ID: 1165751840

View in Genome Browser
Species Human (GRCh38)
Location 19:38264952-38264974
Sequence GCTCCTCTCTGGGGTCCTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 420}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165751831_1165751840 7 Left 1165751831 19:38264922-38264944 CCGGGCGTTTCTCGCCCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1165751840 19:38264952-38264974 GCTCCTCTCTGGGGTCCTGGCGG 0: 1
1: 0
2: 6
3: 51
4: 420
1165751834_1165751840 -7 Left 1165751834 19:38264936-38264958 CCCTGCTGGGATCGCTGCTCCTC 0: 1
1: 0
2: 0
3: 14
4: 208
Right 1165751840 19:38264952-38264974 GCTCCTCTCTGGGGTCCTGGCGG 0: 1
1: 0
2: 6
3: 51
4: 420
1165751835_1165751840 -8 Left 1165751835 19:38264937-38264959 CCTGCTGGGATCGCTGCTCCTCT 0: 1
1: 0
2: 1
3: 23
4: 178
Right 1165751840 19:38264952-38264974 GCTCCTCTCTGGGGTCCTGGCGG 0: 1
1: 0
2: 6
3: 51
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165751840 Original CRISPR GCTCCTCTCTGGGGTCCTGG CGG Exonic
900336665 1:2167494-2167516 GCTCCTCTCGGGGGGACAGGTGG + Intronic
900338189 1:2175217-2175239 GCCTCTCTTTGGGGTCCTGGAGG - Exonic
900427971 1:2589084-2589106 GCTCCTCCCAGGGGACCTAGGGG - Intronic
900439362 1:2645665-2645687 TCTTCTCCCTGGGGTCCTAGAGG + Intronic
900475656 1:2875221-2875243 GCTCCTCTCTGGGGTCGGTCAGG + Intergenic
900937564 1:5776148-5776170 GCTCCTCTATGGGGCCCCAGAGG - Intergenic
901956408 1:12788740-12788762 GATTCTCACTGGGGTCCTGGGGG + Intergenic
901971882 1:12914663-12914685 GATTCTCACTGGGGTCCTGGGGG + Intronic
901979787 1:13024795-13024817 GATTCTCACTGGGGTCCTGGGGG + Intronic
902002296 1:13204143-13204165 GATTCTCACTGGGGTCCTGGGGG - Intergenic
902013286 1:13287077-13287099 GATTCTCACTGGGGTCCTGGGGG - Intergenic
902021526 1:13349907-13349929 GATTCTCACTGGGGTGCTGGGGG - Intergenic
902262638 1:15238323-15238345 TCACCTCTCTGGGTTTCTGGAGG - Intergenic
902478968 1:16701816-16701838 GCAGCTCCCTGGGGTCCTGCTGG - Intergenic
904019246 1:27449774-27449796 GATCCTCTCTCGTGACCTGGTGG - Intronic
904221443 1:28973293-28973315 GCCCTTCTCTGGTGTCCTTGGGG + Intronic
904381193 1:30112183-30112205 CCTCCTCTTTGTGGTCCTGCAGG - Intergenic
904489766 1:30851310-30851332 GCTCATCGCTGGGGCCCTGGAGG - Intergenic
904493473 1:30874200-30874222 TCTCCTTTCTGGGTTCCTAGAGG + Intronic
904833416 1:33320134-33320156 GCTCCTGTCTGAGCTCCTGGAGG + Intronic
904866175 1:33580676-33580698 GCTCCTCTGTGGAGACCGGGCGG - Intronic
905126241 1:35718083-35718105 GCTCCATTCTGAGGCCCTGGAGG + Intronic
905973502 1:42157984-42158006 GCTGCTCTCTGTGGGCCTGGCGG + Intergenic
906696885 1:47829087-47829109 GGACCTCTCTGGGGTCCCTGGGG - Intronic
907049697 1:51321810-51321832 GCTGCTCTCAGGAGTCCTGGGGG + Exonic
907909918 1:58816482-58816504 GCTCCTCCCTGCGGTCCTGCCGG + Intergenic
907917187 1:58881870-58881892 GTATCTCTCTGGGGTCTTGGGGG + Intergenic
908094406 1:60721752-60721774 GCTACCATTTGGGGTCCTGGAGG - Intergenic
908717971 1:67090316-67090338 GCTCCTTTTTGGCGTCCTAGGGG + Intergenic
912995084 1:114525050-114525072 CCCCTTCTCTGGGGTCTTGGAGG - Intergenic
917517224 1:175718424-175718446 GCTCCTCTCTGGGGTTTCAGGGG - Intronic
917967704 1:180188900-180188922 CCTCCTCCCTGGAGTCCTTGTGG + Intronic
920353602 1:205354018-205354040 GGTCCTCGCTGGGCTGCTGGTGG - Intronic
920379123 1:205525755-205525777 TCACCTCTTTGGGCTCCTGGAGG - Intronic
921840542 1:219823510-219823532 GCTCCACTATGGTGCCCTGGTGG + Intronic
922182824 1:223248902-223248924 GCTCCTCTGTGGCTTCCTTGTGG - Intronic
922740217 1:228010300-228010322 GCCCACCTCTAGGGTCCTGGTGG - Intronic
923275369 1:232390739-232390761 GCTCTGCTCTGGGGGCCTGCAGG - Intergenic
923338901 1:232991514-232991536 GCCCCACCCTGAGGTCCTGGGGG - Intronic
924816677 1:247448097-247448119 ACTCCAGGCTGGGGTCCTGGGGG + Intronic
1062982457 10:1736931-1736953 GCTTCACTTTGGGGTGCTGGCGG - Intronic
1064297327 10:14090189-14090211 GCTCTTGCCTGAGGTCCTGGAGG + Intronic
1064413825 10:15131549-15131571 GCCCCTCTCAGGGGTCCCAGGGG - Intronic
1065431351 10:25660692-25660714 GCTGCTCTCTGGTGAGCTGGGGG + Intergenic
1065637224 10:27744456-27744478 GCTCACCTCTGGGGTCGCGGAGG + Intronic
1067079687 10:43205963-43205985 CCTCATCTCTGGGTCCCTGGAGG - Exonic
1067720642 10:48725267-48725289 GCTCCCCCCTGGGCTCTTGGGGG - Intronic
1067911650 10:50352229-50352251 GCTGGGCTCTGGGGTCTTGGGGG - Intronic
1069918949 10:71804535-71804557 TCTCCTCTTTGAGGTCCTGCGGG + Intronic
1070811083 10:79298467-79298489 GCTGCTCCCAGGGGTCATGGGGG - Exonic
1072540475 10:96394488-96394510 GCTGCTCTGTAGGGTCCTGATGG - Intronic
1073729378 10:106271178-106271200 GGTCCACTCTGGTGTCCAGGAGG - Intergenic
1074504653 10:114058289-114058311 GCTCTTCTCTGAGGCCCTGTGGG + Intergenic
1074743608 10:116508676-116508698 TATCCTCTCTGGGGTCCAGATGG + Intergenic
1075068849 10:119307750-119307772 GCTCTACTCTGGTCTCCTGGTGG + Intronic
1076446345 10:130516746-130516768 GCTCAGCTCTGGGGACCGGGTGG + Intergenic
1076522849 10:131091590-131091612 GATGCTCTCTGGAGCCCTGGGGG + Intergenic
1076523117 10:131093481-131093503 GCTCCTCACCCGGGTCCTGCAGG + Intronic
1076605808 10:131689234-131689256 GAGCCTCTGTGGGCTCCTGGTGG - Intergenic
1076607963 10:131701613-131701635 TCTCCTCACTGGTGTCCTGATGG - Intergenic
1076803078 10:132841505-132841527 CCACAGCTCTGGGGTCCTGGTGG + Intronic
1076861141 10:133139089-133139111 GCTCATCTCTGGGTCCCTGTTGG + Intergenic
1076877721 10:133224815-133224837 GCTTCTCGCTGGAGACCTGGTGG - Exonic
1077297429 11:1832649-1832671 GCACCTCCCTGGGGTCCCGGCGG + Intronic
1077453567 11:2664920-2664942 TCACCTCTCTGGGGCCCTGCGGG - Intronic
1077560017 11:3254276-3254298 GCTCACTTCTGGGCTCCTGGCGG - Intergenic
1077565910 11:3300079-3300101 GCTCACTTCTGGGCTCCTGGCGG - Intergenic
1080438396 11:32267915-32267937 GTTCCTGTCTGGAGTCATGGTGG - Intergenic
1083258528 11:61510666-61510688 GCCCCTCTCTGCGGTGCAGGAGG - Exonic
1083627672 11:64079814-64079836 GCTCCTTCCTGGGGTCCAAGTGG - Intronic
1083679130 11:64343187-64343209 GGTGCTCTCGGGGGTGCTGGAGG + Exonic
1083759965 11:64810365-64810387 GCTCCTCATTGGGGTGCTTGGGG - Intronic
1083879533 11:65541169-65541191 GCTGCTCTCTGGGGGCCGGCTGG - Exonic
1084050422 11:66595875-66595897 GCTCTTCTCTGGAGACCTGAGGG + Intronic
1084179302 11:67438569-67438591 GTCCCTCTCTGGGGTAGTGGTGG - Intronic
1084492827 11:69487743-69487765 GGTGCTGTCTGAGGTCCTGGAGG + Intergenic
1084531173 11:69728745-69728767 GCCCCTCTTTGGGGTCCTGGGGG - Intergenic
1084537349 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG + Intergenic
1084658144 11:70531345-70531367 GCCACTCTTTGGGGTCTTGGAGG + Intronic
1084756415 11:71241661-71241683 GCTGCTCCCTGGGAACCTGGTGG - Intronic
1085314688 11:75537384-75537406 GCTCTTCTCTGGGCTCCCCGAGG + Intergenic
1087182025 11:95150806-95150828 GCTCCAATCTGGGGTCCCGCCGG + Intergenic
1087235524 11:95713970-95713992 ACTCTTCTCTGGGGTGCTGAGGG - Intergenic
1087293386 11:96342582-96342604 TCTCCTCTTTGGGGTACTGTAGG + Exonic
1087334367 11:96824726-96824748 ACACCTCTCTGGGGGCCTTGGGG + Intergenic
1088492408 11:110400874-110400896 GGTCCTCTTTGGGGTCTAGGAGG + Intergenic
1088702350 11:112424684-112424706 CCTCCTCTCTGAGGCGCTGGTGG + Intergenic
1088741285 11:112769481-112769503 CCTCCTCTCTGAGGTGCGGGAGG - Intergenic
1089270277 11:117297114-117297136 GGTCCTGTCTGTGGTCGTGGTGG - Intronic
1089629824 11:119777599-119777621 GGTCTTCTCTTTGGTCCTGGTGG + Intergenic
1091694965 12:2622284-2622306 ACTCCTCACTGTGGTCCTGAAGG - Intronic
1091742498 12:2969839-2969861 ACTGCTCTCTGGGGTTGTGGGGG - Intronic
1091908944 12:4213185-4213207 CCTCCTCTCTGGTGGCCTGTGGG - Intergenic
1092782780 12:12002830-12002852 ACTCCTCTCTGGAGCCCTTGGGG - Intergenic
1093133704 12:15423139-15423161 GCTCCTCTCTTGCATCCTGGGGG - Intronic
1094217776 12:27963129-27963151 GCGCCTCTCTATGGTGCTGGAGG + Intronic
1095652469 12:44628604-44628626 GGGCCTCACTGGGGTCCTGAGGG - Intronic
1096513608 12:52144957-52144979 GCCCCTGTCTGGGATTCTGGGGG + Intergenic
1097697929 12:62792566-62792588 TGTCCTCTCTGGGATCATGGTGG + Intronic
1099948429 12:89272299-89272321 GGTCCTCTCTTGGGTCCTCTTGG - Intergenic
1100271456 12:93029245-93029267 TCTGCTCTCTGGAGCCCTGGGGG - Intergenic
1101756053 12:107621250-107621272 GCTCCCATTTGGGGTCCTGGTGG - Intronic
1102991371 12:117318694-117318716 GCTCCCCTCTCAGGTCCTCGGGG - Intronic
1102998069 12:117364855-117364877 GGACCTCTCTGGGGTTCAGGGGG + Intronic
1103355600 12:120317492-120317514 GCAGCTTCCTGGGGTCCTGGCGG - Intergenic
1104391150 12:128391466-128391488 GCTGGGCTCTGGGGTCCTCGGGG - Intronic
1104676325 12:130714626-130714648 GCTCCACTCTGGGCCCCAGGCGG + Intronic
1104766982 12:131336429-131336451 GGTCCTCTCTGTGGTCTAGGAGG + Intergenic
1104994421 12:132644935-132644957 CTTCCTGTGTGGGGTCCTGGGGG + Intronic
1104994460 12:132645044-132645066 CTTCCTGTGTGGGGTCCTGGGGG + Intronic
1104994500 12:132645153-132645175 CTTCCTGTGTGGGGTCCTGGGGG + Intronic
1104994517 12:132645207-132645229 CTTCCTGTGTGGGGTCCTGGGGG + Intronic
1105439310 13:20402497-20402519 TCGCCTCTCTCGGGTCCTGCGGG + Intergenic
1105950907 13:25228780-25228802 CCTGCTCTCTGGGGTGATGGAGG + Intergenic
1110720324 13:78754138-78754160 GCTCCTCTCTGTGGTACTAGGGG - Intergenic
1110887287 13:80655291-80655313 GCTCTTCTCCGGGGTCTTCGTGG + Intergenic
1112300602 13:98226220-98226242 GCTTCTCTCCTGGCTCCTGGAGG + Intronic
1112810737 13:103215674-103215696 GCTCCTCTCTTGTATCCTTGAGG - Intergenic
1114318089 14:21525377-21525399 TCTCCTCTCTGGGCCCCAGGTGG + Exonic
1116082940 14:40199388-40199410 TCCCCTCTCTGTGGTTCTGGTGG + Intergenic
1117071693 14:52063293-52063315 TCTCCTCTCTGGGATCCTGGGGG - Intronic
1117110427 14:52447314-52447336 GCTCCTCTATCTGGTCCTGGAGG + Intronic
1117623302 14:57609939-57609961 GCTCCTTTCTATAGTCCTGGAGG - Intronic
1119473298 14:74912360-74912382 GCTGATCTCTGGGGTCCAGGTGG - Intronic
1119473306 14:74912397-74912419 GTTGATCTCTGGGGTCCAGGTGG - Intronic
1120825192 14:88948731-88948753 TCTCCTCTCTGAGGTCTTGCTGG + Intergenic
1121315588 14:92959281-92959303 GCTCCTTCCTGGGGCCCTGCGGG - Intronic
1121553996 14:94822606-94822628 GCTCCTCTCTGCTGTCCTCATGG - Intergenic
1121637530 14:95463750-95463772 GCTCCTCTCTGGGGCCCTGCGGG + Intronic
1122278039 14:100605278-100605300 GCTGCTCTTTGGGGCCCTGCTGG - Intergenic
1122290584 14:100678460-100678482 GCCCATCCATGGGGTCCTGGAGG + Intergenic
1122483623 14:102063735-102063757 GCTCCTACCTGGGGTCCAGAAGG + Intergenic
1122671780 14:103378376-103378398 GCTCCTCTCTGGGGAACAGGTGG + Intergenic
1122933483 14:104945352-104945374 GCTCCCTTCTGTGGACCTGGAGG - Exonic
1123070619 14:105640916-105640938 GCTCCTGTGTGGGGTCTGGGCGG + Intergenic
1123762885 15:23446539-23446561 ACTCCTCTGTGGGGTGGTGGAGG + Intronic
1124438692 15:29671751-29671773 GAACCTCTCTGGGGTCCTTGTGG + Intergenic
1124635196 15:31360619-31360641 GCTCCTCCCTGGGGGTCTGGAGG + Intronic
1124651872 15:31480052-31480074 GCTCCACTGTGGGCTCCGGGGGG - Exonic
1124813550 15:32965960-32965982 GCTTATCTCTGTGGTGCTGGGGG + Intronic
1125512883 15:40302349-40302371 GCTGCTCTCTGTGGTCCTGCAGG - Exonic
1125589962 15:40847818-40847840 CTTCCACTCTGGGGGCCTGGTGG + Intronic
1125608599 15:40956279-40956301 GCTCTGCTCTGGGGAACTGGTGG - Exonic
1126038708 15:44570536-44570558 ACTCCTCACTGGGGGCCAGGTGG + Exonic
1126115242 15:45201977-45201999 GCTCCTCTCAGGTGTCCTGAGGG + Intergenic
1126185809 15:45829619-45829641 GTTCCTCCCTGGGGCACTGGAGG + Intergenic
1127901690 15:63345716-63345738 GCCTCTCTCTGGGCTCCAGGGGG - Intronic
1129300652 15:74623690-74623712 GCTCCTCTCTCAGGAGCTGGAGG + Intronic
1129466324 15:75726134-75726156 GCTCCTCCATGGGGACCTGCGGG - Exonic
1129784970 15:78304055-78304077 GGTCCTTTCTGGGGTCCACGAGG - Intergenic
1130031142 15:80315286-80315308 CCTCATCTCTGGGGTCTTGGTGG + Intergenic
1130342260 15:83009703-83009725 GCTATTCTCTGGAGTGCTGGAGG - Intronic
1131070670 15:89463788-89463810 GGCCCTGACTGGGGTCCTGGGGG - Intergenic
1132146582 15:99433079-99433101 GCCCCTCTCTGGGCAGCTGGAGG - Intergenic
1132615658 16:840149-840171 GCCCTTCCCTGGGGCCCTGGAGG - Intergenic
1132676561 16:1123590-1123612 TCTCCCTCCTGGGGTCCTGGAGG - Intergenic
1132677029 16:1125095-1125117 GTTCCTCTCTGGGAGCCTGTGGG + Intergenic
1132933235 16:2469117-2469139 CCTCCTCCCTGGGGAGCTGGCGG + Intergenic
1133209284 16:4254080-4254102 GCTCCTCTCTCGGTCCCTGCGGG - Intergenic
1134167300 16:11941195-11941217 GCTCCTCTTTTGGCTCCTGCTGG - Intronic
1134493398 16:14712488-14712510 GCTCCTCTTTTGGCTCCTGCTGG + Intronic
1134498779 16:14751612-14751634 GCTCCTCTTTTGGCTCCTGCTGG + Intronic
1134525333 16:14938241-14938263 GCTCCTCTTTTGGCTCCTGCTGG + Intronic
1134581797 16:15377473-15377495 GCTCCTCTTTTGGCTCCTGCTGG - Intronic
1134712919 16:16336725-16336747 GCTCCTCTTTTGGCTCCTGCTGG + Intergenic
1134720785 16:16380043-16380065 GCTCCTCTTTTGGCTCCTGCTGG + Intronic
1134946642 16:18331842-18331864 GCTCCTCTTTTGGCTCCTGCTGG - Intronic
1134953901 16:18371957-18371979 GCTCCTCTTTTGGCTCCTGCTGG - Intergenic
1135312722 16:21418835-21418857 GCTCCTCTTTGGGCTCCTACTGG - Intronic
1135365639 16:21851105-21851127 GCTCCTCTTTGGGCTCCTACTGG - Intronic
1135446169 16:22520047-22520069 GCTCCTCTTTGGGCTCCTACTGG + Intronic
1135603137 16:23800485-23800507 GCTCACATCTGGGGTACTGGAGG - Intergenic
1136309397 16:29397594-29397616 GCTCCTCTTTGGGCTCCTGCTGG - Intronic
1136322840 16:29499350-29499372 GCTCCTCTTTGGGCTCCTACTGG - Intronic
1136437524 16:30239318-30239340 GCTCCTCTTTGGGCTCCTACTGG - Intronic
1136990168 16:35147181-35147203 GCTGCTCTCTGGGGCCCCAGGGG - Intergenic
1137587089 16:49670119-49670141 CCTGCACTCTGGGGCCCTGGAGG - Intronic
1137675824 16:50303504-50303526 GCTCATCTCTGGTGGCCTTGTGG + Intronic
1137701936 16:50503684-50503706 GCCCCTCCCTGGGGCCCTGTGGG - Intergenic
1138337172 16:56262274-56262296 GCTCCTATCTGGGTTCCTCCTGG - Intronic
1138597205 16:58035357-58035379 CCTCCACTCTGGGGTCCTGGTGG + Intronic
1141154829 16:81590091-81590113 CCTCCTCTCAGGAGTCCTGCTGG - Intronic
1141157670 16:81608635-81608657 CCGCCTCTGTGTGGTCCTGGTGG - Intronic
1141196581 16:81865629-81865651 GCTGCTGTCTGGGCTCCTGGGGG + Intronic
1141651874 16:85397127-85397149 TCTCCTCTGTGAAGTCCTGGGGG + Intergenic
1141696430 16:85622020-85622042 GTTCCTCACTGGGATTCTGGAGG + Intronic
1142286132 16:89172239-89172261 GCCCCTCTCTGGGGGGCTGGGGG + Intronic
1142391432 16:89803450-89803472 GCAGCTCACAGGGGTCCTGGTGG - Intronic
1142418418 16:89955591-89955613 GATTCCCTCTGGGGTCCTTGAGG + Intronic
1142637776 17:1268548-1268570 GCGCCTCTCCCGGGTCCTCGGGG + Intergenic
1142883980 17:2901415-2901437 CCTCCTCTCATGGGTCCTTGTGG + Intronic
1143375943 17:6467757-6467779 GCTCCTCTGTGGGGTATTGAAGG - Intronic
1143578055 17:7806721-7806743 GTTCCCCTCTGGGGGCCTGAGGG - Intronic
1143626045 17:8110597-8110619 GCTCCTCTCTGGGGTGGAAGTGG - Intronic
1144108573 17:12009292-12009314 GCTCCACTCAGGGTTCCAGGAGG + Intergenic
1146107485 17:30053467-30053489 ACTCCTCTCTGCTGTTCTGGCGG - Exonic
1147627476 17:41909402-41909424 TCTCCTCTCTGGGAGCCAGGTGG - Intronic
1147648740 17:42050246-42050268 CCTCCTCCCCGGGCTCCTGGGGG + Intronic
1147872686 17:43598645-43598667 GCACCTCTCAGGAGTCTTGGAGG + Intergenic
1148080535 17:44965701-44965723 CCTCATCTCTGGGGACCTGCTGG + Intronic
1148851412 17:50557276-50557298 GTTTCTCTCTGGGGTCTTGAGGG + Intergenic
1151161228 17:72167393-72167415 ACTCCTCTCTGGGTTCTTAGGGG + Intergenic
1151376386 17:73691630-73691652 GGGCCTCTCTGGGGTCTGGGAGG + Intergenic
1151453661 17:74213897-74213919 CCTCCTGTCTGGGAACCTGGGGG + Intronic
1151537808 17:74748658-74748680 GGTCCTCTCTCGGCTCCTCGCGG + Exonic
1151816528 17:76474025-76474047 GGCCCTACCTGGGGTCCTGGTGG + Exonic
1151827439 17:76531121-76531143 GATCCTCTCTGGGGTCATTCTGG - Exonic
1151883874 17:76911961-76911983 GCCTCTCTCTGGGTTCCTGGTGG + Intronic
1151902746 17:77027846-77027868 GTTCCTCTCTAGGGGCCTGGAGG + Intergenic
1152284004 17:79402064-79402086 CCTCCACCCTGGGCTCCTGGTGG - Intronic
1152294574 17:79459224-79459246 TCACCTCTATGGGGCCCTGGAGG + Intronic
1152534780 17:80944143-80944165 GCTCGTGTTTGGGGGCCTGGTGG + Intronic
1152558891 17:81068055-81068077 CTGCATCTCTGGGGTCCTGGGGG + Intronic
1152760108 17:82103313-82103335 GCCCCCTGCTGGGGTCCTGGGGG + Intronic
1153123594 18:1762705-1762727 TGTCCTCTCTGGGATTCTGGTGG - Intergenic
1154048195 18:10927430-10927452 GCTCCTCTCCGATGGCCTGGGGG - Intronic
1154118574 18:11633302-11633324 GCTCCTCTTTGGGCTCCTGCTGG - Intergenic
1154251138 18:12746318-12746340 GCTCCCCTCTGGTCTCCTGTGGG + Intergenic
1157225324 18:45857890-45857912 ACTCAGCTCTGGGATCCTGGGGG - Exonic
1157700002 18:49756269-49756291 GCTCCACTCTGGAGTCCAGCCGG + Intergenic
1158223863 18:55180288-55180310 GCTCCACTGTGGGGTCTTGGAGG + Intergenic
1158341614 18:56472608-56472630 GATGCTCACTGGGGTTCTGGAGG - Intergenic
1158564994 18:58547344-58547366 GCCCCTCTCTGGGGTCCCACTGG - Intronic
1160720172 19:593732-593754 GCGCTTCCCTGGGGTGCTGGTGG + Intronic
1160906382 19:1453500-1453522 GCTGCCCTCGGGGGTCCGGGCGG - Exonic
1161380037 19:3959993-3960015 CCTTCTCGCTGGGGTCCCGGGGG - Intronic
1161443625 19:4305711-4305733 TCTCCTCTCTGGATCCCTGGAGG + Intronic
1162003926 19:7765231-7765253 GCTCTTGGCTGGGGTCCTGGTGG + Exonic
1162055104 19:8058014-8058036 CCACCTCTCCTGGGTCCTGGAGG - Intronic
1162139486 19:8577318-8577340 GCTGGTGTCTGGGCTCCTGGAGG + Exonic
1162831357 19:13286627-13286649 GCTATTCTCGGGGGTCTTGGGGG + Exonic
1163642560 19:18469858-18469880 GCTCCTGTCTGGGGTCAGGTGGG - Intronic
1164672516 19:30080789-30080811 GGTCAGTTCTGGGGTCCTGGGGG + Intergenic
1164945601 19:32290656-32290678 ACTCCTGTCTGGGATCCTGTGGG - Intergenic
1165443358 19:35843552-35843574 TCACCTCAGTGGGGTCCTGGAGG + Exonic
1165687152 19:37831620-37831642 GCTGCTCTCTGGTACCCTGGGGG - Intergenic
1165695152 19:37895192-37895214 GCTTCTGTCTGGCATCCTGGGGG - Exonic
1165751840 19:38264952-38264974 GCTCCTCTCTGGGGTCCTGGCGG + Exonic
1166250976 19:41570657-41570679 GCTCCTCCCTGGGGTCCCTGAGG + Intronic
1166669527 19:44701528-44701550 TCCCCTCCCTGGGGTCCTCGGGG - Intronic
1166999664 19:46738428-46738450 GTTGCTCTCAGGGGTCCTTGAGG + Intronic
1167211178 19:48135052-48135074 GCTCCTCTCTGGGTCCCTTAAGG + Intronic
1167334409 19:48875679-48875701 GCTGCTCCCAGGGGCCCTGGCGG - Exonic
1167385007 19:49157938-49157960 CCTCCTCTCTGGGAGCCTGGAGG - Intronic
1167434426 19:49470897-49470919 GGCCCTGTCTGGGGTCCTCGGGG - Exonic
1167616265 19:50535871-50535893 ATGCCTCTCTGGGCTCCTGGTGG - Intronic
1167662415 19:50803751-50803773 GATCCTTGCTGGGGTCGTGGTGG + Exonic
1168251664 19:55145663-55145685 GTCCTTCCCTGGGGTCCTGGGGG - Intronic
1168689826 19:58369541-58369563 GCTGTTCTCTGGGGTCTGGGTGG - Intronic
1202713009 1_KI270714v1_random:27723-27745 GCAGCTCCCTGGGGTCCTGCTGG - Intergenic
925183669 2:1832763-1832785 GCTCCTGTCTTGGCTCCTGAAGG + Intronic
925589243 2:5493552-5493574 TTTCCTCTCCGGGGCCCTGGAGG + Intergenic
925924186 2:8658864-8658886 GCACCTCTCAGGGAACCTGGGGG - Intergenic
926127864 2:10283003-10283025 GCTTCCCTGTGGGGTCCCGGGGG - Intergenic
926703221 2:15818120-15818142 GGGCCTCTCTGGAGTCTTGGGGG - Intergenic
926722393 2:15970893-15970915 TCTCCACTCGGGGCTCCTGGAGG + Intergenic
927937134 2:27082417-27082439 GCTCCTCACTGGGGCCCGGAGGG - Exonic
934916061 2:98302070-98302092 GGGCCACACTGGGGTCCTGGGGG - Intronic
936250229 2:110862730-110862752 GGTCCTCACTGGGGTGCTGAGGG - Intronic
938159652 2:128973738-128973760 GCTGTTCTCGGGGGTCTTGGGGG + Intergenic
938405733 2:131032190-131032212 GCTCCTCTGTGGGGCCGAGGAGG + Intronic
941343552 2:164338383-164338405 CTTCCTCTCTGGTGTCCTAGGGG + Intergenic
943441338 2:187931786-187931808 GGCCCTCTCTGGTGTCCAGGAGG + Intergenic
943736983 2:191366932-191366954 GCTCCACTCTAAGCTCCTGGAGG + Intronic
944407027 2:199396574-199396596 GCTCCTCTCTGAGGACATCGTGG - Intronic
944539579 2:200743026-200743048 GCTCCTCTCTGGGACTTTGGGGG - Intergenic
945097148 2:206230725-206230747 GCTGCACTCTTGCGTCCTGGAGG + Intergenic
945178526 2:207067734-207067756 CATCCTCTCTGGGGTGCTGCAGG + Intergenic
945219955 2:207473460-207473482 GTTCCTCCCTGAGCTCCTGGGGG + Intergenic
945977543 2:216282475-216282497 CCTCCTCTCTGGGGTGGTGGTGG - Intronic
947270811 2:228332715-228332737 TCATCTCTCTGGGCTCCTGGTGG + Intergenic
948159259 2:235810786-235810808 TGTCCTTTCTGGGGTCTTGGAGG + Intronic
948556493 2:238814778-238814800 CCTCCTCTATGGGGCTCTGGTGG + Intergenic
948610558 2:239163752-239163774 CCTCCTCTCTGGGGGCCCAGAGG - Intronic
948851660 2:240711315-240711337 TCTCCTGGCTGGGGGCCTGGCGG + Intergenic
948868442 2:240786672-240786694 CATCCCCTCAGGGGTCCTGGTGG - Intronic
1170158034 20:13286266-13286288 GCACCTCTCTGGTGCCCTTGGGG + Intronic
1170714268 20:18818275-18818297 GCTCTTCTCTGGGGGCTTGAGGG + Intronic
1170795606 20:19544272-19544294 GCACCTCTCAGGGGTCCTTGAGG - Intronic
1170874452 20:20237214-20237236 GGTGCTCTCTGGAGTCCTCGGGG - Intronic
1171448414 20:25220444-25220466 ACTCCCTGCTGGGGTCCTGGGGG + Intronic
1171892015 20:30725275-30725297 GGTCCTCTCAGGGGCCATGGTGG + Intergenic
1172055449 20:32151322-32151344 GCCCTTCTCTGGCCTCCTGGAGG + Intronic
1172083407 20:32359219-32359241 GCTCCTCCCTCGCTTCCTGGTGG + Intronic
1172146821 20:32762975-32762997 TCTCCTCTTCGGGCTCCTGGAGG - Intronic
1172613620 20:36268917-36268939 GCCCCTCTATGGAGGCCTGGAGG + Intronic
1173656659 20:44704380-44704402 GCTCCTCGGTGGGGCCTTGGGGG + Intergenic
1174171618 20:48621205-48621227 GTTCCACTTTGGGGCCCTGGAGG + Intergenic
1174594644 20:51674253-51674275 GATCCTCTTTGGTGCCCTGGTGG - Exonic
1175217824 20:57400746-57400768 ACCCTTCTCTGGGGTCTTGGTGG + Intronic
1175308193 20:57992443-57992465 TCACCTCCCTGGGTTCCTGGAGG + Intergenic
1175421218 20:58835075-58835097 GGTCCTCTCTGGGGAACAGGCGG + Intergenic
1175810328 20:61854231-61854253 ACCCCTCTCTGGGGGCCTGCAGG - Intronic
1176164143 20:63664139-63664161 GCTCCTGTCAGGGAACCTGGGGG - Intronic
1176311586 21:5153662-5153684 GCTCCTCCCTGAGGTCCTGAGGG - Intronic
1176666264 21:9690188-9690210 TCTCCCCTCTGGGTTCATGGAGG + Intergenic
1176869736 21:14075197-14075219 GCACCTCTCTGCGGCCATGGGGG - Intergenic
1177209250 21:18049814-18049836 GCTGCATTATGGGGTCCTGGGGG + Intronic
1178104696 21:29304702-29304724 ACACCTCCCTAGGGTCCTGGAGG - Intronic
1179112742 21:38461396-38461418 GTCCCACTCTGAGGTCCTGGGGG + Intronic
1179605009 21:42509503-42509525 TCTCCTCACTGGGCTCCTGTAGG + Intronic
1179731144 21:43367982-43368004 ACTCCTCTCTGTGTCCCTGGGGG - Intergenic
1179845464 21:44108373-44108395 GCTCCTCCCTGAGGTCCTGAGGG + Intronic
1179988299 21:44932901-44932923 GCTGCGCTTGGGGGTCCTGGCGG - Intronic
1179992377 21:44954714-44954736 GCTCTTCTCTGCGGTGCTGCTGG + Intronic
1180159463 21:45992633-45992655 GCCCCTCCCAGGGGTCCTGCTGG + Intronic
1180910933 22:19449452-19449474 TCTCCTCTCTGGAGTGTTGGAGG + Intergenic
1180955310 22:19738784-19738806 GATTTTCTCTGGGATCCTGGAGG + Intergenic
1180956509 22:19743702-19743724 GCTCCACCCTGGGGTGCTGGGGG - Intergenic
1181037070 22:20174809-20174831 GCTCCTGGCTGGGGTCCAGGTGG + Intergenic
1181310130 22:21940061-21940083 GCTCCATTCTGAGGTACTGGGGG - Intronic
1181826426 22:25519936-25519958 GCTCATGTCTGGGGCCCCGGGGG + Intergenic
1183099821 22:35576985-35577007 GCTCCTCTCCGGGGTGCTCATGG + Intergenic
1183297316 22:37037870-37037892 CCTCCTCCCTTGGCTCCTGGCGG - Intergenic
1183704286 22:39467377-39467399 GATCCCCTCTGCGGCCCTGGGGG + Intronic
1183744624 22:39685556-39685578 GCTCCTCTCGGGGGACCTCTCGG + Intronic
1184228360 22:43143515-43143537 GCTGCGTTCTGGGGTCCTGGAGG + Intergenic
1184264134 22:43337737-43337759 ACTCCTCCCTGGGATGCTGGTGG - Intronic
1184507989 22:44915772-44915794 GCTCCCCTCCGAGCTCCTGGTGG - Intronic
1184593118 22:45498988-45499010 GCTCCCCTGTGTGGTCCTGAAGG + Intergenic
1184731539 22:46373605-46373627 GCTCCCCTCTGGGTCCCGGGAGG + Intronic
1184829129 22:46972845-46972867 TCCTCTCTCTGGGGTGCTGGGGG - Intronic
1184970056 22:48013052-48013074 GCTCTCCTCTGGAGCCCTGGAGG - Intergenic
1185327371 22:50233504-50233526 GCTCCTCTCTGTGGCCAGGGGGG + Exonic
1185369706 22:50455419-50455441 GCTCCTCGCTGACCTCCTGGCGG - Intronic
1185402206 22:50625092-50625114 GCTCCTCACTGGGAGCCTGTGGG - Exonic
950194356 3:10998743-10998765 GCTTCCCTCTGGGGTGCAGGGGG + Intronic
950345375 3:12287977-12287999 GCCCCTCTCCGGTGTCCTCGAGG - Intronic
950578894 3:13850292-13850314 GCTCCTCTCTGCTGTCCCGAGGG - Intronic
953026978 3:39151166-39151188 CCCCCTCCCTAGGGTCCTGGAGG + Intronic
953246734 3:41199878-41199900 CTGCCTCTCTGGGGCCCTGGGGG + Intronic
953349324 3:42202772-42202794 GCCCCTCTCTGTCCTCCTGGGGG + Intronic
954378695 3:50208091-50208113 CCTGCTCTGTGGGGACCTGGAGG + Intronic
954433237 3:50482503-50482525 GCTCCTCTTTGGGTCCTTGGAGG - Intronic
956244019 3:67160827-67160849 GCTCTTCTCTGGAATCCTTGGGG + Intergenic
956742930 3:72289158-72289180 CCTCCTCCCTGGGCTGCTGGGGG + Intergenic
956753217 3:72361463-72361485 GCTCCTCTCTTAGTTCCCGGTGG + Intergenic
957071148 3:75568807-75568829 TCTGCACTCTGGTGTCCTGGGGG - Intergenic
961329268 3:126129163-126129185 GCTCCTCTCTGGGGCTCTAAGGG + Intronic
961580420 3:127876153-127876175 ATTCCTCTCTGGGCTTCTGGGGG - Intergenic
961648610 3:128406047-128406069 GCCCCACTGGGGGGTCCTGGTGG - Intronic
961862490 3:129927743-129927765 TCTCCTCTGTCGTGTCCTGGCGG - Intergenic
962707843 3:138062434-138062456 GTTCCTATCTGGGGTCCTTTTGG - Exonic
962829153 3:139124346-139124368 GCTCCTCTCTGGTAACCTGATGG + Intronic
964376208 3:156051717-156051739 GCCCCTCTCTGGGCTGGTGGAGG + Intronic
966190013 3:177263655-177263677 GCTCCTCTCTCCAGTCCTGGGGG - Intergenic
967089620 3:186124526-186124548 TCTCATGTCTGGGGTCCTGATGG + Intronic
967180725 3:186901398-186901420 GCCCCTCTCTGAGTTTCTGGTGG + Intergenic
968654266 4:1771854-1771876 GCTCCTCTCTGGGCCTCTGTGGG - Intergenic
968660398 4:1796440-1796462 GCAGCTCTCTGGGGTACAGGAGG - Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968964846 4:3764696-3764718 GCTTCTCTCTGAGCTCCTGAAGG - Intergenic
969174751 4:5390020-5390042 GCTCCTCTGTGGGCTCCAGAAGG + Intronic
969582044 4:8071312-8071334 GCTCCTTGCTGGGGTCCTGTGGG - Intronic
971213917 4:24646131-24646153 GGACCTCTCTGGGGACCAGGAGG + Intergenic
972161054 4:36227971-36227993 GCCCCTCTTTGGGGTCCCAGAGG + Intronic
972245726 4:37244246-37244268 GATTGTCTCTGGCGTCCTGGAGG - Exonic
972881896 4:43434835-43434857 CCTCATCTCTTGGCTCCTGGTGG - Intergenic
974186744 4:58456871-58456893 TCTCCTCTCTGGGCTGGTGGAGG + Intergenic
974187962 4:58465061-58465083 GCCCCTCTCTGGGCTGGTGGAGG + Intergenic
974459879 4:62173578-62173600 TCTCCTCTCTGAGGTGGTGGTGG - Intergenic
975396747 4:73883762-73883784 GCTCTTTTTTGAGGTCCTGGGGG - Intergenic
976478913 4:85516112-85516134 GCACATCTTTGGGGTGCTGGAGG - Intronic
978194731 4:105957611-105957633 GCTAGTCTCTGAGGTCCTGGAGG - Intronic
981096866 4:140791049-140791071 GTTCCTCTTTGGGGTCTGGGTGG + Intergenic
985420232 4:189777909-189777931 GCCCCACTCTGGTGTCATGGCGG - Intergenic
985544252 5:501192-501214 GCTTCTCTCTGGGCCCCGGGGGG + Intronic
985883478 5:2658082-2658104 GCTCCACTGGGAGGTCCTGGAGG - Intergenic
986078491 5:4363430-4363452 GTTCTTATCTGGGGTCCTGCTGG - Intergenic
986679129 5:10217633-10217655 GCCCCTCTCTGGGGCCGTGCAGG - Intergenic
987097142 5:14560205-14560227 GTTCCTCTCTGGTTTCCTGTCGG + Intergenic
988053621 5:26062919-26062941 GCTCCAATCTGGGGTAGTGGGGG - Intergenic
988540080 5:32100594-32100616 GAAGCTCTCTGGGTTCCTGGGGG + Intronic
989111032 5:37906847-37906869 GCTCCTTGGTGGTGTCCTGGGGG + Intergenic
989242300 5:39215510-39215532 GCTCCTCTCAGGGATCTTTGGGG + Intronic
991505375 5:67318802-67318824 GCTCCTCTCTGGGCTCGCCGAGG + Intergenic
992777645 5:80102566-80102588 GATCCTCTTTGGGGTCCAGAAGG - Intergenic
994768693 5:103954231-103954253 GCCCCTCTCTGGGCTGGTGGAGG - Intergenic
994898843 5:105744431-105744453 GATCCTGTCTGGTGTCCAGGAGG - Intergenic
996054595 5:118968989-118969011 GCTCCTCTGGGGAGTCCAGGAGG + Intronic
996298610 5:121954372-121954394 GCCCCTCTCTGGGCTGCCGGAGG - Intergenic
996308395 5:122077099-122077121 GCTCCACTCTGCAGTCCCGGTGG - Intronic
997980699 5:138465913-138465935 GCTGCCCTCTGGGGCCCCGGCGG - Exonic
999266302 5:150269159-150269181 CCTCCTGCCTGGGGACCTGGGGG + Intronic
1000318938 5:160118818-160118840 GCTCTTCTCCGGGGTCCTCATGG - Exonic
1002496280 5:179614010-179614032 ACTCGTCTTTGGGGCCCTGGTGG - Intergenic
1002522744 5:179800563-179800585 GATCCATTCTGGGCTCCTGGAGG - Exonic
1002874332 6:1198294-1198316 GCACCTCTGTGGAGTCCTGCTGG + Intergenic
1002900125 6:1404246-1404268 CCTCGGCTCTGGGCTCCTGGAGG - Intergenic
1003126877 6:3362774-3362796 CTTCCTCTCCTGGGTCCTGGAGG - Intronic
1003270458 6:4603293-4603315 GCCCCTCCCAGGGCTCCTGGAGG - Intergenic
1005342585 6:24857227-24857249 GCTCTTGTCTGGGGGCCTGCTGG + Intronic
1005813383 6:29532315-29532337 GCTGCTCTCTGGGGGCCCTGGGG + Intergenic
1007249251 6:40484479-40484501 GCTCTTCTCTGGGGTCCCCTGGG - Intronic
1008740617 6:54602982-54603004 GTTCTTCTCTGAAGTCCTGGAGG - Intergenic
1011899514 6:92274998-92275020 ATTCCTGTCTGGGGTCCAGGAGG + Intergenic
1013235926 6:108197906-108197928 CCTCCTCTTTGGTGTCTTGGTGG + Intergenic
1013896699 6:115097404-115097426 GGTCCTGTCTGGGGTGATGGGGG - Intergenic
1014153237 6:118082959-118082981 TCTCCCCTCAGTGGTCCTGGTGG - Intronic
1015126594 6:129762109-129762131 GCCCCTGTCTGGGGGCCTGGAGG + Intergenic
1018848425 6:167571107-167571129 GCTCAACGCTGGGCTCCTGGGGG + Intergenic
1019036128 6:169061174-169061196 TCTACCCTCTGGGGTCCTGTAGG + Intergenic
1019275907 7:175485-175507 GCCCCTCTCTATGGTCCTGGGGG - Intergenic
1019559499 7:1648937-1648959 GCCCCATTCTGAGGTCCTGGGGG + Intergenic
1019736926 7:2655044-2655066 GCCCCTTTCTGAGGTCCTGGGGG + Intronic
1020059962 7:5144441-5144463 GCACTGCACTGGGGTCCTGGGGG - Intergenic
1020455761 7:8372232-8372254 TCATCTCTCAGGGGTCCTGGGGG - Intergenic
1024095790 7:45981383-45981405 GCTGCTCCCGGGGCTCCTGGAGG - Intergenic
1024626085 7:51209429-51209451 GCCCCGCTGTGGGGTTCTGGAGG - Intronic
1025092950 7:56078290-56078312 CCTACCCTCTGAGGTCCTGGGGG - Intronic
1025209344 7:57011900-57011922 CATCCTCCCTGGGGTCCAGGTGG - Intergenic
1025662601 7:63564954-63564976 CATCCTCCCTGGGGTCCAGGTGG + Intergenic
1026023394 7:66727689-66727711 GCCCCTCGCAGGGGTCCTGGCGG + Intronic
1026671977 7:72398709-72398731 GCTCCTCTTAGGGGTCCTGGGGG + Intronic
1026888195 7:73966881-73966903 GCCCTTCGCTGGGGTCCTGGCGG + Intergenic
1026930679 7:74221514-74221536 GCTCCTCTTGGGGGCCATGGGGG - Intronic
1026968880 7:74455833-74455855 TTTCCTCTGTGGGGTCCTGTGGG - Intronic
1027432373 7:78127524-78127546 ACTCCTCTCGGTGGTCCTGTTGG + Intronic
1029839155 7:103344258-103344280 GAACCTTTCTGGGGTGCTGGGGG + Intronic
1032065787 7:128769314-128769336 CCTCCTCTCTGAGGGACTGGAGG + Exonic
1032078343 7:128846593-128846615 GGGCCAATCTGGGGTCCTGGAGG - Intronic
1034470766 7:151253259-151253281 CCTCCTCTATGGGGTCCTCAGGG + Intronic
1034549039 7:151808795-151808817 GCTCCTCCCTGGCTGCCTGGAGG - Intronic
1035067928 7:156121647-156121669 GCTCCTCACAGGGGCCCTGCTGG - Intergenic
1035276896 7:157753285-157753307 GTTCCTCTGTGGGGTCCAGTGGG - Intronic
1037469341 8:19191978-19192000 GCTCCTCACTGGGGATCTCGTGG - Intergenic
1037885931 8:22596357-22596379 TCTCCTCCCAGGGGTCCTGAGGG + Intronic
1038672114 8:29591008-29591030 CTTCTTCTCTGGGATCCTGGTGG + Intergenic
1039917624 8:41871595-41871617 GCCCCTCTCCTGGCTCCTGGTGG - Intronic
1040278928 8:46028035-46028057 GCACCTCTCTGTGGCCATGGTGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1048254641 8:132896504-132896526 GCTCCTCACCAGGATCCTGGAGG - Intronic
1049268345 8:141681406-141681428 ATTCCTCTCTGGGGTCTCGGAGG - Intergenic
1049317171 8:141975479-141975501 GCTCCTCTCTGGGATGTTAGGGG + Intergenic
1049400912 8:142426814-142426836 GCTCCTCCCTGGGGCCCAGCGGG + Intergenic
1049478291 8:142806989-142807011 GGGTCTCTCTGGGGTTCTGGAGG + Intergenic
1049482848 8:142835049-142835071 GCTCCTCTCAGGGGTGCCAGGGG + Intronic
1049482888 8:142835161-142835183 GCTCCTCTCAGGGGTACTGGGGG + Intronic
1049569719 8:143363614-143363636 GTTCCTCCCTGAGCTCCTGGGGG + Intergenic
1049583610 8:143423273-143423295 CCTCCTCTCAGGGACCCTGGAGG + Intronic
1052330390 9:27261406-27261428 GCTCCTTTCTGGAGTCATGATGG - Intergenic
1055563779 9:77548181-77548203 GCTCCTCTCCCAGCTCCTGGTGG + Intronic
1055582459 9:77721498-77721520 GCATCTCTCTGGGGTCCTTTCGG + Exonic
1057063426 9:92026277-92026299 GTCCCTCTCAGGGCTCCTGGAGG - Intergenic
1057704135 9:97385872-97385894 GCTCTGCTCTGGGGGCCTGGTGG + Intergenic
1057716840 9:97502121-97502143 GCCCCGGGCTGGGGTCCTGGCGG + Intronic
1058577190 9:106416241-106416263 GTCCCTTTCTGGGGTTCTGGAGG - Intergenic
1059191898 9:112334062-112334084 CCTCGTTTCTGGGGTCCTTGTGG - Intergenic
1059433825 9:114264927-114264949 GGTCTGCCCTGGGGTCCTGGAGG - Exonic
1060199804 9:121645822-121645844 CCTCTTCTCTGGGCTTCTGGAGG + Intronic
1060435056 9:123586122-123586144 GGTCCTCTGTTGTGTCCTGGAGG - Intronic
1060996738 9:127878231-127878253 GGTGGTCTTTGGGGTCCTGGCGG - Intergenic
1061133500 9:128721055-128721077 GCTCCGTTCTGGGGTCTGGGAGG + Exonic
1061812097 9:133168072-133168094 GCTCCTCTCCCAGGTGCTGGGGG - Intergenic
1061813972 9:133182169-133182191 GCTCCATGCTGGGGGCCTGGTGG + Intergenic
1061814856 9:133188574-133188596 GCTCCCTGCTGGGGGCCTGGCGG + Intergenic
1061859343 9:133460159-133460181 TCGCCTGTCTGGGGTGCTGGGGG + Exonic
1062078518 9:134605755-134605777 CCTGCTCTCTGGGGACCTAGGGG - Intergenic
1062166737 9:135111596-135111618 GCTCCTGTGTGGGGTCCCTGTGG + Intronic
1062725573 9:138071581-138071603 GCTTCTCTCGGGGCTCCTGTGGG - Intronic
1203659835 Un_KI270753v1:31573-31595 TCTCCCCTCTGGGTTCATGGAGG - Intergenic
1185460977 X:332701-332723 GGTCCTGTCGGGGGTCCTCGTGG - Intergenic
1186468533 X:9803513-9803535 ACCCTTCTCTGGAGTCCTGGGGG - Intronic
1187245118 X:17547011-17547033 TTTCCTCCCTGGGGTCCAGGAGG + Intronic
1187578184 X:20580059-20580081 GCTTCTCTCCTGGGTCCTGATGG + Intergenic
1188262111 X:28034359-28034381 GCTCCTCCCTGGTATCCTGGAGG - Intergenic
1188416803 X:29945132-29945154 TCTCCTCTCTGTGGCCCTGAGGG + Intronic
1188434478 X:30145237-30145259 ACTCCTCTCTGGAGCCCTGAGGG - Intergenic
1192213860 X:69144379-69144401 GATGCTCTCTGGACTCCTGGAGG + Intergenic
1192245541 X:69368889-69368911 CCTGCTCTCCTGGGTCCTGGAGG - Intergenic
1192436937 X:71148758-71148780 GCTCAGCTCTTGGGGCCTGGGGG + Intronic
1192719629 X:73678487-73678509 GATAGTCCCTGGGGTCCTGGGGG + Intronic
1194765164 X:97841511-97841533 GCTGCCATCTTGGGTCCTGGAGG - Intergenic
1195322402 X:103730274-103730296 GCTCCTTGCTGGGGGTCTGGCGG + Intergenic
1195399484 X:104446418-104446440 GCTTCTCTCTGGGATCCCTGAGG + Intergenic
1199815628 X:151394594-151394616 GTTTCACTCTGGGGTACTGGGGG - Intergenic
1200051832 X:153436886-153436908 GCTCCATTCTGAGGTACTGGGGG - Intergenic
1200146722 X:153930227-153930249 GCTTCTCCCTGGGTTCCTGGTGG - Intronic