ID: 1165755264

View in Genome Browser
Species Human (GRCh38)
Location 19:38289170-38289192
Sequence AGCGATATGTTCAACTATGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165755260_1165755264 7 Left 1165755260 19:38289140-38289162 CCCAGAAGGCAGGATTCTGAAGA 0: 1
1: 0
2: 1
3: 41
4: 299
Right 1165755264 19:38289170-38289192 AGCGATATGTTCAACTATGAAGG 0: 1
1: 0
2: 1
3: 0
4: 106
1165755261_1165755264 6 Left 1165755261 19:38289141-38289163 CCAGAAGGCAGGATTCTGAAGAC 0: 1
1: 1
2: 1
3: 13
4: 235
Right 1165755264 19:38289170-38289192 AGCGATATGTTCAACTATGAAGG 0: 1
1: 0
2: 1
3: 0
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165755264 Original CRISPR AGCGATATGTTCAACTATGA AGG Exonic
902959787 1:19955010-19955032 AGCGATGTTTTCAACTCTCATGG + Intergenic
907462969 1:54616309-54616331 ATCGAAATGTGAAACTATGATGG - Intronic
915866323 1:159503174-159503196 AGCGAGATTTCCAGCTATGAAGG + Intergenic
916906061 1:169284818-169284840 AGCTATATGTGCAATTATTAAGG + Intronic
921225110 1:213011087-213011109 AGAAATGTGTTCAAATATGAGGG + Intronic
1063209837 10:3870078-3870100 AGTAATGTGTTCAACTGTGAGGG + Intergenic
1063731653 10:8704168-8704190 AGTGAAATGTTCAACAATGCAGG - Intergenic
1067783173 10:49223645-49223667 AGAGATGTGTACAACTAAGAGGG - Intergenic
1072384667 10:94912395-94912417 AGCCAAATGTCCAACAATGATGG + Intergenic
1088012916 11:105024731-105024753 TGTAATGTGTTCAACTATGAAGG + Intergenic
1090742036 11:129672330-129672352 ATTGAAATGTTCAAGTATGATGG - Intergenic
1095062411 12:37714251-37714273 AAAGATAGGTTCAACTATGTAGG - Intergenic
1111689710 13:91548186-91548208 AGTGATATGATCATCTATGTAGG + Intronic
1112765952 13:102743796-102743818 TGCCAAATGTTTAACTATGAAGG - Exonic
1113418620 13:110152325-110152347 AGCGAGATGTTCAAGTAAGTGGG - Exonic
1119267122 14:73269590-73269612 AGAGATATGTTCAAATAAGCAGG + Intronic
1123156234 14:106229213-106229235 AGAAAGATGGTCAACTATGAAGG - Intergenic
1133487143 16:6231300-6231322 AGGGATATGTTGAAAGATGAAGG + Intronic
1134374173 16:13654693-13654715 AGCAATATGTTCACCAATCAGGG - Intergenic
1138308139 16:55997512-55997534 GGGGATATGTTCAATTATTATGG - Intergenic
1138755042 16:59474064-59474086 AGGAATATGTTTAACTAAGAAGG + Intergenic
1138761833 16:59553724-59553746 AGGGATATGTTTTATTATGATGG - Intergenic
1162855163 19:13462481-13462503 TGCAATATGATCAACTATTATGG + Intronic
1165755264 19:38289170-38289192 AGCGATATGTTCAACTATGAAGG + Exonic
926098898 2:10100989-10101011 AATTATATGTTCAATTATGATGG + Intergenic
939574212 2:143876695-143876717 AGCACTATGTTAAAGTATGAGGG - Intergenic
940929108 2:159405911-159405933 AGTGATATTTTCATTTATGAAGG + Intronic
944824199 2:203464651-203464673 AGAAATATGTTCAGCTTTGAGGG - Intronic
1174758088 20:53179685-53179707 AGCGATATGTTCAACAGGCAAGG - Intronic
955737388 3:62053927-62053949 GGTGAAATGTTCAAATATGAAGG + Intronic
963902284 3:150744109-150744131 AGTGATAAATTCATCTATGAAGG - Intronic
964152571 3:153545200-153545222 AGCAATATGTTAAACTAAGGAGG - Intergenic
964628312 3:158780558-158780580 ATAAATATGTTCAACTATTATGG - Intronic
966059531 3:175737918-175737940 AGAGATATATTCAAACATGAAGG - Intronic
967454341 3:189665521-189665543 ATTGATATTTGCAACTATGAGGG + Intronic
970679024 4:18485953-18485975 AGCCAAATGTCCAACAATGATGG + Intergenic
976012926 4:80513917-80513939 ACCCATATGTTTAAATATGAAGG + Intronic
976957386 4:90917262-90917284 AGCCAAATGTCCAACAATGATGG + Intronic
979296760 4:119041763-119041785 AGCTATATGTTACACTACGAAGG - Intronic
982492619 4:156047810-156047832 GGCGATATCTGCAAATATGAGGG + Intergenic
989483418 5:41960074-41960096 AGGGATATATTCACCTAAGAAGG - Intergenic
989719596 5:44508945-44508967 AGCCAAGTCTTCAACTATGACGG - Intergenic
990118012 5:52413281-52413303 AACAATATGTTAAACTATAAAGG - Intergenic
993666831 5:90709012-90709034 AGCTATGTGTTAAAATATGATGG + Intronic
993809341 5:92456503-92456525 AGCTATATGTTCAACTAAGAGGG - Intergenic
993842085 5:92892276-92892298 AGCCAAATGTCCAACAATGATGG - Intergenic
996248244 5:121292939-121292961 GGCGACATGTTCAAACATGATGG - Intergenic
1007515626 6:42408722-42408744 TGAGATGTGTTCAACTATAAAGG - Intronic
1012607033 6:101170259-101170281 ACTGATCTGTTCAAATATGAAGG - Intergenic
1021901327 7:25288607-25288629 AGCCATATGTTCTACTCTGTTGG - Intergenic
1023407115 7:39845656-39845678 TGCAATATGTACAATTATGAAGG - Intergenic
1030336140 7:108328776-108328798 TGCCATATTTTCACCTATGAGGG + Intronic
1030541971 7:110842441-110842463 AGTGATATATTCAACTCGGAAGG + Intronic
1046163788 8:110401808-110401830 AGAGATGAGTTCAACTCTGATGG - Intergenic
1056185284 9:84128646-84128668 AGAGAAATGTTCTACTCTGAGGG - Intergenic
1188739908 X:33765449-33765471 AGCTAAATGTTCAAGAATGATGG + Intergenic
1188998497 X:36916003-36916025 AGCCAAATGTCCAACAATGATGG + Intergenic
1189457790 X:41209053-41209075 AGATATATGTTGAAGTATGAAGG - Intronic
1193513065 X:82430137-82430159 AGCAATATGTTTCGCTATGAAGG + Intergenic
1195408797 X:104546707-104546729 AGTGATAAGTCCAACTGTGAAGG - Intergenic
1196185550 X:112741198-112741220 AGCGATATGTTGAAACATCAAGG - Intergenic
1199224606 X:145357801-145357823 AGCCAAATGTCCAACAATGATGG - Intergenic
1201081314 Y:10251796-10251818 AACAATATGTTCAACTTTGTGGG + Intergenic
1201081795 Y:10260483-10260505 AACAATATGTTCAACTTTGTGGG + Intergenic
1201082107 Y:10266034-10266056 AACAATATGTTCAACTTTGTGGG + Intergenic
1201082362 Y:10320734-10320756 AACAATATGTTCAACTTTGTGGG - Intergenic
1201082703 Y:10326863-10326885 AACAATATGTTCAACTTTGTGGG - Intergenic
1201083024 Y:10332647-10332669 AACAATATGTTCAACTTTGTGGG - Intergenic
1201083347 Y:10338436-10338458 AACAATATGTTCAACTTTGTGGG - Intergenic
1201083670 Y:10344223-10344245 AACAATATGTTCAACTTTGTGGG - Intergenic
1201083991 Y:10350010-10350032 AACAATATGTTCAACTTTGTGGG - Intergenic
1201084314 Y:10355802-10355824 AACAATATGTTCAACTTTGTGGG - Intergenic
1201084637 Y:10361584-10361606 AACAATATGTTCAACTTTGTGGG - Intergenic
1201084937 Y:10367039-10367061 AACAATATGTTCAACTTTGTGGG - Intergenic
1201085265 Y:10372999-10373021 AACAATATGTTCAACTTTGTGGG - Intergenic
1201085587 Y:10378787-10378809 AACAATATGTTCAACTTTGTGGG - Intergenic
1201085909 Y:10384572-10384594 AACAATATGTTCAACTTTGTGGG - Intergenic
1201086229 Y:10390358-10390380 AACAATATGTTCAACTTTGTGGG - Intergenic
1201086552 Y:10396150-10396172 AACAATATGTTCAACTTTGTGGG - Intergenic
1201086879 Y:10401944-10401966 AACAATATGTTCAACTTTGTGGG - Intergenic
1201087203 Y:10407729-10407751 AACAATATGTTCAACTTTGTGGG - Intergenic
1201087522 Y:10413515-10413537 AACAATATGTTCAACTTTGTGGG - Intergenic
1201087843 Y:10419299-10419321 AACAATATGTTCAACTTTGTGGG - Intergenic
1201088167 Y:10425086-10425108 AACAATATGTTCAACTTTGTGGG - Intergenic
1201088498 Y:10431048-10431070 AACAATATGTTCAACTTTGTGGG - Intergenic
1201088799 Y:10436504-10436526 AACAATATGTTCAACTTTGTGGG - Intergenic
1201089120 Y:10442287-10442309 AACAATATGTTCAACTTTGTGGG - Intergenic
1201089443 Y:10448072-10448094 AACAATATGTTCAACTTTGTGGG - Intergenic
1201089767 Y:10453858-10453880 AACAATATGTTCAACTTTGTGGG - Intergenic
1201090068 Y:10459309-10459331 AACAATATGTTCAACTTTGTGGG - Intergenic
1201090390 Y:10465097-10465119 AACAATATGTTCAACTTTGTGGG - Intergenic
1201090715 Y:10470883-10470905 AACAATATGTTCAACTTTGTGGG - Intergenic
1201091040 Y:10476670-10476692 AACAATATGTTCAACTTTGTGGG - Intergenic
1201091361 Y:10482456-10482478 AACAATATGTTCAACTTTGTGGG - Intergenic
1201091688 Y:10488250-10488272 AACAATATGTTCAACTTTGTGGG - Intergenic
1201092009 Y:10494034-10494056 AACAATATGTTCAACTTTGTGGG - Intergenic
1201092348 Y:10500160-10500182 AACAATATGTTCAACTTTGTGGG - Intergenic
1201092671 Y:10505945-10505967 AACAATATGTTCAACTTTGTGGG - Intergenic
1201092996 Y:10511733-10511755 AACAATATGTTCAACTTTGTGGG - Intergenic
1201093254 Y:10516338-10516360 AACAATATGTTCAACTTTGTGGG - Intergenic
1201093577 Y:10522121-10522143 AACAATATGTTCAACTTTGTGGG - Intergenic
1201094097 Y:10531482-10531504 AACAATATGTTCAACTTTGTGGG - Intergenic
1201094435 Y:10537606-10537628 AACAATATGTTCAACTTTGTGGG - Intergenic
1201094761 Y:10543394-10543416 AACAATATGTTCAACTTTGTGGG - Intergenic
1201094957 Y:10596703-10596725 AACAATATGTTCAACTTTGTGGG + Intergenic
1201095285 Y:10602657-10602679 AACAATATGTTCAACTTTGTGGG + Intergenic
1201095613 Y:10608614-10608636 AACAATATGTTCAACTTTGTGGG + Intergenic
1201095942 Y:10614572-10614594 AACAATATGTTCAACTTTGTGGG + Intergenic