAGTCAGGTCAGACTGAGTCAGG - Intergenic
1035796552 8:2362601-2362623 CACTGAGGACAGACAGTGGGAGG - Intergenic
1036380140 8:8231370-8231392 GGCCAAGGTCAGCCTGTGGCTGG - Intergenic
1038021586 8:23555696-23555718 CCAGGAGGTCAGACTGTGGCTGG + Intronic
1038345814 8:26731515-26731537 GACTGAGGTCAGATTGTGGAGGG + Intergenic
1038612319 8:29068403-29068425 GACTAATGTCAGCTTGTGGCTGG - Exonic
1038694938 8:29798071-29798093 GTCTGGGGCCAGACTGTGGAAGG + Intergenic
1039022717 8:33225322-33225344 GACTGAGAAGAGACTGTGGATGG - Intergenic
1041461267 8:58114459-58114481 TACTGAGGTCAGCATGAGGCTGG - Intronic
1045873333 8:106950201-106950223 GACTGAGGGCAGCCTGGTGCAGG + Intergenic
1048818173 8:138353758-138353780 GTGTGAGCTCAGACTGTGCCAGG - Intronic
1049758971 8:144323345-144323367 GCCTGAGGTGAGGCTGTGGCTGG - Intronic
1050096483 9:2072816-2072838 TAGTGAGGACAGGCTGTGGCTGG + Intronic
1050763789 9:9107526-9107548 GCCTTAGATCAGATTGTGGCAGG + Intronic
1053801194 9:41765414-41765436 CCCTGAGGCCAGCCTGTGGCAGG + Intergenic
1054144007 9:61549423-61549445 CCCTGAGGCCAGCCTGTGGCAGG - Intergenic
1054189623 9:61977564-61977586 CCCTGAGGCCAGCCTGTGGCAGG + Intergenic
1054463782 9:65480779-65480801 CCCTGAGGCCAGCCTGTGGCAGG - Intergenic
1054648892 9:67611045-67611067 TCCTGAGGCCAGCCTGTGGCAGG - Intergenic
1054941722 9:70750341-70750363 GACTGCATTCAGACTGTGGAGGG + Intronic
1054972121 9:71100039-71100061 ATCTGAAGTCAGACTGTGTCAGG - Intronic
1055760236 9:79599235-79599257 CACTGGGGTCAGACTATGGAAGG - Intronic
1056923207 9:90810209-90810231 GACTGAGGTCAGGATGTCCCAGG + Intronic
1058417723 9:104805695-104805717 GTCACAGGACAGACTGTGGCAGG - Intronic
1059415949 9:114162608-114162630 GACTGGGGTGAGACTGGGACTGG + Intronic
1061176338 9:128999708-128999730 GCCTAATGCCAGACTGTGGCGGG - Exonic
1062011093 9:134267280-134267302 GCCTCCGGTCAGACTGTGGTGGG - Intergenic
1062264009 9:135678538-135678560 GGCTGAGGTATGACCGTGGCTGG + Intergenic
1185500783 X:595661-595683 GAGTGAAGTCAGAGTCTGGCTGG - Intergenic
1186893162 X:13980093-13980115 GACTAAGGTCCAACTGTGGAAGG + Intergenic
1189029605 X:37437051-37437073 GAGGGAGGTCTGACTGTTGCAGG + Intronic
1189376955 X:40474011-40474033 GACTTAGGTCAGACTGAAGAAGG + Intergenic
1189390140 X:40569672-40569694 CACTGCAGTCAGACAGTGGCTGG - Intergenic
1189626555 X:42903322-42903344 GAGTGAGCTCAGGCTGGGGCTGG + Intergenic
1190059277 X:47200558-47200580 GAGTGAGCTCAGACTTTGGCTGG + Intronic
1190118573 X:47641730-47641752 GTCAGAGGGCAGACTGTGGTAGG + Intronic
1192321955 X:70097055-70097077 GACAGAGAGCAGGCTGTGGCAGG + Intergenic
1195933915 X:110107160-110107182 ACCTGAGGTCATACTTTGGCAGG + Intronic
1199061584 X:143361681-143361703 GAATGAGTTAAGACTCTGGCTGG - Intergenic
1199236694 X:145501582-145501604 GACTGAGGTCAGACTGTGATGGG + Intergenic