ID: 1165752074

View in Genome Browser
Species Human (GRCh38)
Location 19:38266248-38266270
Sequence GGCTGCAGCCAGATGGCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165752074 Original CRISPR GGCTGCAGCCAGATGGCCTA GGG Intronic
900342047 1:2194117-2194139 GGCGGCCGCCAGAAGGCCTGGGG + Exonic
901202200 1:7473189-7473211 GGCTGCAGGGAGAGGCCCTAGGG + Intronic
901529203 1:9843037-9843059 GGAGGCAGCCAGATGGCTCAGGG + Intergenic
902374337 1:16023227-16023249 GGCTGCAGCCAGCGGGCCAGGGG + Intronic
902538444 1:17135436-17135458 GGCCCCAGCCAGAAAGCCTAAGG - Intergenic
902747232 1:18482108-18482130 AGCTGCAGCCAGATGGCTTCCGG + Exonic
903038647 1:20511886-20511908 AGCTGCAGCCAGATGTCCCTAGG + Intergenic
903533691 1:24052307-24052329 GGCTGGAGCCAGAGGAGCTAAGG - Intergenic
904743336 1:32695390-32695412 AGCTGGAGAGAGATGGCCTAAGG - Exonic
905927673 1:41763376-41763398 TGCTGCAGCCAGATGGAGTGTGG - Intronic
907372073 1:54010219-54010241 GGCAGCAGCCAGAGGGCAAAGGG - Intronic
908036589 1:60061099-60061121 GGATGCATCCACATGGTCTATGG + Intronic
910791393 1:91054752-91054774 GGCAGCAGCCAGATGGTGCAGGG + Intergenic
910844578 1:91592999-91593021 GGCTGCAGGCAGATTGCCGAGGG + Intergenic
912465874 1:109873390-109873412 GGCTGGAGCCACATGGGCAAGGG + Intergenic
912582867 1:110735977-110735999 GGCTGCAGCAAGATTGCCTATGG - Intergenic
915819394 1:159005873-159005895 GAGAGCAACCAGATGGCCTAAGG + Intronic
915932051 1:160066959-160066981 GGCTGCAGCTAGAAGGACTTAGG - Intronic
916612815 1:166409868-166409890 GGCTGAAGCCAGAGAGCCAAGGG - Intergenic
917510330 1:175664179-175664201 AGCTACAGCCAGCTGGCCTCTGG + Intronic
918160809 1:181897631-181897653 GCTTGCAGACAGACGGCCTATGG - Intergenic
921320521 1:213934167-213934189 GCCTGAAGCCAGAAGGCCTCGGG - Intergenic
921762248 1:218929698-218929720 GGCTAGAGCCACATTGCCTATGG - Intergenic
922388737 1:225115651-225115673 GGCTGCAGCCAGATTGATTCTGG + Intronic
922480595 1:225937845-225937867 GGCTGAAGTCAGAAGGCCTGGGG + Intronic
923125150 1:231028142-231028164 GGATGCAGCCAGAGGGTCTGTGG - Intronic
1062832392 10:614473-614495 GGCTGCAGCCAGAGGCCTAAGGG + Intronic
1066031924 10:31436486-31436508 GTCCGGAGCCACATGGCCTAGGG + Intronic
1070830357 10:79414497-79414519 AGCTGCAGTCACATGACCTAGGG + Intronic
1071515199 10:86292398-86292420 CCCTGCAGCCACATGCCCTAGGG + Intronic
1071731419 10:88252492-88252514 GGCTGTGGCCAGAGGGGCTAGGG + Intergenic
1071745367 10:88412658-88412680 GGCTCGAGTCAGATGGCATAGGG + Intronic
1072374487 10:94800734-94800756 GGCTGCAGCCAGGTGGGGGAAGG - Intronic
1072434170 10:95400474-95400496 GGCTGCTTCCATATGGACTATGG + Intronic
1073454308 10:103627305-103627327 GCATGGAGCCAGATGGCCTGGGG + Intronic
1073477389 10:103763238-103763260 GGCTGCAGGCTGATGGCTGAGGG - Intronic
1075240722 10:120775968-120775990 GGATGCAGCCAGGAGCCCTAGGG - Intergenic
1077423847 11:2465383-2465405 TCCTGCAGCCAGGTGGCCTTAGG + Intronic
1083611332 11:64005819-64005841 GGCTGGAGACAGAGGGCCTTGGG + Intronic
1083871573 11:65491346-65491368 AGATGCAGGCAGATGGCCTCTGG - Intergenic
1084433323 11:69123473-69123495 GGCTGCAGCCCGCTGGCGTGAGG - Intergenic
1084769850 11:71335497-71335519 GGCTTCTGCCAGCTGGCCTCTGG + Intergenic
1086435150 11:86772897-86772919 GGCTGCAGCCAGATTGCAGTAGG - Intergenic
1087993764 11:104778749-104778771 GGCTGCAGGCTGATGACTTATGG - Intergenic
1088817695 11:113432984-113433006 GTCTGCAGCCGCCTGGCCTAGGG - Intronic
1089335796 11:117722974-117722996 TTCTGGAGCCAGATGGCCTGAGG + Intronic
1089405566 11:118194630-118194652 TGTTGCAGCCAGATGGTCTTGGG - Intronic
1090427571 11:126619360-126619382 GGCGGAAGCCAGATGGTGTAGGG + Intronic
1090920105 11:131199329-131199351 GGCTGCACCCAGATCTCCTGAGG + Intergenic
1091863769 12:3811489-3811511 GGCTGCAGCCTGCTATCCTAAGG + Exonic
1092406848 12:8227497-8227519 ACCTGCAGCCAGCTGGCCTCGGG - Exonic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1095949743 12:47775398-47775420 GGCAGCAGCCAGCTGGAGTAGGG + Intronic
1102191487 12:110992048-110992070 GGCTGAAGCCAGCTGGCTGAAGG - Intergenic
1102865379 12:116370003-116370025 GGCTGGAGCTTGATGGCCTGGGG + Intergenic
1103376784 12:120462771-120462793 GGCTGAAGGCAGAGGGCCTGGGG - Exonic
1103961560 12:124611964-124611986 GGCAGCAGCCAGTTGTCCCATGG - Intergenic
1106836773 13:33643399-33643421 GGCCACAGCCAGCTGGACTAGGG + Intergenic
1107171925 13:37353159-37353181 GGCTGGAGCCAGAGGGGATAGGG - Intergenic
1113198555 13:107838167-107838189 GGCTACATTCAGAGGGCCTATGG - Intronic
1113542587 13:111120857-111120879 GAGTGCAGCCAGATGACCTGGGG - Intronic
1114443560 14:22770522-22770544 GCCTGCAGACAGGTGGCCTCTGG + Exonic
1116861488 14:49999260-49999282 GGCTGCAGGGAGGTGGCCTAGGG - Intronic
1117754348 14:58958630-58958652 GGCTGAAACCAGATGGTCCAAGG - Intergenic
1119270814 14:73302851-73302873 AACTGCGGCCTGATGGCCTAGGG - Intronic
1120899872 14:89566717-89566739 GGCTTCACCCAGGTGTCCTAGGG - Intronic
1122287081 14:100658517-100658539 GGCTGCAGCCAGGAGGGCAAAGG + Intergenic
1123553065 15:21400446-21400468 GGCTGCATCCTGATGGCTGATGG - Intergenic
1123589310 15:21837834-21837856 GGCTGCATCCTGATGGCTGATGG - Intergenic
1127716013 15:61650117-61650139 GGCTGCAGCCAGACTGTCAAGGG - Intergenic
1128680887 15:69650547-69650569 GGCAGCAGCTAGACGGCATAGGG - Intergenic
1128745269 15:70110064-70110086 GGCTGCAGGCAGGTGGGCTGGGG - Intergenic
1130854518 15:87829837-87829859 GGAAGCAGCCAGAGGGCCTTGGG + Intergenic
1131176052 15:90210498-90210520 TGCTGCAGCCAGGTGGCCCAGGG + Intronic
1131588491 15:93721809-93721831 TGATACAGCCAGATGGCCTGGGG - Intergenic
1132103895 15:99049196-99049218 GGCTGCATCCCAGTGGCCTAGGG + Intergenic
1202961413 15_KI270727v1_random:127666-127688 GGCTGCATCCTGATGGCTGATGG - Intergenic
1132691077 16:1182225-1182247 GGCTGCACCCAGGTGGGCTGAGG - Intronic
1132717736 16:1300678-1300700 GGCTGCAGCCAGGTGGGGTTGGG - Intergenic
1133347518 16:5080707-5080729 ACCTGCAGCCAGCTGGCCTCGGG - Intronic
1133774891 16:8888516-8888538 GTCTGCATCCAGAAGGCCTGGGG - Intergenic
1135654820 16:24238778-24238800 GGCTGCAGCCAGATCACACAGGG + Intergenic
1136233746 16:28902574-28902596 GGCTGCACCCACATAGCCTGTGG - Exonic
1136454944 16:30375114-30375136 GGCTGGTGCCAGAGGGCCTTAGG - Intronic
1139598021 16:67969143-67969165 GGCTGCAGCTAGAGGGCCCAGGG - Intronic
1140199920 16:72886813-72886835 CCCTACAGCCAGATGGCCCAGGG + Intronic
1140491074 16:75336332-75336354 GGCTGCAGCTAGAGTGCCTGGGG + Intronic
1141992633 16:87619413-87619435 GCCTGCAGCCAGGTGGGCTGGGG - Intronic
1142137205 16:88456895-88456917 GGCCCTACCCAGATGGCCTAGGG - Intronic
1142150187 16:88509288-88509310 AGCTGGACCCAGCTGGCCTATGG + Intronic
1143092006 17:4454380-4454402 GTCTGCAGCCACAGGGCCCAGGG - Intronic
1143378022 17:6478735-6478757 GGCTGCAGACAGGGGGCCCAAGG + Exonic
1143981251 17:10872004-10872026 GGCTGCAGTCAGAGGGCTCATGG - Intergenic
1144886209 17:18464239-18464261 GGCGGCAGGCAGATGGCCCAGGG + Intergenic
1145145999 17:20480130-20480152 GGCGGCAGGCAGATGGCCCAGGG - Intergenic
1145980391 17:29007689-29007711 GGCAGCAGGCAGATGGCGTGTGG + Intronic
1146005776 17:29159721-29159743 GGCAGCAGCCAGGTACCCTAGGG + Intronic
1146546551 17:33743707-33743729 GGATTCAGCCTGATGGCCTTTGG + Intronic
1148211404 17:45810955-45810977 GGGAGCAGCCAGGTGGCCCAAGG - Intronic
1148232059 17:45942437-45942459 GGCTGCATCGAGAGGGCCAAGGG + Intronic
1148643316 17:49204385-49204407 AGCTGTAGCCACATGGCCGATGG + Intronic
1148907410 17:50920033-50920055 GGCTGCAGGCTGGTGGCCTAAGG + Intergenic
1149851401 17:60037670-60037692 TGCTGCAGTGAGATTGCCTAGGG + Intergenic
1150491021 17:65574403-65574425 GGCTGCAGCCAGGTGACCCCTGG + Intronic
1152426876 17:80222811-80222833 GGCTGCATCCAGCTGGCCATGGG + Exonic
1152521870 17:80861229-80861251 GGCTGAAGGCAGACGGCCGAAGG - Intronic
1152542315 17:80982474-80982496 TCCTGCACCCAGAAGGCCTAGGG + Intergenic
1152738986 17:82010950-82010972 GACTGCAGCCACCTGGCCTGCGG + Intronic
1155962444 18:32005986-32006008 GTATACATCCAGATGGCCTAAGG + Intergenic
1156265154 18:35481186-35481208 GGCTGCTGCCAGCTGACCTGTGG - Intronic
1156309466 18:35908974-35908996 GCCTGCAGCCAGAAGGCCGTGGG + Intergenic
1161575612 19:5052764-5052786 GGCAGCAGCCTGAAGGCCCATGG + Intronic
1161659666 19:5538193-5538215 GACTGCAGCCATGTGACCTACGG + Intergenic
1162806098 19:13138752-13138774 GGCTTCCGCGAGGTGGCCTAGGG - Exonic
1162842054 19:13363840-13363862 GTCTGCACCCAGATGGCCAGTGG + Intronic
1163663507 19:18592366-18592388 TGCTGCAGCCAGTGTGCCTAGGG + Intronic
1165079511 19:33299400-33299422 GGGTGTAGCCACATGGTCTAGGG + Intergenic
1165752074 19:38266248-38266270 GGCTGCAGCCAGATGGCCTAGGG + Intronic
1166653323 19:44591818-44591840 GTATACATCCAGATGGCCTAAGG - Intergenic
1167012661 19:46819140-46819162 GTCTGGAGCCAGAGAGCCTAAGG - Intergenic
1168104095 19:54156064-54156086 GGCTGCTTCCAGCAGGCCTAAGG - Intronic
925309938 2:2875216-2875238 GGCTGCACCCAGGCGGCCTGGGG - Intergenic
927101171 2:19788903-19788925 GGCTGTACCCAGAGAGCCTAAGG + Intergenic
929111334 2:38407558-38407580 GGCTGCTGACAGATGGTCTGTGG - Intergenic
929582144 2:43088262-43088284 TGCTGCAGCCAGATGGCAGCTGG + Intergenic
929946845 2:46378136-46378158 GACTGCTGCCAGATGGCTGAAGG + Intronic
930717746 2:54608610-54608632 GGATGGAGCCAGATGGGCGAGGG + Intronic
931483896 2:62671117-62671139 GGATGCAGCCAGTTGTCTTATGG - Intergenic
934731458 2:96661285-96661307 GGCTGCAGGCAGATCTCCCATGG + Intergenic
934891362 2:98072941-98072963 TGCTGCAGCCAGAAGACATAAGG + Intergenic
935499239 2:103818336-103818358 GGCTGAAGCCAGAATGCCTGTGG + Intergenic
938365368 2:130729315-130729337 GGCTGCAGCCAGCAGGCTTGAGG - Exonic
939703454 2:145422004-145422026 GGCTCCAGCCAACTGGCCTGTGG + Intergenic
940259272 2:151763831-151763853 GGCTTCAGCCACATGGGCTTGGG - Intergenic
948268552 2:236656662-236656684 GGCTGGATCAAGGTGGCCTAGGG + Intergenic
948809610 2:240467876-240467898 CGCTGCACACAGACGGCCTAGGG + Exonic
948994573 2:241571936-241571958 GGCAGCAGGCAGGTGGCCGAGGG + Intronic
1169218128 20:3805002-3805024 GCCTGAAGCCAGCTGCCCTATGG + Exonic
1171975786 20:31593862-31593884 GGGTGTAGCCAGTTGGCCTCAGG + Intergenic
1172461016 20:35118754-35118776 GGCTGCACAGAGATGGCCTGGGG + Intronic
1172884070 20:38219750-38219772 GGCTGCAGCCAGATGGCTCCTGG + Exonic
1173086399 20:39923195-39923217 GGCTACAGCCAGATTCCCTTTGG - Intergenic
1173319833 20:41977417-41977439 GTCTGCAGCTGGATGACCTATGG + Intergenic
1173963629 20:47094054-47094076 GTCTGCACCATGATGGCCTAGGG + Intronic
1175735044 20:61379539-61379561 GGCTGCAGGGAGGTGGCCTGTGG + Intronic
1175767821 20:61603384-61603406 GTCTGCAGCCAGCTTCCCTAGGG - Intronic
1176297225 21:5080579-5080601 GGCCGGGGCCAGCTGGCCTAGGG - Intergenic
1177202017 21:17968085-17968107 GGCAAAAGGCAGATGGCCTAAGG - Intronic
1177391518 21:20480004-20480026 GGCTGCAGCCAGGTGGTCACAGG - Intergenic
1179163985 21:38920823-38920845 GGCTGCAAACAGATGAGCTAGGG + Intergenic
1179808602 21:43855800-43855822 TGCTGCAACCAGAGGCCCTAGGG + Intergenic
1179859804 21:44181369-44181391 GGCCGGGGCCAGCTGGCCTAGGG + Intergenic
1180956296 22:19742883-19742905 GGCTGAAGCCAGGTTGCCTGGGG + Intergenic
1181088240 22:20454567-20454589 GGCTACAGGCAGTTGGCCTAGGG + Intronic
1182517828 22:30869073-30869095 GGCAGGAGGCAGCTGGCCTAGGG - Intronic
1185344384 22:50304974-50304996 GGCTGCAGCCAGAGGGACGGAGG + Intronic
949632557 3:5944288-5944310 GGCTGCAGCCAGGTGGGGGAGGG - Intergenic
949704294 3:6798162-6798184 GGCTGCAGCCAGATTGCAGTGGG + Intronic
949845019 3:8361086-8361108 GGTTGGAGACAGATGGCCAAAGG + Intergenic
953032078 3:39185832-39185854 GGCTGCACACAGATGGCCTGGGG - Exonic
954627068 3:52028443-52028465 GGCTTCAGCCTGATGGGCAAAGG - Intergenic
958849975 3:99312902-99312924 GGCAGCAGCCAGATAGTGTATGG - Intergenic
961287089 3:125814849-125814871 GGCTGCAGCCAGAAGGATTCAGG - Intergenic
961489721 3:127246431-127246453 GGCTGCAGTCAGGATGCCTAAGG + Intergenic
962102437 3:132356740-132356762 GGCTGCAGCCAGGTAGCATGAGG - Exonic
962855456 3:139340887-139340909 AGCTGCAGCCAGATAGCCTTGGG + Intronic
966835639 3:184047539-184047561 TGCTGCAGCCAGCTGGTCTTGGG - Intergenic
968281443 3:197479877-197479899 GACAGCAGCCAGGTCGCCTAGGG - Intergenic
968446641 4:655506-655528 GGCTGAAGCCATACGGCCTCCGG + Intronic
968520586 4:1033099-1033121 GGCTGCAGCCAGGAGGCCCTGGG + Intergenic
968994707 4:3938307-3938329 ACCTGCAGCCAGCTGGCCTCGGG - Intergenic
969759291 4:9170486-9170508 ACCTGCAGCCAGCTGGCCTAGGG + Exonic
969802791 4:9582701-9582723 GGCTGCAGCCAGAAGGATTCAGG - Intergenic
969819253 4:9707966-9707988 ACCTGCAGCCAGCTGGCCTCGGG + Intergenic
971098180 4:23432567-23432589 ATCTGCAGCCTGATGGCCTCTGG - Intergenic
973656034 4:53048727-53048749 GGCAGGAGCCAGATGACCCAGGG - Intronic
973656217 4:53050772-53050794 GGCAGGAGCCAGATGACCCAGGG - Intronic
975344175 4:73275148-73275170 GTCAGAAGCCAGATGGACTATGG - Intergenic
982321649 4:154083072-154083094 GACTGCAGTCAGAGGGCCTGCGG - Intergenic
989554464 5:42777149-42777171 GTCTGTAGCCAGATGAACTAAGG + Intronic
994275730 5:97834808-97834830 AGCTGCAGACACATGGCATAGGG - Intergenic
994793341 5:104260655-104260677 GGCTGCCACCAGGTTGCCTAAGG - Intergenic
995645390 5:114305562-114305584 GGCCTCAGCCAGATGGTCTCTGG + Intergenic
997487639 5:134245112-134245134 GGCTGCAGGCAGATGAAGTATGG + Intergenic
997622733 5:135309383-135309405 GGCTGCACAGAGATGGCCTTGGG + Intronic
997836365 5:137196413-137196435 AGCTGAAGCCAGATGGCCCAGGG - Intronic
998230381 5:140357757-140357779 GTCTGCAGCCACTGGGCCTAAGG + Intergenic
999001416 5:147927239-147927261 GGTGGCACCCAGATGGCTTATGG - Intergenic
1001800959 5:174543639-174543661 GTCTGCTGCCTGATGGCTTAAGG + Intergenic
1001833595 5:174810809-174810831 GTATGCAGCCAGATTGTCTATGG - Intergenic
1001955424 5:175845379-175845401 CACTGCAGCCACATGGCCTTTGG + Intronic
1002382779 5:178842140-178842162 TGCTGCAGCAAGCTGGCCTGGGG - Intergenic
1002419812 5:179139652-179139674 GGCTGCAGGCAGGTGGGCTGTGG + Intronic
1002518520 5:179776680-179776702 GGCAGCAGCCAGATGGGGTCAGG - Exonic
1002911123 6:1491607-1491629 GGCTGTCCCCAAATGGCCTATGG + Intergenic
1002993103 6:2256104-2256126 GGTTGCAGTCAGATGGCATCTGG + Intergenic
1003045569 6:2730098-2730120 TGCTGCAGGCAGATGGCCTGCGG - Intronic
1003340410 6:5214700-5214722 GCTTGCAGCCAGATGGCCGGGGG + Intronic
1006694500 6:35920344-35920366 GGCTGCAGCCACATGGCCTCGGG - Intronic
1006897421 6:37479959-37479981 GACTGCACCCAGATGGCACAGGG - Intronic
1009319375 6:62267437-62267459 GGCTGCAGCCAGGTGAACAAGGG + Intronic
1014837631 6:126177913-126177935 GGAGGCAGCCAGAGGGCTTAAGG - Intergenic
1015951286 6:138555516-138555538 GGCTGCAGCCTGGTGCCCTTGGG + Intronic
1017804028 6:157927262-157927284 GGCTGAAGCCTGATGGCCAAAGG - Intronic
1019499075 7:1355434-1355456 CCCTGCAGCCAGATGGCCCCTGG + Intergenic
1021566742 7:22023850-22023872 GGCTGCAGCCAGTTTCCCCAAGG - Intergenic
1021808183 7:24377280-24377302 GCCTGCAGCCACATGGGCAAAGG + Intergenic
1022172584 7:27844071-27844093 GGCGGCAGCCAGAGGGCCTGCGG + Intronic
1025980807 7:66404054-66404076 GACTGGACCCAGATGGCCCATGG + Intronic
1026201537 7:68218661-68218683 GCCTGCATCCAGATGGCCTAAGG - Intergenic
1029316784 7:99723177-99723199 GGGTACATCCAGATGGCCTGAGG + Intronic
1029668159 7:102009149-102009171 GATTGTAGCCAGATGGCCTCAGG + Intronic
1034399961 7:150855651-150855673 GGCTGCAGACTGATGGCTTTGGG - Intronic
1035129357 7:156638654-156638676 GGCTTCAGCCAGATGGGGTCTGG - Exonic
1036252202 8:7171953-7171975 GGCTGCAGCCAGAAGGATTCAGG + Intergenic
1036365289 8:8115507-8115529 GGCTGCAGCCAGAAGGATTCAGG - Intergenic
1036381436 8:8238517-8238539 ACCTGCAGCCAGCTGGCCTCGGG + Intergenic
1036847225 8:12178475-12178497 ACCTGCAGCCAGCTGGCCTCGGG - Intergenic
1036868592 8:12420796-12420818 ACCTGCAGCCAGCTGGCCTCGGG - Intergenic
1037362001 8:18084014-18084036 GGCGGCAGCCAGGAGGACTAAGG + Intronic
1039960740 8:42245455-42245477 AGCTGCTGGCAGATGGCCTGGGG - Intergenic
1041245623 8:55885841-55885863 GGCTGCAGGCAAATGACCCAGGG - Intronic
1043408210 8:79961706-79961728 GGCTTCTGCAAGATGGCATATGG + Intronic
1047616985 8:126570809-126570831 GGCTGCAACCACAGAGCCTAGGG - Intergenic
1049157201 8:141074412-141074434 GGCTCCAGCCAGCAGGCCAAGGG - Intergenic
1049354645 8:142181773-142181795 GGCTGCAGCCAGCTCGGCCAGGG - Intergenic
1049665936 8:143842604-143842626 GGCTGATGCCACATGGCCCAAGG - Intergenic
1051720254 9:20029476-20029498 TGCTGCAGTCAGATGGACTGAGG - Intergenic
1055036128 9:71820485-71820507 AGCTGCAGAAAGATGGGCTAAGG + Intergenic
1060820775 9:126660460-126660482 TGCTGCAGCCAGGTGGCCTGGGG + Intronic
1060972774 9:127748311-127748333 GGCTGCAGCCACTTGGCCTGTGG - Intronic
1062001010 9:134215622-134215644 GCTTGGAGCCAGATGGCCTGGGG + Intergenic
1062011341 9:134268557-134268579 AGCTGCAGCCCGAGGGCCCAGGG + Intergenic
1062191669 9:135251020-135251042 GGCTGCACCCAGCTAGCCTGTGG + Intergenic
1062201639 9:135306009-135306031 GCCAGCATCCAGGTGGCCTAAGG + Intergenic
1185677558 X:1861102-1861124 GGCTGGAGGCAGAGGGCCAAAGG - Intergenic
1186882077 X:13876601-13876623 GGATCCAGCCAGATGGTCAATGG + Intronic
1193907907 X:87264849-87264871 GGCCACAGACAGATGCCCTATGG + Intergenic
1198225825 X:134645032-134645054 GGGTGCAGCAAGATGGCAAAAGG - Intronic
1198427360 X:136533393-136533415 GACTGTAGCCAGTTGGCCTGGGG + Intronic
1199973445 X:152877338-152877360 GGCTGTGGCTAGATGGCCTTTGG - Intergenic
1200119885 X:153785190-153785212 CCCTGCAGCCACATGGCCTGAGG - Intronic
1200953555 Y:8923529-8923551 GCCTGCAGCAAGAGGGCCTGGGG - Intergenic
1201320417 Y:12692626-12692648 AGCTGCAGCAAGAAGGACTATGG - Intergenic