ID: 1165754600

View in Genome Browser
Species Human (GRCh38)
Location 19:38285248-38285270
Sequence TCTCATCACCACCAGCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 287}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165754600_1165754603 -8 Left 1165754600 19:38285248-38285270 CCTGAGAGCTGGTGGTGATGAGA 0: 1
1: 1
2: 3
3: 16
4: 287
Right 1165754603 19:38285263-38285285 TGATGAGACATTGGCCCTTTGGG No data
1165754600_1165754610 26 Left 1165754600 19:38285248-38285270 CCTGAGAGCTGGTGGTGATGAGA 0: 1
1: 1
2: 3
3: 16
4: 287
Right 1165754610 19:38285297-38285319 CCGAGTGTTCCAGAGACCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 74
1165754600_1165754602 -9 Left 1165754600 19:38285248-38285270 CCTGAGAGCTGGTGGTGATGAGA 0: 1
1: 1
2: 3
3: 16
4: 287
Right 1165754602 19:38285262-38285284 GTGATGAGACATTGGCCCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 89
1165754600_1165754611 27 Left 1165754600 19:38285248-38285270 CCTGAGAGCTGGTGGTGATGAGA 0: 1
1: 1
2: 3
3: 16
4: 287
Right 1165754611 19:38285298-38285320 CGAGTGTTCCAGAGACCCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1165754600_1165754604 -7 Left 1165754600 19:38285248-38285270 CCTGAGAGCTGGTGGTGATGAGA 0: 1
1: 1
2: 3
3: 16
4: 287
Right 1165754604 19:38285264-38285286 GATGAGACATTGGCCCTTTGGGG 0: 1
1: 0
2: 2
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165754600 Original CRISPR TCTCATCACCACCAGCTCTC AGG (reversed) Intronic
900474671 1:2870497-2870519 TCTCAGCACCCACAGCTCTCAGG - Intergenic
900555337 1:3277455-3277477 TCTCCTCACCACAGGGTCTCTGG + Intronic
901236891 1:7672042-7672064 TCTCATCACCACCAGCCCTCAGG + Intronic
902817701 1:18925651-18925673 GATCATCATAACCAGCTCTCTGG - Intronic
903691699 1:25178626-25178648 TACAATCACCACCTGCTCTCAGG + Intergenic
904769839 1:32874817-32874839 CCTCAGCACCACCAGCACTCAGG - Intergenic
904826573 1:33277085-33277107 TGTCATCACCACCATCTTCCGGG - Intronic
905315260 1:37078844-37078866 TCTCCTCACCTCCTGATCTCAGG - Intergenic
905802804 1:40856186-40856208 TTTTATCAGCACCAGCCCTCAGG + Intergenic
905872509 1:41413143-41413165 TCTCCTCTCCACCAGAGCTCTGG - Intergenic
906209168 1:44002714-44002736 CCTAATCACCACCAGCCCCCTGG + Intronic
906804683 1:48769304-48769326 TCTCACTCCCACCACCTCTCTGG + Intronic
910742965 1:90541412-90541434 TCAGCTCACCTCCAGCTCTCAGG - Intergenic
911357076 1:96835780-96835802 TCTCACCTCCCCCAGCTCTGCGG + Intergenic
912755887 1:112324709-112324731 TCTCACCACCACCTGCACTTGGG + Intergenic
916490848 1:165301080-165301102 ACTCAAAACCACCAACTCTCAGG + Intronic
916747929 1:167698567-167698589 TCTGCTCCCCACCAGCTCCCAGG + Intronic
917284633 1:173411217-173411239 ACTCATCACCAGCACCCCTCAGG + Intergenic
917965844 1:180178090-180178112 TCTAATACCCCCCAGCTCTCAGG + Intronic
918118985 1:181521259-181521281 CCTCCTCTCCACCAGCCCTCTGG + Intronic
918254343 1:182735495-182735517 TCTCATCAGATCTAGCTCTCAGG - Intergenic
921065696 1:211620830-211620852 TGTCTTCACCACAAGGTCTCTGG + Intergenic
921264916 1:213414452-213414474 TCACATCACCTCCTGCTCTATGG - Intergenic
923102034 1:230824423-230824445 TCTCATCTCCACCAGGCCACAGG + Intergenic
924039060 1:239965461-239965483 ATTCATCACCACCAGGTCTCCGG - Intergenic
924112154 1:240711032-240711054 TCCCACCTCCAACAGCTCTCAGG + Intergenic
1066514047 10:36135766-36135788 TATCATCATCATCATCTCTCAGG + Intergenic
1067285701 10:44906211-44906233 TCACATCACCACCAACACTCTGG - Intergenic
1068429846 10:56917425-56917447 TCTTTTGAACACCAGCTCTCTGG + Intergenic
1069566514 10:69466981-69467003 TCGCATCAGCGCCAGCCCTCTGG + Intronic
1069603715 10:69726571-69726593 TACCATCACCCCCAGCTCTGTGG + Intergenic
1070580717 10:77717148-77717170 GCCCATCACCACCAGCCCTGGGG - Intergenic
1070638097 10:78145390-78145412 TCCCATCACCACCACCCCTCAGG - Intergenic
1070665105 10:78337189-78337211 TCCAATCCACACCAGCTCTCAGG + Intergenic
1075397576 10:122139021-122139043 GGTCATCACCAGCAGCTCTGCGG - Intronic
1075930079 10:126288357-126288379 TCCCAGCACCCTCAGCTCTCCGG + Intronic
1077020772 11:416296-416318 TCTCAGCGTCACCATCTCTCAGG + Intronic
1077115889 11:884500-884522 TCTCAGCAACCCCAGCTCTTGGG - Intronic
1077881866 11:6357097-6357119 TGGCATCACAGCCAGCTCTCAGG + Intergenic
1078050396 11:7960726-7960748 TCTCATCACCACCCGGCCCCTGG - Exonic
1079312538 11:19379158-19379180 TCTCCTCACCACCAGCCCCGTGG - Intronic
1080956505 11:37102927-37102949 ACACATCACCAACAGCTCTTTGG + Intergenic
1081445147 11:43123983-43124005 TCTCATCACAACCAGCTACAAGG + Intergenic
1084762487 11:71282945-71282967 TGTCTTCTCCACCTGCTCTCTGG - Intergenic
1084860163 11:72012976-72012998 AGTCATCACCTCCAGCTCCCGGG + Exonic
1084900111 11:72303272-72303294 CCCCATCATCACCGGCTCTCAGG - Intronic
1084954550 11:72684427-72684449 CCTCATTACCACCCGCTCTTCGG - Intergenic
1085302937 11:75468920-75468942 TGACATCACCACCACCTCACAGG + Intronic
1089285804 11:117407286-117407308 TCTCATCACCACCACCACCATGG - Intronic
1090420309 11:126570729-126570751 ACTCCTCACCACCAGCTGTGGGG + Intronic
1090772172 11:129930949-129930971 TCCTCCCACCACCAGCTCTCTGG - Intronic
1090998189 11:131885866-131885888 TCTCATCAACTACACCTCTCTGG - Intronic
1092525277 12:9306000-9306022 TCTCATCCCACCCAGCTCTTTGG + Intergenic
1092541995 12:9425817-9425839 TCTCATCCCACCCAGCTCTTTGG - Intergenic
1092722962 12:11459748-11459770 ACTCACCACTACCAGCTCACTGG + Intronic
1093323424 12:17742358-17742380 CCTCATCACCATAAGCCCTCTGG - Intergenic
1093441557 12:19203455-19203477 TCTCCACACCACCAGTTCCCAGG + Intronic
1093563976 12:20579640-20579662 GTTCCTCAGCACCAGCTCTCAGG + Intronic
1094511015 12:31096622-31096644 TCTCATCCCACCCAGCTCTTTGG + Exonic
1097710718 12:62914195-62914217 CCTTATAACAACCAGCTCTCAGG - Intronic
1099381880 12:81964465-81964487 TCACAGCAACACCATCTCTCGGG - Intergenic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1105494958 13:20922364-20922386 TCACATCATCTCTAGCTCTCAGG - Intergenic
1106109249 13:26761966-26761988 TCTCATCATCCTCAGCTCCCTGG + Intergenic
1107206511 13:37796565-37796587 TTTTCTCATCACCAGCTCTCAGG + Intronic
1107941680 13:45382129-45382151 CCTCATCCCCCCCGGCTCTCAGG - Intergenic
1108053017 13:46464143-46464165 CCTCATCCCCCCCGGCTCTCAGG + Intergenic
1108053406 13:46465541-46465563 CCTCACCCCCACCGGCTCTCAGG + Intergenic
1108836048 13:54550232-54550254 TCTCAACTCCTCCAGCTTTCAGG - Intergenic
1113025667 13:105938378-105938400 TCTCATCACCACCAGTTCACAGG + Intergenic
1114066307 14:19062171-19062193 TCTCATCCTCCCCAGCTTTCGGG - Intergenic
1114095961 14:19337853-19337875 TCTCATCCTCCCCAGCTTTCGGG + Intergenic
1116110170 14:40568897-40568919 TCTCAGCTCCAACAGATCTCAGG - Intergenic
1116216407 14:42023016-42023038 TCACATCAACAAAAGCTCTCTGG - Intergenic
1117515338 14:56495089-56495111 TCTGATCACCCCCAGCTCTAAGG + Intronic
1117580147 14:57143692-57143714 TCTCATTAGCACCAGCTCTGGGG + Intergenic
1117770253 14:59127023-59127045 TCCCATCATCCCCAGCTCTAAGG + Intergenic
1118198521 14:63650507-63650529 TCTCACCACCACCCACCCTCTGG - Intergenic
1119653985 14:76403680-76403702 TGTCACCACCTCCACCTCTCTGG - Intronic
1120093773 14:80364730-80364752 TCTATTCACCACCAGCTCTTTGG + Intronic
1122219685 14:100229284-100229306 TCCCATCATCCCCAACTCTCCGG + Intergenic
1124853372 15:33362461-33362483 TCTCATCACCACCATTTCATGGG + Intronic
1126536176 15:49767991-49768013 GCTAATCACCACCAAATCTCTGG + Intergenic
1128053254 15:64681838-64681860 TCTCACCTCCACCAGACCTCCGG + Exonic
1128378419 15:67093660-67093682 TCTTAGCAGCAGCAGCTCTCTGG - Intronic
1130024790 15:80261751-80261773 TCTCTGCACCACAAGCCCTCAGG - Intergenic
1130103712 15:80913222-80913244 TTTCTTCACCACCAACTCTTGGG + Intronic
1130747744 15:86674289-86674311 TCCCATCTCCTCCAGTTCTCTGG - Exonic
1131048031 15:89328578-89328600 CATTACCACCACCAGCTCTCAGG + Intronic
1131148412 15:90031161-90031183 ACCCATCACCACCAACTGTCGGG - Intronic
1131166443 15:90145391-90145413 TCTCCTCTCCACCAGCTGCCAGG + Intergenic
1132286598 15:100668082-100668104 TCTCATCAGCTCCAGCTCTGTGG - Intergenic
1132389502 15:101428120-101428142 TCTCATCACCAACCCCACTCTGG + Intronic
1133249879 16:4474159-4474181 TCCCATTACCCCCAGATCTCTGG - Exonic
1133863049 16:9614617-9614639 CCTCATCTCTACCAGCTCTCGGG - Intergenic
1136030927 16:27502338-27502360 TCCCATCACCACCACCTCCTGGG - Intronic
1136270747 16:29146859-29146881 TGTCACCACCACCTGCTTTCAGG - Intergenic
1137583905 16:49652384-49652406 TTTGATCACAGCCAGCTCTCGGG - Intronic
1138729495 16:59179006-59179028 TCTCTTAAACACCTGCTCTCAGG - Intergenic
1140421943 16:74826518-74826540 TCTCACCACCACCACATCACTGG + Intergenic
1140645105 16:77021378-77021400 TCTCATCCCAACCAGCTTTTAGG - Intergenic
1141243640 16:82286432-82286454 GTTCATCATCACCAGCACTCAGG - Intergenic
1141700734 16:85640906-85640928 TCCCCTGACCACCAGCCCTCTGG - Intronic
1142362788 16:89635256-89635278 CCTCACCACCACCAGCTCCTGGG + Intronic
1143495980 17:7312835-7312857 TTTCATCACCACCACCAGTCGGG - Exonic
1144705211 17:17363584-17363606 CCCCATCACCACCACCTCCCCGG - Intergenic
1144825988 17:18105989-18106011 TCACATCACCCCCAACTCCCAGG - Intronic
1145986989 17:29053613-29053635 TCTCTTGAGCACCAACTCTCGGG - Intronic
1146683208 17:34823351-34823373 TCTCTGCCCCACCACCTCTCAGG + Intergenic
1148645628 17:49218310-49218332 TCTCACCAACAGCAGCTCTGGGG - Intronic
1148949452 17:51297497-51297519 TCTCAGAACCACCACATCTCAGG - Intronic
1149434197 17:56619437-56619459 TCTCCTCACCACGAACTGTCCGG + Intergenic
1151722387 17:75864799-75864821 CCTCCTCTCCTCCAGCTCTCTGG - Intergenic
1152148722 17:78585428-78585450 TCTGATCAGCACCATCACTCTGG + Intergenic
1155349706 18:24894541-24894563 TTTCACCACCACCAGATTTCAGG - Intergenic
1156310559 18:35918481-35918503 ACTCCTGACCCCCAGCTCTCTGG - Intergenic
1157430603 18:47621356-47621378 TCCCATGCCCTCCAGCTCTCTGG - Intergenic
1158184548 18:54756573-54756595 GTTCATCAACACCAGCTCTGTGG - Intronic
1159755087 18:72354273-72354295 TCTCATCACTTCCAGCTCCATGG - Intergenic
1159910120 18:74138124-74138146 TCTCCCCACCCCCATCTCTCTGG + Intronic
1159914102 18:74173460-74173482 TCTCTTCTCCGCCAGCTCTGTGG + Intergenic
1160490247 18:79331820-79331842 CCTCAACACCTCCAGCTATCCGG - Intronic
1160571511 18:79820438-79820460 TCCCATCCTCACCAGCACTCAGG + Intergenic
1161294004 19:3510554-3510576 TCTCATCCCCACCAGCCTGCAGG + Intronic
1162129242 19:8515351-8515373 GGACATCACCACCAGCTATCCGG - Intergenic
1163726137 19:18924191-18924213 TGTCAACCCCTCCAGCTCTCAGG - Intronic
1163751633 19:19081653-19081675 CCTCACCACCTCCAGGTCTCAGG + Intronic
1164802291 19:31087631-31087653 CCTCAGCACCCCCAGCTCACAGG - Intergenic
1165443893 19:35846084-35846106 TGTGACCAGCACCAGCTCTCGGG + Exonic
1165731547 19:38148944-38148966 TCTCATCACACACAGCTCTGGGG - Intronic
1165754600 19:38285248-38285270 TCTCATCACCACCAGCTCTCAGG - Intronic
1166024915 19:40073772-40073794 TCTCATCAATATGAGCTCTCTGG + Exonic
1166046720 19:40234440-40234462 TCTTCTCACCACCATCTCCCTGG + Intronic
1166631318 19:44410290-44410312 TCTCTTCACCCCCAGGCCTCAGG + Intergenic
1166631525 19:44411490-44411512 TGTCTTCACCCCCAGCCCTCAGG + Intergenic
1166636655 19:44457131-44457153 TGTCTTCACCCCCAGCCCTCAGG - Intergenic
1166636854 19:44458304-44458326 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1166638672 19:44474314-44474336 TCTCTTCACCACCAGCCCTCAGG - Intergenic
1167350152 19:48969305-48969327 CCTCAGCCCCACCAGCTCCCTGG - Exonic
1167412369 19:49352386-49352408 TCTCTTCACCACTATCTCTTGGG - Intronic
1202648929 1_KI270706v1_random:163325-163347 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1202649331 1_KI270706v1_random:166264-166286 TCTCTTCACCCCCAGGCCTCAGG + Intergenic
925857337 2:8142439-8142461 TCTCCTCCCCCCCAGCTCTGTGG - Intergenic
927327815 2:21826205-21826227 TTTCATCATCACCACCACTCAGG + Intergenic
927492193 2:23527949-23527971 CCCCATCACCACCACCCCTCTGG + Intronic
928909323 2:36402694-36402716 TCTCTTCATCTCCAGCTCTCAGG - Intronic
931241934 2:60461567-60461589 TCTCTCCACCGCCAGCTCCCCGG - Exonic
932872505 2:75416681-75416703 TCTCATCACCCAGTGCTCTCAGG + Intergenic
933190691 2:79330429-79330451 ACTCAACACCACCTCCTCTCTGG + Intronic
935813636 2:106825802-106825824 TTTCTTCACCACCAGGTTTCTGG + Intronic
937630249 2:124093304-124093326 ATTCCTCACCACAAGCTCTCAGG - Intronic
937778182 2:125806062-125806084 TCTCCTCACCAAAACCTCTCAGG - Intergenic
938483703 2:131682308-131682330 TCTCATCCTCCCCAGCTTTCGGG - Intergenic
938650830 2:133381810-133381832 TCACATCACCCCTAGCTCTGGGG + Intronic
938824959 2:134995452-134995474 ACTCCACACCACCTGCTCTCTGG - Intronic
943326560 2:186505820-186505842 CCTCATCACCACCTGTTCCCTGG - Exonic
945181189 2:207092979-207093001 TCTCAGCCCCACCATCTCACTGG + Intronic
946026186 2:216673252-216673274 TCTCCCCACCACCACCTCTGTGG - Exonic
948411328 2:237763777-237763799 ATTCTTCACCACCAGCCCTCGGG - Exonic
1171869744 20:30515306-30515328 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1171870530 20:30521084-30521106 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1172814542 20:37676072-37676094 TCTCACCACCACCTTCTCTGCGG + Intergenic
1175831448 20:61967166-61967188 TCCCCTCACCAGCAGCCCTCTGG - Intronic
1176602490 21:8806282-8806304 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1176602889 21:8809217-8809239 TCTCTTCACCCCCAGGCCTCAGG + Intergenic
1176603125 21:8810534-8810556 TGTCTTCACCCCCAGCCCTCAGG + Intergenic
1176611856 21:8991052-8991074 TCTCTTCACCCCCAGGCCTCAGG + Intergenic
1179572612 21:42286839-42286861 TCCCCTCACCTCCCGCTCTCTGG - Intronic
1180344775 22:11697835-11697857 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1180345174 22:11700774-11700796 TCTCTTCACCCCCAGGCCTCAGG + Intergenic
1180345411 22:11702091-11702113 TGTCTTCACCCCCAGCCCTCAGG + Intergenic
1180352311 22:11815221-11815243 TGTCTTCACCCCCAGCCCTCAGG - Intergenic
1180352949 22:11819016-11819038 TCTCTTCACCCCCAGGCCTCAGG + Intergenic
1180385898 22:12176845-12176867 TGTCTTCACCCCCAGCCCTCAGG + Intergenic
1180484785 22:15784762-15784784 TCTCATCCTCCCCAGCTTTCGGG - Intergenic
1180951499 22:19722601-19722623 TCTCAGCACCACCCCCTCCCAGG + Exonic
1181030407 22:20146758-20146780 TTTCATCTCCCCAAGCTCTCGGG - Intronic
1182714110 22:32341241-32341263 TCTCATCTCCACCCACTCCCTGG - Intergenic
1182972950 22:34594632-34594654 TTTCATCAAAACCTGCTCTCAGG + Intergenic
1183084877 22:35480635-35480657 TCACATCTCTACCAGCCCTCAGG - Intergenic
1183231726 22:36586519-36586541 TCACATCAAGCCCAGCTCTCAGG - Intronic
1184079521 22:42209639-42209661 TCTCATACTCACCATCTCTCTGG + Exonic
949216603 3:1577347-1577369 TCTCACCACCTCCAGTCCTCCGG + Intergenic
949883355 3:8677827-8677849 CCACTCCACCACCAGCTCTCAGG + Intronic
950105902 3:10388298-10388320 CCTCTTCACCACCAGCCCCCAGG + Exonic
951941771 3:28087244-28087266 TCTTTTCTCCCCCAGCTCTCGGG - Intergenic
953221833 3:40978795-40978817 TCTCATTATCACCAGCAGTCTGG - Intergenic
954574928 3:51670879-51670901 TCTCCTCAGCCCCAGCTCCCTGG + Intronic
956927823 3:74008495-74008517 TTTCCTCACCTCCAGTTCTCAGG + Intergenic
958294873 3:91891233-91891255 TGTCTTCACCCCCAGCCCTCAGG + Intergenic
958741769 3:98082561-98082583 TCTCATTTCTCCCAGCTCTCTGG + Intergenic
959510243 3:107202655-107202677 CATAATCACCACCAGCTCTGTGG - Intergenic
960962511 3:123082265-123082287 TCTCAACCCCACAAGCTCCCTGG - Intronic
966086180 3:176068995-176069017 TCGCTCCACCACCAGGTCTCTGG - Intergenic
966174742 3:177125301-177125323 GCTCAACATCACCAGCTATCAGG + Intronic
966371882 3:179259360-179259382 ATTCTTCACCACCAGCCCTCGGG + Intronic
967438195 3:189475954-189475976 TTTGCTCACCACCAGCTCCCAGG - Intergenic
967604037 3:191423164-191423186 TCTCATATCCACCATCTCTAAGG + Intergenic
970414041 4:15838794-15838816 TCCCATCACCATCAACTCTTTGG - Intronic
973374950 4:49280117-49280139 TGTCTTCACCCCCAGCCCTCAGG - Intergenic
973375138 4:49281143-49281165 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
973376038 4:49287165-49287187 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
973376961 4:49293328-49293350 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
973377672 4:49298310-49298332 TGTCTTCACCCCCAGCCCTCAGG - Intergenic
973377882 4:49299483-49299505 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
973378592 4:49304446-49304468 TGTCTTCACCCCCAGCCCTCAGG - Intergenic
973378827 4:49305763-49305785 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
973379391 4:49309891-49309913 TCTCTTCACCCCCAGGCCTCAGG + Intergenic
973380265 4:49315887-49315909 TCTCTTCACCCCCAGGCCTCAGG + Intergenic
973380467 4:49317057-49317079 TGTCTTCACCCCCAGCCCTCAGG + Intergenic
973381184 4:49322053-49322075 TCTCTTCACCCCCAGGCCTCAGG + Intergenic
973381481 4:49323664-49323686 TGTCTTCACCCCCAGCCCTCAGG + Intergenic
973382273 4:49329098-49329120 TCTCTTCACCCCCAGGCCTCAGG + Intergenic
973382461 4:49330124-49330146 TGTCTTCACCCCCAGCCCTCAGG + Intergenic
973385810 4:49513710-49513732 TCTCTTCACCCCCAGGCCTCAGG + Intergenic
973386046 4:49515027-49515049 TGTCTTCACCCCCAGCCCTCAGG + Intergenic
973837339 4:54823442-54823464 TCTCATAAACAACAGCTCTTTGG - Intergenic
979004267 4:115270038-115270060 TATCTTGACCACCAGCTGTCAGG - Intergenic
984892355 4:184504929-184504951 TCTCATCACTTCCAGGCCTCCGG - Intergenic
985717686 5:1471829-1471851 GCTCCTCACCTCCTGCTCTCTGG - Intronic
985717707 5:1471933-1471955 GCTCCTCACCTCCTGCTCTCTGG - Intronic
990608862 5:57437708-57437730 TCAAATCAAAACCAGCTCTCAGG + Intergenic
991557909 5:67916125-67916147 TGTTATCACCTCCATCTCTCAGG - Intergenic
996400112 5:123053284-123053306 TCTCATCACCATCACCACCCTGG + Intergenic
997344103 5:133172763-133172785 TCTCATCACCACCAGTTTTTTGG + Intergenic
998682189 5:144481042-144481064 CCTCATCACTACCAGATCCCTGG - Exonic
1001953643 5:175833366-175833388 TTTCTTCACCACGAGTTCTCTGG - Intronic
1002066892 5:176656366-176656388 TCTCATGAGCACCAAATCTCTGG - Intronic
1003227081 6:4215701-4215723 TCTTTTCAAAACCAGCTCTCAGG - Intergenic
1003362586 6:5442848-5442870 TCTCATCCACACCAGGCCTCTGG + Intronic
1003929461 6:10909601-10909623 TCTCCTAACCAACAGCTCTCAGG - Intronic
1004462268 6:15848710-15848732 TCTCATGACCTGAAGCTCTCTGG + Intergenic
1006436667 6:34029317-34029339 TCTCCTGACCCCCAGCTCTATGG + Intronic
1006803869 6:36776420-36776442 CATCCTCACCACCAGCTCTGAGG - Intronic
1006811526 6:36823324-36823346 TATCATCACCACAAGCACTCCGG + Intronic
1007269491 6:40625559-40625581 TCTCTTCACCTCCAGCACTAAGG + Intergenic
1007418594 6:41706227-41706249 TCCCATCCCCTCCAGCTGTCTGG - Intronic
1007545225 6:42688219-42688241 TCTTATCACCACCTGATTTCGGG - Exonic
1010236588 6:73579931-73579953 TCTCCTAACCACCAGGCCTCTGG + Intergenic
1012425410 6:99108693-99108715 CCTCATCTCCACTAGCTTTCTGG + Intergenic
1012444251 6:99292092-99292114 ACTGATCACCACCAGACCTCTGG + Intronic
1013194973 6:107837101-107837123 CCCCACCACCACCATCTCTCTGG + Intergenic
1015666675 6:135638355-135638377 TTTCAACACCAGTAGCTCTCTGG + Intergenic
1016478701 6:144457624-144457646 ACTGTTCACCACCATCTCTCAGG - Intronic
1018268409 6:162050841-162050863 TCTCATCAACTCCAGCTGTGTGG - Intronic
1019326373 7:440313-440335 TCTCCACACCAGAAGCTCTCTGG - Intergenic
1019504699 7:1385167-1385189 TCTCTTGGCCACCAGCTCCCTGG + Intergenic
1021633570 7:22669231-22669253 CTTCACCTCCACCAGCTCTCAGG + Intergenic
1023768172 7:43531324-43531346 TCTCTTCACCACTTGCTCTGTGG + Intronic
1024178305 7:46862951-46862973 GCTCACCATCACCATCTCTCAGG + Intergenic
1024231520 7:47367325-47367347 CCTGACCACCTCCAGCTCTCTGG + Intronic
1024232128 7:47370743-47370765 TCCCACCACCAGCAGCTCCCTGG - Intronic
1026045054 7:66901429-66901451 GCTGCTCACCACCAGCTCTGTGG - Intergenic
1029661436 7:101964888-101964910 TCTCATCTCCACCTGATCCCAGG + Intronic
1029970506 7:104784040-104784062 ACACATCACCAGCAGCACTCTGG - Intronic
1030564541 7:111136769-111136791 TATCATCATCACCAGCACTTAGG + Intronic
1031663781 7:124459973-124459995 TCTCACCACCACCAGTGCCCTGG + Intergenic
1032501394 7:132402903-132402925 GCTCTTCAACACTAGCTCTCTGG - Intronic
1033540475 7:142351282-142351304 TCACATCACAACCTGCTCTGAGG - Intergenic
1034359625 7:150482920-150482942 TCTCATTACCCCCAACTCTGTGG + Intergenic
1034542220 7:151765550-151765572 TCTCAGCTCCACCAGCTCCCTGG + Intronic
1036474113 8:9077532-9077554 TCTCATCACCACCACCCTCCAGG - Intronic
1038482477 8:27911118-27911140 CCTCGTCACTACCAGCTCTAAGG + Intronic
1040853023 8:51921581-51921603 CCTCATCCCCACCAGCTGCCAGG - Intergenic
1041600217 8:59708452-59708474 TCTCTTCACTGCCAACTCTCTGG - Intergenic
1047225609 8:122953344-122953366 TCTCGACTCGACCAGCTCTCCGG + Exonic
1047240295 8:123081289-123081311 TCACATCACCACCAAGCCTCAGG + Intronic
1048232467 8:132657439-132657461 TCTCTGCTCTACCAGCTCTCAGG - Intronic
1048301451 8:133254404-133254426 TCTCATGAGCACCAGCTCGGTGG + Intronic
1049354325 8:142180083-142180105 TCTCATCTCCACCAGCTCCCCGG - Intergenic
1049435097 8:142582920-142582942 TGTCATCACCACCAACCCTGGGG + Intergenic
1050171587 9:2825138-2825160 TCTTATCACCACCACCTCCTAGG - Intronic
1052780706 9:32779678-32779700 TGCCATCACCCCCATCTCTCAGG - Intergenic
1053042429 9:34885891-34885913 TCTCTCCACACCCAGCTCTCTGG + Intergenic
1056923864 9:90815580-90815602 TCGCCCCACCACCAGCACTCAGG + Intronic
1057218077 9:93240481-93240503 TCTCATCATCTTCAGCTCTGTGG + Intronic
1058680831 9:107438864-107438886 TCTGATCACTATCAGCTGTCTGG - Intergenic
1061661570 9:132133660-132133682 TCCCACCATCACCAGCTCTCAGG + Intergenic
1062029082 9:134353915-134353937 TCCCATCACCACCAGCCTTGGGG - Intronic
1062385340 9:136307139-136307161 TCCCAGCAGCACCAGCTCCCAGG + Intergenic
1203698854 Un_GL000214v1:119392-119414 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1203699576 Un_GL000214v1:124373-124395 TGTCTTCACCCCCAGCCCTCGGG - Intergenic
1203699813 Un_GL000214v1:125690-125712 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1203700714 Un_GL000214v1:131682-131704 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1203701438 Un_GL000214v1:136675-136697 TGTCTTCACCCCCAGCCCTCAGG - Intergenic
1203479550 Un_GL000224v1:280-302 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1203480276 Un_GL000224v1:5259-5281 TGTCTTCACCCCCAGCCCTCAGG - Intergenic
1203480516 Un_GL000224v1:6576-6598 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1203481243 Un_GL000224v1:11587-11609 TGTCTTCACCCCCAGCCCTCAGG - Intergenic
1203481483 Un_GL000224v1:12904-12926 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1203482207 Un_GL000224v1:17896-17918 TGTCTTCACCCCCAGCCCTCAGG - Intergenic
1203482447 Un_GL000224v1:19213-19235 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1203548767 Un_KI270743v1:151616-151638 TGTCTTCACCCCCAGCCCTCAGG - Intergenic
1203549034 Un_KI270743v1:153077-153099 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1203549416 Un_KI270743v1:155472-155494 TCTCTTCACCCCCAGGCCTCAGG + Intergenic
1203549649 Un_KI270743v1:156789-156811 TGTCTTCACCCCCAGCCCTCAGG + Intergenic
1203550374 Un_KI270743v1:161784-161806 TCTCTTCACCCCCAGGCCTCAGG + Intergenic
1203550592 Un_KI270743v1:162954-162976 TGTCTTCACCCCCAGCCCTCAGG + Intergenic
1203568229 Un_KI270744v1:109367-109389 TGTCTTCACCGCCAGCCCTCAGG - Intergenic
1203568304 Un_KI270744v1:109802-109824 TGTCTTCACCGCCAGCCCTCAGG - Intergenic
1203568580 Un_KI270744v1:111404-111426 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1203569153 Un_KI270744v1:115638-115660 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1203569867 Un_KI270744v1:120610-120632 TGTCTTCACCCCCAGCCCTCAGG - Intergenic
1203570102 Un_KI270744v1:121927-121949 TCTCTTCACCCCCAGGCCTCAGG - Intergenic
1188708946 X:33370541-33370563 GCTCAACACCACCAGTTATCAGG - Intergenic
1189309726 X:40010751-40010773 TCACAGCACCAGCAGCTCTAAGG - Intergenic
1191937123 X:66437931-66437953 TATCACCTCCACCACCTCTCAGG + Intergenic
1192177909 X:68897435-68897457 TCCCATCCCCACCAGCACCCTGG + Intergenic