ID: 1165753864

View in Genome Browser
Species Human (GRCh38)
Location 19:38280092-38280114
Sequence GCAGCTGTCTAGACACAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165753864 Original CRISPR GCAGCTGTCTAGACACAGAA TGG Intronic
900181833 1:1314507-1314529 GCCGCTCTCCAGAGACAGAAGGG + Intronic
900887778 1:5427640-5427662 GAAGCTGTTGAGACACAGAAGGG - Intergenic
901239040 1:7682298-7682320 GCAGCTGGCCAGAGACAGACGGG + Intronic
902778198 1:18687938-18687960 GCAGCTTTCTAGACTCACCATGG - Intronic
904901139 1:33858030-33858052 TCAGATGATTAGACACAGAATGG - Intronic
905104466 1:35556226-35556248 GCAGCTGTTCAGACAGAGCAGGG + Intronic
907245537 1:53106119-53106141 GCAGCGACCTACACACAGAAGGG - Intronic
907858195 1:58324654-58324676 GCAGGTGTCTTGGAACAGAAAGG - Intronic
908638586 1:66196397-66196419 GATGCTGCCTAGGCACAGAAGGG + Intronic
910667324 1:89739375-89739397 GCAGCCTTCTAGAGACAGTATGG + Intronic
911026138 1:93436971-93436993 GCAGCTGCCTAGGGACAGAGTGG + Intergenic
914884616 1:151574799-151574821 GCAGCTGTCCAGGCCCAGTAGGG + Intronic
915671656 1:157494264-157494286 GCTACTGTGTAGACACAGATGGG + Intergenic
918710538 1:187722529-187722551 GCTGTTGTCTATACACACAATGG + Intergenic
920500565 1:206482535-206482557 CCAGCTCTCTAGACACACCACGG - Intronic
923225556 1:231936008-231936030 GCAGCTGTCTAAACCTGGAATGG - Intronic
924905635 1:248449239-248449261 GCAGCTTTATTGCCACAGAAAGG + Intergenic
924922255 1:248642797-248642819 GCAGCTTTATTGCCACAGAAAGG - Intergenic
1065292423 10:24244468-24244490 TCAGATGTCTGGCCACAGAAGGG + Intronic
1072987469 10:100153863-100153885 ACAGTTCTATAGACACAGAATGG - Intronic
1076587940 10:131562058-131562080 GCAGCTGTGCATGCACAGAAAGG + Intergenic
1077364834 11:2157420-2157442 GCAGGTCTCTGGACACTGAAGGG + Intronic
1077595587 11:3528840-3528862 GAAGATGTCTAGACTCTGAAAGG - Intergenic
1080564028 11:33491705-33491727 GTAGCTGTCTGAAAACAGAATGG + Intergenic
1090001654 11:122965832-122965854 GAAGCTGTCTAAACAGAGGAAGG + Intergenic
1090626513 11:128613505-128613527 CCAGCTGCCTAGCCACAGCACGG - Intergenic
1092619925 12:10252820-10252842 GCAGCTGTGTGTACACAAAAGGG + Intergenic
1096604919 12:52757817-52757839 GCAGGAGTCAAGGCACAGAAGGG - Intergenic
1097259245 12:57706175-57706197 CCAGCAGTCTAGGTACAGAATGG - Intronic
1099037305 12:77604672-77604694 ACAGCTTTCTAGACACTCAAAGG - Intergenic
1101960185 12:109243230-109243252 ACAGCTGTCTAGACTTCGAATGG - Intronic
1102596574 12:113997321-113997343 GCAGCTGAGTACACAGAGAAGGG + Intergenic
1103962068 12:124615200-124615222 TCAGATTCCTAGACACAGAAAGG - Intergenic
1104573475 12:129945547-129945569 GCAGCTGTTTATACAGACAAGGG - Intergenic
1104806041 12:131590169-131590191 GCAGCTGTCAAGGAACAGAAAGG + Intergenic
1104972231 12:132537068-132537090 CCAGCTGTCTCCACACAGCAAGG - Intronic
1105014882 12:132780424-132780446 ACAGCTCTCTACACAGAGAAGGG + Intronic
1105067993 12:133216819-133216841 GCACCTGTCTAGAGAATGAAGGG - Intergenic
1106448342 13:29857140-29857162 ACAGCTGTAGAGACACATAAGGG - Intergenic
1107880257 13:44826414-44826436 GCAGTTGTCTTGAAACAGAGAGG + Intergenic
1111225400 13:85264924-85264946 GCAAATGTATAGAAACAGAAAGG - Intergenic
1111725403 13:92002004-92002026 GCAGATGTACAGGCACAGAAAGG - Intronic
1111738817 13:92176317-92176339 GAAGCTGTCTTGAGACACAAGGG - Intronic
1112205410 13:97319247-97319269 GCAGCTGTCTAGTCAAAGCTAGG + Intronic
1118221741 14:63860811-63860833 TAAGCTGTCTAGAAGCAGAAAGG + Intronic
1121207366 14:92180643-92180665 ACAGCTGTGGAGACCCAGAAAGG - Intergenic
1123574613 15:21654767-21654789 GAAGCTGTCAACACACAGACAGG - Intergenic
1123611227 15:22097263-22097285 GAAGCTGTCAACACACAGACAGG - Intergenic
1124345621 15:28919681-28919703 GCAGCTGTCTTGTCCCAGAAGGG + Intronic
1127566650 15:60195872-60195894 GCATCTGTCTGAACAAAGAATGG - Intergenic
1127785305 15:62350386-62350408 GCAGCTGTCTGGGTAGAGAAGGG + Intergenic
1127846955 15:62878376-62878398 GCAGCTCTCTAGCCACTGCAAGG - Intergenic
1128617088 15:69118651-69118673 TGAGATGTCAAGACACAGAAAGG + Intergenic
1202983477 15_KI270727v1_random:389019-389041 GAAGCTGTCAACACACAGACAGG - Intergenic
1132905528 16:2280730-2280752 TGAGCTGCCTGGACACAGAATGG + Intronic
1138427831 16:56948014-56948036 CCAGCTGTGTGGACACAGATTGG + Intergenic
1142617774 17:1146567-1146589 GCAGGTGTCTGGGCACTGAAGGG - Intronic
1142859131 17:2750071-2750093 GCTGCTGCCTAGACACGGGACGG - Intergenic
1142894506 17:2965171-2965193 ACAGCTGTCTTGACTCTGAAGGG - Intronic
1143032839 17:3977251-3977273 GCTGCTGTCTGGACACAGTGGGG + Intergenic
1146186645 17:30728688-30728710 CCAACTGTCCAGCCACAGAAAGG - Intergenic
1146833278 17:36088892-36088914 GAAGCTCTCTAGACAGAGATAGG - Intronic
1147263770 17:39223436-39223458 CCAGCTGGCCTGACACAGAAGGG + Intronic
1149559101 17:57595530-57595552 GCAGCTGTCTGTACACAGGAAGG - Intronic
1149762043 17:59240976-59240998 GAATCTGTCTAAACACAGAAAGG - Intronic
1150483514 17:65528493-65528515 ACAGATGTCTACACACAAAAGGG + Intergenic
1151271525 17:73000064-73000086 GCAATTCCCTAGACACAGAAAGG - Intronic
1151385865 17:73754942-73754964 GCAGGTGTCATGACAGAGAAAGG + Intergenic
1152273044 17:79336541-79336563 TCAGCTGTCTGGACTCACAAGGG + Intronic
1152742425 17:82024181-82024203 GCAGCTCCCTAGACCCAGGAAGG - Intronic
1154495770 18:14959526-14959548 GCATCAGACTAGACACAGACTGG + Intergenic
1156374371 18:36500376-36500398 GCAGAAGTCTAGTGACAGAAAGG - Intronic
1156637540 18:39049449-39049471 CCAGCCATCTGGACACAGAAGGG + Intergenic
1158785148 18:60702632-60702654 GCAGCAATCTAAAAACAGAAGGG + Intergenic
1160417787 18:78723527-78723549 GGAGCCGTGTACACACAGAAGGG + Intergenic
1160508542 18:79440730-79440752 GGAGCTGTTCAGACACAGCAGGG - Intronic
1164130418 19:22356637-22356659 GCAGCTGTCTTCCCACAGGAAGG + Intergenic
1164579216 19:29424255-29424277 GGAGCTGCCCAAACACAGAAGGG + Intergenic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1165753864 19:38280092-38280114 GCAGCTGTCTAGACACAGAATGG + Intronic
1166804694 19:45478622-45478644 GTAGCTGTCTAGCGACAGAGTGG - Intronic
926103182 2:10133628-10133650 GTGTCTGTCTGGACACAGAAGGG + Intergenic
926684336 2:15687175-15687197 TCAGAAGTCTAGACACAGCATGG - Intergenic
928691380 2:33802956-33802978 AAAGCTGTCTAGCAACAGAAGGG - Intergenic
929366125 2:41158829-41158851 GCAGGTGCATAGAAACAGAAGGG - Intergenic
929422938 2:41813363-41813385 GCAGAAGTCAAGAGACAGAAGGG + Intergenic
929446264 2:42003766-42003788 ACAGGGTTCTAGACACAGAAGGG - Intergenic
930075522 2:47402890-47402912 GCAGCTGAGTAAACACAGAAAGG + Intergenic
932094751 2:68837811-68837833 TCAGATTTCTAGACTCAGAATGG - Intergenic
937059655 2:118971607-118971629 TCAGCTGTCCAGACCCAGAATGG - Intronic
939405498 2:141750299-141750321 GCATCTTTCTAGAAATAGAAGGG - Intronic
940137036 2:150448781-150448803 GCAGCTTTGTACACACAGAAAGG - Intergenic
940816371 2:158302176-158302198 GCACCTGGCAAGAGACAGAAAGG + Intronic
941213824 2:162680004-162680026 GCATCTTTCTAGATAAAGAATGG + Intronic
942031287 2:171962730-171962752 TCAGCTGACTAGACACACCAGGG - Intronic
944405123 2:199375425-199375447 GCATCTGGCCAGACAGAGAACGG + Intronic
945163836 2:206921216-206921238 GGAGCTGACTAGACAAAGAAAGG + Intergenic
947109760 2:226706297-226706319 GCAACTTCCTAGACACAGGAAGG + Intergenic
947319662 2:228902768-228902790 GCAAATCTATAGACACAGAAAGG + Intronic
947865113 2:233391812-233391834 GCAGAGGTTTAGACAGAGAAAGG - Intronic
948345707 2:237296186-237296208 GCAGCTGTCTACGTACAGGATGG - Intergenic
1168918801 20:1513895-1513917 CCAGCATTCTAGACACAGATGGG - Intergenic
1168973790 20:1949079-1949101 GCAGCTGTGTAGGAACAGATTGG + Intergenic
1169310152 20:4531011-4531033 GCAGCCAGTTAGACACAGAAAGG + Intergenic
1171228139 20:23458575-23458597 GCAGCTCTCTGGACTCAGAGAGG + Intergenic
1172417926 20:34787191-34787213 GCTGCTGTCTGGAGACAGATTGG - Intronic
1172588393 20:36100914-36100936 GCAGCTGCCTAGAACCAGATGGG - Intronic
1174593234 20:51663263-51663285 GCATCTATCCAGACACACAAAGG + Intronic
1177122876 21:17159800-17159822 GAAGCTGCCTTGAAACAGAAAGG - Intergenic
1180698605 22:17769803-17769825 GCATCTGCCTAGAGACAGGAAGG - Intronic
1182699416 22:32223129-32223151 GCAGCTGTTTAGAAACATGAGGG - Intronic
1184382018 22:44150700-44150722 GTAGCTGTCTAGTGACAGAGTGG + Intronic
950330959 3:12155794-12155816 GCAGCGGGCTAGACACACAGAGG + Intronic
952534832 3:34298272-34298294 GAACCAGTCTTGACACAGAAAGG + Intergenic
952580114 3:34823521-34823543 GCAAATGTATAGACACAGGAAGG + Intergenic
952604003 3:35122145-35122167 AAAGATTTCTAGACACAGAAAGG + Intergenic
953838449 3:46368162-46368184 GCAGCTGTTTAAAGACAAAAAGG + Intergenic
955346487 3:58165462-58165484 GCAGCTGTGTAATCTCAGAATGG - Intronic
959418525 3:106105522-106105544 CCAGCTTTCTAGAAACTGAATGG + Intergenic
960186648 3:114649339-114649361 GAAGCTGTTTACACACAAAAGGG + Intronic
960853034 3:122075585-122075607 GCATCTGTCATGACACTGAAGGG + Intronic
961032357 3:123617771-123617793 GCAACCGTCTAGAAAGAGAAGGG - Intronic
963246198 3:143065693-143065715 GCTGCTGTGCAGAGACAGAATGG + Intergenic
963565963 3:146931172-146931194 GTTTCTGTCTAGAAACAGAATGG - Intergenic
965954966 3:174358983-174359005 GCAGCTGTCTACTCAGAAAAGGG - Intergenic
968256709 3:197280831-197280853 GCAGCTGTAGCAACACAGAAGGG - Intronic
970144595 4:13021789-13021811 GCTACAGTCTAGAGACAGAATGG - Intergenic
972489960 4:39577893-39577915 GTAGCCGTCAAGCCACAGAAGGG - Intronic
975166404 4:71182666-71182688 GCAACTTCCCAGACACAGAAAGG - Intergenic
975833642 4:78397706-78397728 ACAGCTGTCTAGGGACAGTAAGG - Intronic
977204889 4:94156914-94156936 GCAGCTGGCTTGATATAGAACGG + Intergenic
979322207 4:119337667-119337689 GCAGCTCTCTAGACACTCAAAGG - Intergenic
982069176 4:151680445-151680467 ACAGCTTTCTGGACACAGAAGGG + Intronic
982282439 4:153698500-153698522 GCAGCTATATGGACTCAGAAAGG - Intergenic
982533631 4:156580059-156580081 GCTGCTGTCTAGGTACAGGAAGG - Intergenic
983240187 4:165223280-165223302 GCAGCTCTCTAGACACTCAGAGG - Intronic
983794191 4:171839625-171839647 ACAGATTGCTAGACACAGAAGGG + Intronic
987047875 5:14124459-14124481 GCAGCAGGCTAGAGAGAGAATGG + Intergenic
987182282 5:15380457-15380479 TCAACTGACTAGAAACAGAAAGG + Intergenic
989274300 5:39569121-39569143 GGAGATGTCTGGAGACAGAAAGG - Intergenic
989343935 5:40408135-40408157 TCAGGTGTCTAGACAAAGAGAGG - Intergenic
990192593 5:53276846-53276868 ACAGCTCTCAAGAGACAGAAGGG - Intergenic
990492096 5:56312475-56312497 GCAGATGGCAAGTCACAGAATGG + Intergenic
992462128 5:76971024-76971046 GCAGCTTTCTGGAAACAAAATGG + Intronic
996078407 5:119226183-119226205 GCAGTTCTCTAAACAGAGAAAGG - Intronic
997141141 5:131381959-131381981 TCAGCTGTCCAGAAACTGAAAGG - Intronic
998767014 5:145499612-145499634 GCAGATGTCAGGACACAGAAAGG - Intronic
999955699 5:156699186-156699208 ATGGCTGTCTAGACACAGACAGG + Intronic
1000836906 5:166166521-166166543 GGAGCTGTCTATGCACTGAATGG + Intergenic
1001227578 5:169958479-169958501 ACAGCTTTCCATACACAGAAAGG + Intronic
1004253530 6:14042366-14042388 ACAGCTTTCTAGGCACAGAATGG - Intergenic
1006404891 6:33839183-33839205 GAAGCTGTGTAAACACAGGAGGG - Intergenic
1007315000 6:40979948-40979970 GCTGCTGACTAGACACAGCCAGG - Intergenic
1011525911 6:88264494-88264516 GCAATTGCCCAGACACAGAATGG - Intergenic
1012382170 6:98633265-98633287 GCAGCTTTCAATACAAAGAAAGG + Intergenic
1015601574 6:134915927-134915949 GCTGCAGTGTAGGCACAGAATGG + Intergenic
1016598132 6:145824488-145824510 GCAGGTGCCTGGAAACAGAAGGG + Intergenic
1016656036 6:146519524-146519546 GCACCTGGCTAGACACTGAGGGG - Intergenic
1016704118 6:147087275-147087297 GCAAATGTATAGATACAGAAAGG + Intergenic
1018871111 6:167782980-167783002 GCAGGTGTGTAGACAGAAAAGGG - Intergenic
1020904377 7:14047116-14047138 GCATCTCTCTATACATAGAAGGG - Intergenic
1021298508 7:18940162-18940184 GCATCTGTGTAGACACATAGAGG + Intronic
1021949523 7:25761231-25761253 GCAGCTCTCTAAAGACAGTATGG - Intergenic
1021949940 7:25764810-25764832 GCAGCTCTCTAAAGACAGTATGG - Intergenic
1024809660 7:53193102-53193124 ACAGCCGTGGAGACACAGAAAGG + Intergenic
1028569699 7:92273389-92273411 GATGTTGTCTAGAGACAGAAAGG - Intronic
1033192571 7:139295383-139295405 GCAGCTGTCTACACCCAGGGGGG - Intronic
1033463712 7:141571258-141571280 CCAGCTGACAAGACACAGGAGGG - Intronic
1035044651 7:155955733-155955755 CCAGATGTGTACACACAGAACGG + Intergenic
1038129253 8:24711045-24711067 GAAACTGCCTAGACAAAGAAAGG + Intergenic
1039905764 8:41785462-41785484 GCAGCTGTCTAGCTACGGAGAGG + Intronic
1040495992 8:47966057-47966079 GCAGATGACTGGACACAGAAAGG + Intronic
1044492253 8:92833479-92833501 GCTGCTGTGTAGAAACAGACTGG + Intergenic
1045204481 8:100023795-100023817 GCAGCTGACTAGAGACAAAAAGG - Intronic
1045468666 8:102491608-102491630 GCAGATGTCTTGACAGAGAAGGG + Intergenic
1045600445 8:103708870-103708892 GAAGCTGTCTAGAGAAAGGAAGG - Intronic
1047012947 8:120692174-120692196 GCAGCTGGCCAGAGCCAGAAGGG + Intronic
1047059774 8:121212188-121212210 TCAGCAGTGTAGACACTGAAGGG + Intergenic
1047243449 8:123116526-123116548 GCAGATAAATAGACACAGAAAGG + Intronic
1047365916 8:124211427-124211449 GCAGGTCTCTGGACAAAGAAAGG - Intergenic
1048794966 8:138141346-138141368 GAAGCTGTGGAGAAACAGAAGGG + Exonic
1049712204 8:144070173-144070195 GCAGCTGTTGAGTCACAGAATGG + Intergenic
1051750189 9:20333571-20333593 GCAGCCATCAACACACAGAAAGG + Intergenic
1051820036 9:21153919-21153941 GCAGCTATGTGGAGACAGAAAGG - Intergenic
1053100615 9:35369190-35369212 GTAGCTATCTAGGCAAAGAATGG - Intronic
1055293010 9:74803545-74803567 GTCACTGTCTAGACACAGCAGGG + Intronic
1056309528 9:85324884-85324906 GTAGGTGGCTAGACCCAGAAGGG + Intergenic
1057521519 9:95764164-95764186 GCAGCTGTCTGGGAACAGCAGGG + Intergenic
1059075677 9:111191454-111191476 GTAGCTGTAAAGACACAGACTGG + Intergenic
1061066358 9:128280212-128280234 GCAGGTGTGTAGAAAGAGAATGG - Intronic
1188607567 X:32051223-32051245 AGAGATGACTAGACACAGAAGGG - Intronic
1190756379 X:53405384-53405406 GCCACTGTCTACACACAGCAGGG + Exonic
1197054764 X:122104312-122104334 GCAGGTGTCTTGACACACACAGG + Intergenic
1197599935 X:128517193-128517215 ACAGCTGACTAGACACAGTCAGG + Intergenic
1200038180 X:153346590-153346612 GCTGCTCTCTGGTCACAGAAGGG + Intronic
1201710954 Y:16991159-16991181 GCAGCTGCTTATACACATAAAGG - Intergenic
1201897970 Y:19014204-19014226 GCAGCAGTAAAGACAGAGAAAGG + Intergenic