ID: 1165746883

View in Genome Browser
Species Human (GRCh38)
Location 19:38234715-38234737
Sequence TGGGGGGCCATGCAGTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165746872_1165746883 13 Left 1165746872 19:38234679-38234701 CCAGATGGGGATGCTGAGGCGCA No data
Right 1165746883 19:38234715-38234737 TGGGGGGCCATGCAGTATCAGGG No data
1165746869_1165746883 18 Left 1165746869 19:38234674-38234696 CCTGCCCAGATGGGGATGCTGAG No data
Right 1165746883 19:38234715-38234737 TGGGGGGCCATGCAGTATCAGGG No data
1165746871_1165746883 14 Left 1165746871 19:38234678-38234700 CCCAGATGGGGATGCTGAGGCGC No data
Right 1165746883 19:38234715-38234737 TGGGGGGCCATGCAGTATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165746883 Original CRISPR TGGGGGGCCATGCAGTATCA GGG Intergenic
No off target data available for this crispr