ID: 1165753288

View in Genome Browser
Species Human (GRCh38)
Location 19:38275029-38275051
Sequence TTGTGACATTGAAAGAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165753287_1165753288 8 Left 1165753287 19:38274998-38275020 CCTCTTCTGTGAAGCAGCTCTGC 0: 1
1: 0
2: 3
3: 20
4: 238
Right 1165753288 19:38275029-38275051 TTGTGACATTGAAAGAGCAAAGG 0: 1
1: 0
2: 3
3: 42
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165753288 Original CRISPR TTGTGACATTGAAAGAGCAA AGG Intronic
902700608 1:18169455-18169477 TTGTGAATTGGAAAGAGCAGAGG - Intronic
902754633 1:18540967-18540989 TTGTGGAACTGTAAGAGCAATGG - Intergenic
902761477 1:18583649-18583671 ATGTCACTCTGAAAGAGCAATGG - Intergenic
903561045 1:24227789-24227811 TTGTACCATTGATAGAGCACAGG + Intergenic
904091783 1:27949985-27950007 TGGTGACAGTGAAGGAGCTAAGG - Intronic
908678365 1:66631429-66631451 TTCTGATATTGAAAGACCATGGG - Intronic
908949109 1:69538188-69538210 TTGTAACAGTGAAACAGAAATGG + Intergenic
909281525 1:73761000-73761022 TTTCGTCATTGAAAGAGAAAAGG + Intergenic
909497286 1:76292363-76292385 TTGTGATATTGAAAGCCCACTGG - Intronic
909501508 1:76340019-76340041 TTCTGAGATTCAAAGAGCAAGGG + Intronic
909591804 1:77358691-77358713 TTTTCAAATTGAAAGAGCTAAGG - Intronic
910031886 1:82736110-82736132 TTATGACATTGAAAGCACATAGG - Intergenic
910331771 1:86081260-86081282 TCATGACATTGAAAGTGCAAAGG - Intronic
910866450 1:91792416-91792438 TTTTGACATTAAAGGAGCAATGG - Intronic
911516199 1:98871245-98871267 TTGAGACATTACAAGAACAAAGG - Intergenic
911808898 1:102247948-102247970 AAGTGACATTGAAAAAACAATGG - Intergenic
912053207 1:105558847-105558869 TTCTGGGTTTGAAAGAGCAAAGG - Intergenic
913045578 1:115071070-115071092 TTGTGACAAGGAAAAAGCAGAGG - Intronic
913065246 1:115246652-115246674 ATGGAACATTGAAAAAGCAATGG - Intergenic
913696448 1:121330484-121330506 TTGTGACCTTGAATAAACAAAGG + Intronic
914141113 1:144949569-144949591 TTGTGACCTTGAATAAACAAAGG - Intronic
914255184 1:145956895-145956917 ATTTAACATTGAAAGAGCCAAGG + Intronic
914413132 1:147451138-147451160 TTTTCACATTGACAGAACAATGG + Intergenic
916624504 1:166540647-166540669 ATGCCAAATTGAAAGAGCAATGG - Intergenic
916632925 1:166636567-166636589 TTCTGACATAGGAAAAGCAAAGG + Intergenic
916846255 1:168653528-168653550 TTGTGAATTGGAAAGAACAAGGG + Intergenic
917321463 1:173787059-173787081 GTGTGGCATAGAAAGAGGAATGG - Intergenic
917614043 1:176719504-176719526 TCATAACATTGAAAGTGCAAAGG - Intronic
918407190 1:184222918-184222940 TGGGGACATGGAAAGAGAAAGGG - Intergenic
918457684 1:184740927-184740949 TCATGACACTGAAAGAGCAAAGG + Intronic
918632459 1:186734272-186734294 TTGTTCCATTGATAGAGCACAGG + Intergenic
919841953 1:201615768-201615790 ATGTGTCATGGAAAGAGTAAAGG - Intergenic
920483774 1:206348850-206348872 TTGTGACCTTGAATAAACAAAGG + Intronic
920538233 1:206755567-206755589 TTGTTCCATTGATAGAGCATAGG + Intergenic
920600280 1:207318098-207318120 TTATGATTTTGACAGAGCAAGGG - Intergenic
921409169 1:214815989-214816011 TTCTGGCATTCAGAGAGCAAAGG - Intergenic
921576373 1:216839901-216839923 TTGTTCCATTGATAGAGCACAGG + Intronic
922543418 1:226435906-226435928 TTGTGACACAGAAAGGGCAAAGG - Intergenic
922903068 1:229153020-229153042 TTGTTCCATTGATAGAGCATAGG + Intergenic
923777300 1:236991040-236991062 TTTTAACATTGGAAGAGCACAGG - Intergenic
924624902 1:245689398-245689420 TTGTCCCATTGAAAGTGGAATGG + Intronic
1063858837 10:10286527-10286549 TGGTGAGATTGAAGGAGCAGTGG + Intergenic
1063910101 10:10820793-10820815 TTCTCTCATTGTAAGAGCAATGG + Intergenic
1064608569 10:17072355-17072377 TTTTGCCATTGAAAGAAAAAAGG + Intronic
1065085117 10:22166091-22166113 GTGTAACAGTGAAACAGCAAAGG + Intergenic
1065172422 10:23045017-23045039 TTGTTACACTGAAAGGCCAAAGG - Intergenic
1067702900 10:48586548-48586570 TAGTGACATTTAAAGGGCCAGGG - Intronic
1068424971 10:56847982-56848004 TTGTGACCTTGAAATTACAATGG - Intergenic
1068704834 10:60063544-60063566 TTTTGACATTCTAAGAGGAAAGG - Intronic
1069295092 10:66834037-66834059 GTGTGTCATTGAAAGAACATGGG - Intronic
1069852883 10:71421902-71421924 TTGGGTCATTAAAAGAGGAAGGG + Intronic
1071081412 10:81816666-81816688 TTTTGCCATAGATAGAGCAAAGG + Intergenic
1073679673 10:105689054-105689076 TTGACACATAGAAAGAACAAGGG - Intergenic
1073857832 10:107697637-107697659 TGGTAACATTAAAAGAGGAAGGG - Intergenic
1074743715 10:116509673-116509695 ATGGGAACTTGAAAGAGCAAGGG + Intergenic
1074767875 10:116713959-116713981 TTGTGACATGTCAAGAGCTAAGG - Intronic
1076185468 10:128444689-128444711 TTATGACACTGAAAGCACAATGG - Intergenic
1077441118 11:2569712-2569734 TTGTGACACTTAAAGTGCAGCGG - Intronic
1079198521 11:18354095-18354117 CTTTGACATTGAAAGAGTACTGG + Intronic
1079931522 11:26569156-26569178 CTGTGACATTGAACCACCAAGGG + Intronic
1080439196 11:32275234-32275256 TTGTGGCATTGAAAGCGTAAGGG - Intergenic
1081646848 11:44796038-44796060 ATGTGGCATGGAAAGGGCAACGG - Intronic
1082098949 11:48155778-48155800 CTGTGACATTAAAAGAAAAAAGG - Intronic
1082219003 11:49609820-49609842 TGGTTTCATTGAAAGAGCACAGG - Intergenic
1083023238 11:59528246-59528268 TTGCTACATTCATAGAGCAATGG - Intergenic
1084734419 11:71095085-71095107 ATGTGACATTGAATGAGGAAAGG - Intronic
1085441133 11:76563702-76563724 TTGTTCCATTGATAGAGCACAGG + Intergenic
1085525556 11:77161594-77161616 TTGAGACATCCAAACAGCAAGGG - Intronic
1086183806 11:83989121-83989143 TAGTGGCTTTGAATGAGCAAGGG + Intronic
1086630649 11:89015056-89015078 TGGTTTCATTGAAAGAGCACAGG + Intronic
1087870541 11:103288326-103288348 TTATGACAGTGAAAGAGCTCAGG + Intronic
1088449489 11:109966380-109966402 TTGCATCATGGAAAGAGCAATGG + Intergenic
1088855624 11:113750168-113750190 TGGTACCACTGAAAGAGCAAAGG + Intronic
1090972152 11:131653240-131653262 ATGTGAGACTGAAAGAACAAAGG - Intronic
1091832345 12:3558626-3558648 TTGACACATTGGAAGAGCACAGG + Intronic
1092507182 12:9115295-9115317 TGTTGATATTGAAAAAGCAAGGG - Intronic
1092845032 12:12576509-12576531 TTGGGATATTGAAAGAGAATGGG + Intergenic
1093128548 12:15359965-15359987 TTGAGACATAGGAAAAGCAAAGG - Intronic
1094364626 12:29666894-29666916 TTTTTGCGTTGAAAGAGCAAAGG - Intronic
1095527787 12:43148760-43148782 TTTTGAAATAGAAATAGCAATGG + Intergenic
1097430728 12:59502710-59502732 TTGTGACATTTCAAGAACTAAGG - Intergenic
1099304914 12:80941407-80941429 TTGAGACATAGAGAGAGGAATGG + Intronic
1099771360 12:87062209-87062231 TTGTAACATTCAAAGGGCAGAGG + Intergenic
1100351564 12:93788679-93788701 TGGTGTCATAGAAACAGCAATGG + Intronic
1101052696 12:100879959-100879981 TTGAGCTATTGAAAGAGGAATGG + Intronic
1101324481 12:103703096-103703118 TTATGACATTTAAAGAGATATGG - Intronic
1101409100 12:104454581-104454603 TTTGAACATTGAAAGAGGAACGG - Intergenic
1101702309 12:107185743-107185765 ATTTGACATTGATAGAGGAAAGG + Intergenic
1104859092 12:131915495-131915517 TTTTCACTTGGAAAGAGCAAGGG - Intronic
1105798290 13:23879900-23879922 TTGTGCCATCCAGAGAGCAAAGG + Intronic
1105904037 13:24786317-24786339 TTGTGACATCGAAAAAATAAAGG - Intronic
1106389981 13:29325735-29325757 TTAAGATATTGAAAGAGCACAGG - Intronic
1108757553 13:53522256-53522278 TTGTGAAAGTGAAAGGGCACAGG + Intergenic
1108840339 13:54605335-54605357 GTTTGACTGTGAAAGAGCAAGGG + Intergenic
1109556544 13:63983258-63983280 TTGGGATATTGATAAAGCAATGG - Intergenic
1109618544 13:64870540-64870562 TTGTTTCATTTATAGAGCAAAGG + Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110521650 13:76486261-76486283 TTGTTCCATAGAAAGAGCATTGG - Intergenic
1111009850 13:82297714-82297736 TGGTCATCTTGAAAGAGCAATGG + Intergenic
1112124924 13:96454311-96454333 TACTCACATTGAAAAAGCAAAGG - Intronic
1112798293 13:103081787-103081809 TAAGCACATTGAAAGAGCAAAGG - Intergenic
1112870807 13:103968575-103968597 AGATGACATTGAAATAGCAAAGG + Intergenic
1113326368 13:109285597-109285619 GGGTGACATTGGAAGGGCAAAGG - Intergenic
1113626455 13:111851562-111851584 TTGGGAAATTGAAAGTGGAATGG - Intergenic
1113976224 13:114229544-114229566 TTGAGGCTTTGAAAGAGCAAAGG - Intergenic
1114423480 14:22603648-22603670 TTGTGACATCGATAGAGACATGG + Exonic
1115621838 14:35148503-35148525 TTGTTCCATTGATAGAGCATAGG + Intronic
1115976711 14:39004865-39004887 TGGTGTCATGGAAAGAGCAATGG - Intergenic
1117155374 14:52934513-52934535 TCATGATACTGAAAGAGCAAAGG - Intronic
1120042085 14:79765362-79765384 TTGTTCCATTGAAAGAGAACTGG - Intronic
1121807256 14:96839872-96839894 TTGCCACATTGACAGAGGAAAGG - Intronic
1124430273 15:29601363-29601385 TTATGACATTGAAAGCACAAAGG - Intergenic
1124580345 15:30948225-30948247 TTGTGTCATTAAAAGATGAAGGG - Intronic
1125086420 15:35735543-35735565 TTATGACATTGAAAGCTCAAAGG - Intergenic
1129432531 15:75510612-75510634 TTCTGACATTAAAATAGAAAAGG - Intronic
1130968593 15:88715415-88715437 TTGTGACTATGACAGAGCTAGGG - Intergenic
1131438285 15:92439990-92440012 TTGTGACAATGGAAGAGGCATGG - Intronic
1131928326 15:97411101-97411123 TTATGACTCTGAAAGATCAAAGG - Intergenic
1132633106 16:929245-929267 TGGTGAGGTTGAAACAGCAAAGG - Intronic
1136448352 16:30337675-30337697 TTGGGCCATTGAAAGAGCATGGG + Intergenic
1138133910 16:54504865-54504887 TTGTGACAATGAAGGAAAAAGGG + Intergenic
1138137104 16:54532659-54532681 TGGTGACATTCAAGGAGGAAAGG + Intergenic
1138863170 16:60784133-60784155 TTGTGACACTGAATTAGAAAAGG + Intergenic
1139013850 16:62665882-62665904 TTGTGACATTTAAAGAGAACAGG - Intergenic
1139265146 16:65631449-65631471 TTGTTACAATGCAAGATCAATGG - Intergenic
1141123876 16:81386253-81386275 TTTTTTCATTGAAATAGCAAAGG + Exonic
1142047521 16:87935156-87935178 TTGGGCCATTGAAAGAGCATGGG - Intronic
1144086395 17:11812749-11812771 TTGTGGCATTGGAGGAGAAAAGG - Intronic
1144291118 17:13827340-13827362 CTGTCATATTGCAAGAGCAACGG + Intergenic
1144309490 17:13999514-13999536 ATGGGGCAATGAAAGAGCAAAGG + Intergenic
1144643129 17:16950449-16950471 TTGTGTCTTTGACAGAGTAAAGG + Intronic
1145205599 17:20983542-20983564 TTGTGTCTTTGACAGAGTAAAGG - Intergenic
1145819264 17:27818742-27818764 TTCTGTCAGTGAAAGAGAAAGGG - Intronic
1146616548 17:34361466-34361488 TTGTGCACTGGAAAGAGCAAGGG - Intronic
1146895589 17:36539157-36539179 TTGTGACATTGAAAGACTGTTGG + Exonic
1146949624 17:36896866-36896888 GTGTGCCATTGAAAGAGCCCTGG - Intergenic
1147972011 17:44223317-44223339 TTTTGACTAGGAAAGAGCAAAGG + Intergenic
1148026832 17:44594445-44594467 TGGGGACATTGACAAAGCAAGGG - Intergenic
1150061022 17:62068332-62068354 TTGTGTGATTTAAAGAGTAATGG + Intergenic
1150635428 17:66909878-66909900 TTTTGACAGTGAAAGGGCAAAGG - Intergenic
1152329332 17:79662777-79662799 TTGTGGCATGGGAAGAGAAACGG + Intergenic
1153841853 18:9014892-9014914 TTGCGCCATTCCAAGAGCAATGG + Intergenic
1155591597 18:27433834-27433856 TTTTAAAAGTGAAAGAGCAAAGG + Intergenic
1155661201 18:28250256-28250278 TCGTGACAGGGAAAGAGCTAGGG - Intergenic
1156274607 18:35572308-35572330 TTGTGAGATAGAAAGGGAAAAGG + Intergenic
1156768851 18:40694856-40694878 TGATGACCTTCAAAGAGCAATGG - Intergenic
1157021402 18:43787426-43787448 TTGTGCCATTGAAAGAGAGGTGG + Intergenic
1158547414 18:58408038-58408060 TGGTGACATGCAAAGAGCAATGG + Intergenic
1158547798 18:58410728-58410750 TGGTGACATGCAAAGAGCAACGG + Intergenic
1158652928 18:59303806-59303828 TCATGTCCTTGAAAGAGCAATGG - Intronic
1158801669 18:60918216-60918238 TTCAGAAATTGAAAAAGCAAAGG - Intergenic
1158925782 18:62257964-62257986 TTGCAACATTGAAAGAACCAAGG - Exonic
1159228016 18:65565612-65565634 TTATGAGATTGAACGTGCAAAGG + Intergenic
1159289438 18:66396552-66396574 TTGTGACTGTGAATGAGGAATGG + Intergenic
1159476524 18:68927861-68927883 TTGGTACACTGAAAGAGCAATGG + Intronic
1160000323 18:75013360-75013382 TTTTGTCATTAAAAGTGCAAAGG - Intronic
1160000978 18:75022148-75022170 TTGTGACTTTGATAGACAAAAGG - Intronic
1161841386 19:6683150-6683172 TTGTGTCATGGAAAGCTCAAAGG + Intronic
1164692031 19:30218291-30218313 TTGGGACTTTGGAAAAGCAAGGG + Intergenic
1165753288 19:38275029-38275051 TTGTGACATTGAAAGAGCAAAGG + Intronic
1165984495 19:39756141-39756163 ATGTAACAGTGAAACAGCAAAGG + Intergenic
1167731198 19:51257600-51257622 GTGTGACATTCTAAGAGCTAGGG - Intronic
925435274 2:3831852-3831874 TTGTGATGTTGAATGAGAAAAGG + Intronic
926197831 2:10774384-10774406 TTGTGATATTGGAAGTGAAATGG + Intronic
927211136 2:20639891-20639913 TTGTGACCTTGGAACAACAAGGG + Intronic
927428967 2:23010250-23010272 TTATAACCTTGCAAGAGCAATGG + Intergenic
928773166 2:34726303-34726325 GTGTAACATTGGAAGAGCAGAGG + Intergenic
929813271 2:45209916-45209938 TTGTAACATTGCAAGAGCAAAGG - Intergenic
930362501 2:50399546-50399568 TAGAGCCCTTGAAAGAGCAAAGG - Intronic
930939053 2:56991820-56991842 TTGGAATATGGAAAGAGCAACGG - Intergenic
931419566 2:62113814-62113836 TTCTGCCATTTATAGAGCAAAGG - Intronic
931961034 2:67483272-67483294 TTGTTCCATTTATAGAGCAAAGG - Intergenic
932106584 2:68948623-68948645 AGGTGGGATTGAAAGAGCAATGG + Intronic
933083540 2:78024665-78024687 TGGAGACTTTAAAAGAGCAATGG + Intergenic
933322950 2:80799948-80799970 TTGTAAGCTTTAAAGAGCAATGG - Intergenic
935920666 2:108009858-108009880 ATGTGGCATTGACAGAGCATAGG - Intronic
936751098 2:115642611-115642633 TAGAGAGATTGAAAGAGAAAGGG - Intronic
937827554 2:126383171-126383193 TTGTGACATGGAAACAGCCGTGG - Intergenic
938159274 2:128971208-128971230 TTGTGATAATGACAGAGCATGGG + Intergenic
938364305 2:130722113-130722135 TTGTTGCATTGATAGAGCACAGG - Intergenic
938424497 2:131173490-131173512 TTGTTAAATTGACAGAGCACAGG + Intronic
938716414 2:134026291-134026313 TTTTCACATTGAAAGAGTTATGG + Intergenic
939131671 2:138242863-138242885 GTGTGACATTTAAATAGCACTGG + Intergenic
939457714 2:142459897-142459919 TCCTGACATTGAAAGAGCAAAGG - Intergenic
940199214 2:151131743-151131765 TTGTTCCATTGATAGAGCACAGG + Intergenic
940435717 2:153651462-153651484 CTGAGATATTGAAAGAACAACGG - Intergenic
941502646 2:166299094-166299116 TCGTGAAAGTGAAAGAGTAAAGG - Intronic
942570188 2:177306094-177306116 TAGTGAGATTTAGAGAGCAAGGG + Intronic
943175089 2:184462092-184462114 TTGGGAAATTTAAAGAGTAAAGG - Intergenic
944045462 2:195406088-195406110 CTGTGACATTGAAAGAGAGTAGG - Intergenic
944823022 2:203450471-203450493 TAGTGACCTTGAAAAAGCAAAGG + Intronic
945151196 2:206793793-206793815 TTGTGTCAATGAAAGAAAAATGG + Intergenic
945817701 2:214626095-214626117 GTGTGACCGTGCAAGAGCAATGG + Intergenic
946091536 2:217229287-217229309 TTGTTACATTTATAGAGCACAGG + Intergenic
946970006 2:225081026-225081048 TGGGGACAGAGAAAGAGCAAAGG - Intergenic
947101503 2:226625960-226625982 TGGTGACAAGGAAAGACCAAGGG - Intergenic
1169722670 20:8696070-8696092 TTGTGACCTTGATTCAGCAATGG - Intronic
1170023918 20:11867957-11867979 TCATGACATTGAAAGGGCAAAGG + Intergenic
1170397202 20:15939417-15939439 TTGTGCCATTTACAGAGCACAGG - Intronic
1170436993 20:16340569-16340591 TAGTGACAATGAATCAGCAATGG + Intronic
1170854622 20:20039656-20039678 TGGTGATATTGACAGAGCACGGG - Exonic
1173547135 20:43906568-43906590 TTGTGAAAATGAAGGAGCCAGGG + Intergenic
1173628018 20:44488067-44488089 ATGTTACTTTGAAAAAGCAAGGG - Intronic
1175352944 20:58338783-58338805 TTGAGACATAAAAAGACCAAAGG - Intronic
1175408532 20:58751175-58751197 TTGTGCAATTCAAAGAGCATGGG + Intergenic
1176868523 21:14070275-14070297 TAGTGACATTGTGAGAGAAAGGG + Intergenic
1176886360 21:14260063-14260085 TTTTGGTATTGAAAGAACAAAGG + Intergenic
1177282724 21:19004801-19004823 TTGTGACATTGTATAAGAAAGGG + Intergenic
1178394552 21:32230804-32230826 TTGTGAGTTTGAATTAGCAATGG + Intergenic
1178780635 21:35599743-35599765 TGTTGGCATTGAAAGAGAAATGG - Intronic
1182731250 22:32496531-32496553 TTGTTCCATTTACAGAGCAAAGG - Intronic
950543025 3:13623370-13623392 TTCTGGGAATGAAAGAGCAAGGG + Intronic
951413912 3:22399426-22399448 TTGTGACATTTCATTAGCAATGG - Intergenic
951812484 3:26716175-26716197 ATGTGACATTGGTGGAGCAAAGG - Intergenic
952471654 3:33660114-33660136 TTTTCACAGTGAAAGAGAAAAGG + Intronic
953045808 3:39293514-39293536 TGGTGTGATTGAAAAAGCAAAGG - Intergenic
955462329 3:59197159-59197181 TTATGACATTAACAGAGGAAAGG - Intergenic
958025908 3:88048820-88048842 TTGTGACATTGAATGGGGCAAGG - Intergenic
958576409 3:95954454-95954476 TAGGGACATTGAAACACCAAAGG + Intergenic
958633601 3:96713331-96713353 TCCTGACATTGAAAGTGAAAAGG - Intergenic
958698825 3:97561922-97561944 TTGCTTCATTTAAAGAGCAAAGG - Intronic
959589865 3:108066952-108066974 TCATGACATTGAGAGTGCAAAGG + Intronic
959681068 3:109097158-109097180 TTTTGACCTTCAAAGAGTAAAGG + Intronic
959714866 3:109421731-109421753 TAGTGTTATTGGAAGAGCAAAGG + Intergenic
959821061 3:110736174-110736196 TTGTTCCATTTATAGAGCAAAGG + Intergenic
960292338 3:115900740-115900762 TGTTGACAGTGAAAGAACAATGG + Intronic
960669401 3:120141728-120141750 TTGTTACATTTATAGAGCACAGG - Intergenic
961130812 3:124465846-124465868 TTGAGAGATTGAGAGAGAAAGGG + Intronic
961169553 3:124787070-124787092 TAATGACATTTAAAAAGCAAAGG - Intronic
961613219 3:128157599-128157621 TTGTGCCATTTCAAGAGCACAGG - Intronic
962157368 3:132962090-132962112 TTGTCCCATTGATAGAGCACAGG + Intergenic
963527496 3:146432456-146432478 TTCTTACTTTGAAAAAGCAAAGG - Intronic
964907799 3:161739384-161739406 TTGTAAAATAGAAAGAGCAATGG + Intergenic
965451813 3:168847242-168847264 TTGTGACTATGAAACAGCAAAGG + Intergenic
966081543 3:176009893-176009915 TTGAGACATCGAAAGAAGAAAGG - Intergenic
966962330 3:184952863-184952885 CTGTCACATTGAAACAGCAGAGG + Intronic
967413243 3:189188337-189188359 TTGGCACAATGAAAGAGTAAAGG + Intronic
967468069 3:189830792-189830814 TTGGGACTTTGAAGGAGGAAGGG + Intronic
970625206 4:17869624-17869646 TTGTAAGATTGAAAGAGCCTAGG - Intronic
970921204 4:21397289-21397311 TTGTAATATTGAAACATCAATGG - Intronic
971622580 4:28874576-28874598 TTATGACATTGAAAGTGTAGAGG + Intergenic
971676740 4:29641090-29641112 TCGTGACAATGAATGAGTAAAGG + Intergenic
971904740 4:32711837-32711859 TTTTAACAGTGAAACAGCAAAGG - Intergenic
973147868 4:46850908-46850930 TTGTGACATTCAATGAGGACCGG + Intronic
973149166 4:46866026-46866048 TTGTGTCATTAACACAGCAATGG - Intronic
973167081 4:47091533-47091555 TTGTGACATTCACTGAGCCAAGG - Intronic
973850668 4:54958403-54958425 TTGTCAGATTCAAAGGGCAAGGG - Intergenic
974807692 4:66900949-66900971 TCATGACATTGAAAATGCAAAGG + Intergenic
974908833 4:68090600-68090622 TTGTGACTTTAAAAGAGGCAAGG + Exonic
975118850 4:70706563-70706585 TTGTTAGATTTAAAGAGCATGGG - Intronic
975184520 4:71385721-71385743 TTGAGATATTGAAAGAGCTTAGG - Intronic
975430468 4:74284271-74284293 TCATGCCATTGAAAGGGCAAAGG + Intronic
976433018 4:84985511-84985533 TTGTTCCATTGATAGAGCACAGG - Intergenic
976605858 4:86982232-86982254 TTACCACATTGAAGGAGCAAAGG + Intronic
977011932 4:91646933-91646955 TTGAGACATTGAAAGAGGTCAGG + Intergenic
977588177 4:98798530-98798552 TTGAGAAATTGAACGGGCAAAGG - Intergenic
977915818 4:102591551-102591573 TTGTTCCATTTACAGAGCAAAGG - Intronic
979574267 4:122268405-122268427 TCATGACATTGAAAGTGCAAAGG - Intronic
979973889 4:127171727-127171749 TTGTTCCATTTAAAGAGCACAGG - Intergenic
980327777 4:131370736-131370758 TACTGACATTGAAAGATCTATGG - Intergenic
982285514 4:153729628-153729650 ATCTGACATTGAAAGAAGAATGG - Intronic
982757981 4:159247301-159247323 CTGTGAGATTGTAAGGGCAAAGG - Intronic
984229133 4:177072792-177072814 TTGTAACATTGAGCAAGCAATGG - Intergenic
984406122 4:179332264-179332286 TTGTGACTTTGAGAGAAGAAAGG - Intergenic
984431091 4:179650121-179650143 TTAAGATATTGAAAGAGAAATGG - Intergenic
984851650 4:184158726-184158748 TTATGACATTGAAAGCACAAAGG - Intronic
984970253 4:185182340-185182362 TTTTGACATTTACATAGCAAAGG + Intronic
985047967 4:185959687-185959709 TCATGACATTGAAAGCACAAAGG + Intergenic
985051774 4:185998651-185998673 TTGGGACAAGGGAAGAGCAAAGG + Intergenic
986163825 5:5255377-5255399 TAGAGAGATTGAAAGAGTAAAGG + Intronic
987071205 5:14338606-14338628 CTGTGACATTGACAGAACATGGG + Intronic
987982336 5:25102293-25102315 TTGTTTCATTGATAGAGCACAGG + Intergenic
990266321 5:54080758-54080780 TTGTGACATTTAAAGGACAGGGG - Intronic
990381303 5:55223805-55223827 TTGGGAAACTGAAAGAGCAATGG - Intronic
990464069 5:56055835-56055857 TTGTGATATAGAAAGAGCATAGG + Intergenic
990529659 5:56660705-56660727 TTGTGGGGTTGAAAGATCAATGG - Intergenic
991036071 5:62129021-62129043 TGGTGACATTGAAAGGCCTAGGG - Intergenic
993508199 5:88737168-88737190 TTGTTAAATTGAAACATCAAGGG + Intronic
994153040 5:96472134-96472156 TTTTGATATTGAAAAAGCACAGG - Intergenic
996292184 5:121865345-121865367 TAGTAATCTTGAAAGAGCAAAGG + Intergenic
998982870 5:147724062-147724084 TTGTGCCACTGAAAGAGGATAGG + Intronic
999688076 5:154120360-154120382 TTGTTCCATTTATAGAGCAAAGG - Intronic
1001953439 5:175831892-175831914 GTCAGACATTGAAAGAGAAAGGG + Intronic
1003844477 6:10158800-10158822 CTGTGACCTTTCAAGAGCAAGGG + Intronic
1003920146 6:10825269-10825291 TTGAGCCATTGAAAGAGCTCTGG + Intronic
1003981001 6:11389656-11389678 TGGTGACAGTGAAGGAGGAAAGG - Intergenic
1005116415 6:22343165-22343187 TTGTGACATTGCATGCACAAAGG - Intergenic
1005601489 6:27430795-27430817 TCCTGACCCTGAAAGAGCAAGGG - Intergenic
1007297773 6:40839785-40839807 CTAGGACATTGAAACAGCAATGG + Intergenic
1008877849 6:56348873-56348895 CTTTGAAATTGAAAAAGCAAAGG + Intronic
1008949211 6:57136919-57136941 TGGTAACATAGAAAGGGCAAAGG + Intronic
1009303326 6:62055285-62055307 ATGTGTCATTGAAGGAGGAATGG + Intronic
1009733657 6:67645397-67645419 TTATGACATTGAAAGCTGAAAGG - Intergenic
1009871322 6:69455450-69455472 TTCCAACATTAAAAGAGCAAAGG + Intergenic
1010124317 6:72414442-72414464 TTATGACTATGAAAGATCAATGG + Intergenic
1010384082 6:75258783-75258805 ATGTGACATTCAAAGAGTATCGG + Exonic
1010425623 6:75725939-75725961 TATTGACACTGATAGAGCAAGGG - Intergenic
1010462376 6:76128069-76128091 TTGTGACAATGAAAGAAAAAAGG - Intergenic
1010796701 6:80124847-80124869 TTGTTTCATTGAAAGAGAACAGG + Intronic
1010915321 6:81610017-81610039 TTATGACATTGGAACAGCATTGG - Intronic
1011050775 6:83147170-83147192 TTGCAACAATGAAAAAGCAAAGG + Intronic
1011285975 6:85723527-85723549 TTGTGCCATTAAAATAGAAAAGG - Intergenic
1011823369 6:91278262-91278284 TTCTAACATTGTAAGAGTAATGG - Intergenic
1012146217 6:95686373-95686395 ATGTGTCATGGAAAGAGAAATGG + Intergenic
1012977819 6:105798899-105798921 TTGTGGTATTGTAAGAGCTAAGG - Intergenic
1013519740 6:110922308-110922330 TTTGGACATTGCAAAAGCAAAGG + Intergenic
1013866174 6:114698918-114698940 TTGAGACATAGAAAGAACATGGG + Intergenic
1013919205 6:115381010-115381032 ATGTGATATTGAACTAGCAATGG - Intergenic
1013968948 6:115992144-115992166 TTCTTACTTTGAAAGAGCAAAGG - Intronic
1014020297 6:116579270-116579292 TTTTCAGAATGAAAGAGCAATGG - Intronic
1014470356 6:121806190-121806212 TTGTCTCATTGAATTAGCAATGG + Intergenic
1014544879 6:122722900-122722922 TTGTGATCTTGAAATAGCAGTGG - Intronic
1014598411 6:123375172-123375194 TTGTCACATTCCAAGAGCAATGG + Intronic
1015002683 6:128238455-128238477 ATGTGACATTGAAATAAAAAGGG - Intronic
1015204615 6:130621238-130621260 TTATGCTATAGAAAGAGCAAAGG + Intergenic
1015620675 6:135128671-135128693 TTTTGACATTGATAGGGAAAGGG + Intergenic
1015795852 6:137010392-137010414 TTGTGACATTGGAAAAGTAAAGG - Intronic
1017984823 6:159434956-159434978 TTGTGACATTGAACAGGGAACGG - Intergenic
1020482744 7:8682119-8682141 CTGTTTCATTGAAAGGGCAAGGG + Intronic
1020578618 7:9966510-9966532 TTGTGACATGGAAAGAGAGAAGG - Intergenic
1022433282 7:30349942-30349964 TTGTGACAATGAGAGGGCATAGG + Intronic
1023795888 7:43791774-43791796 TTATGACATTGAAAGCACAAAGG - Intronic
1024107319 7:46106372-46106394 TTGAGACATAAAAAGAGAAAGGG + Intergenic
1024736508 7:52310884-52310906 AAGAGACTTTGAAAGAGCAAGGG - Intergenic
1026576981 7:71580624-71580646 TTGTGACAGTGGGAGAGGAATGG + Intronic
1028137375 7:87236414-87236436 TTGTTCCATTTATAGAGCAAAGG + Intergenic
1028210826 7:88072508-88072530 ATGTGACAGTGAGAGAGCAAGGG + Intronic
1031307334 7:120147106-120147128 TTGTTACATTTATAGAGCACAGG + Intergenic
1031627546 7:124007939-124007961 GTGTGATATTTAAAGACCAAGGG - Intergenic
1031670426 7:124536270-124536292 TTGTGTAATTGCAAGAGCAGTGG + Intergenic
1031782009 7:125980060-125980082 TCCTGACATTGAAAGAGTAAGGG + Intergenic
1032439297 7:131929822-131929844 TTGGGAAATTGAAACATCAAAGG + Intergenic
1032514076 7:132494177-132494199 TTGTGAAGATGAAATAGCAAAGG + Intronic
1032648854 7:133856088-133856110 CTGTGTCATTAAAAGAGCATGGG + Intronic
1032754968 7:134881006-134881028 TTGTGGCATTGTCAGAGCTATGG + Intronic
1033424953 7:141235841-141235863 TTGTAAGATTCAAAGGGCAAGGG - Intronic
1033762624 7:144452183-144452205 TTGTGGCATTTAAGGAGCAGTGG - Exonic
1034053487 7:148008565-148008587 TCATGACATTGAAAGTGGAAAGG - Intronic
1035696494 8:1601640-1601662 TTGTCACATTGAAAGTAAAATGG + Intronic
1037417204 8:18664859-18664881 TTGTTACACTTAAAGAGCAAAGG - Intronic
1037453893 8:19044709-19044731 CTGTGAGATTGAAAGAACTATGG + Intronic
1037491513 8:19400889-19400911 ATGTTACATTGAAAGAGTGATGG - Intergenic
1037653757 8:20865511-20865533 TTGTGAAATGGAAAGAGTGAAGG + Intergenic
1038079680 8:24119924-24119946 TTTTGACAGGGAAGGAGCAAAGG - Intergenic
1039382813 8:37101637-37101659 TTGTGAGATGGAAAGAAAAAGGG - Intergenic
1040425586 8:47282162-47282184 TTGTTACATTTATAGAGCACAGG + Intronic
1040771432 8:50982187-50982209 TACTGACATTGTATGAGCAAGGG - Intergenic
1041265148 8:56057456-56057478 TCATGACATTGAAAGCACAAAGG + Intergenic
1041457089 8:58072886-58072908 TTGTGAAAAGGAAAGAGAAATGG + Intronic
1042322530 8:67492309-67492331 TAGTGACATTGAAAGTACAAAGG + Intronic
1045295559 8:100869233-100869255 TTGTGAGGTTGAAAGAGAACAGG + Intergenic
1045566374 8:103320168-103320190 TTGTGACATAGTAAGAGTCAAGG + Intronic
1045808092 8:106189479-106189501 TTGTGACTGTCAAAGAGGAAAGG - Intergenic
1046371025 8:113306641-113306663 ATGGGACATTGAGGGAGCAAAGG + Intronic
1046602517 8:116333172-116333194 TTATAACTTTGAAAGAGCAATGG - Intergenic
1046810633 8:118529345-118529367 TTGTGACAATGAAAGCCCAAAGG - Intronic
1046818341 8:118609708-118609730 TGGAGAGATTGAAAAAGCAAGGG - Intronic
1049994718 9:1024282-1024304 TTATGACAGTGAAAGAGAAAAGG + Intergenic
1050784769 9:9387678-9387700 TTGTCACATTGAAACAGGAAGGG + Intronic
1051852927 9:21529759-21529781 TTGTTCCATTGATAGAGCACAGG + Intergenic
1053342774 9:37352230-37352252 TTCTGACATTGAAAGGGAAGGGG - Intronic
1055836668 9:80451744-80451766 TACTGACATTTAAAGAACAAAGG - Intergenic
1056022654 9:82456651-82456673 ATGTAACATAAAAAGAGCAAAGG + Intergenic
1057645366 9:96869032-96869054 TCTTGACATAGAAAGAGCATGGG + Intronic
1059353198 9:113680302-113680324 TTGTGATATTGAAAGAGAAATGG + Intergenic
1059555826 9:115279121-115279143 GTGTGACATTCAAAGAGCTCAGG - Intronic
1059573868 9:115469155-115469177 TTCTGAGATAGAAAAAGCAATGG - Intergenic
1060117476 9:120953900-120953922 TTGTGACATTAAAACATGAATGG - Intronic
1060658359 9:125388180-125388202 CTGTGACCTTCAGAGAGCAAAGG + Intergenic
1186849325 X:13565076-13565098 TAATGACATTTAAAGAGCCATGG + Intergenic
1187470389 X:19564575-19564597 TTGTGAGAGAGAAAGAGGAAGGG - Intronic
1188705324 X:33321528-33321550 TTGTTACTTTTATAGAGCAAAGG + Intronic
1189105144 X:38228034-38228056 ATATGACATTGAAAGACCCATGG + Intronic
1189901250 X:45708850-45708872 TCATGACATTGAAAATGCAAGGG - Intergenic
1191673542 X:63771221-63771243 TTATTACATTGAAATAGTAAAGG + Intronic
1192888147 X:75359250-75359272 TTCTGACATTTAAAAACCAATGG + Intergenic
1193226455 X:78989684-78989706 TTGTCACATTGAAGGTGCTAAGG - Intergenic
1193916955 X:87377777-87377799 TTGTAACAGTGAAACAGCAAAGG + Intergenic
1195902253 X:109811313-109811335 TTGTGACATTGAAGGCACCAGGG + Intergenic
1196042871 X:111224682-111224704 TTGTGATTTTTAAAGAGCAAGGG + Intronic
1199321786 X:146448060-146448082 TTGTGGCATTTCAAGAGTAATGG - Intergenic
1199503627 X:148537128-148537150 TGGTGCCATTTAAATAGCAAAGG + Intronic
1201504726 Y:14685649-14685671 TTGTGCCATTGTCACAGCAATGG - Intronic
1202021122 Y:20466210-20466232 TTGTGACATGGGAAGAGGAGAGG + Intergenic