ID: 1165756488

View in Genome Browser
Species Human (GRCh38)
Location 19:38296208-38296230
Sequence TGCTGGGTCTGGAGGCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 480}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165756488 Original CRISPR TGCTGGGTCTGGAGGCCAGA GGG (reversed) Intronic
900104430 1:976318-976340 GGCTGGGTCTTGCGGGCAGACGG - Intronic
900136341 1:1118735-1118757 TGCTAGGTCTGAAAGCCACAGGG + Intergenic
900417927 1:2543552-2543574 TGATGGGGCTGGAGCCCAGTGGG - Intergenic
900508953 1:3049132-3049154 TGCTGAGGCAGGAGGCCTGAGGG - Intergenic
900522575 1:3112846-3112868 TGATGGGGCTGGAGCCCAGGCGG - Intronic
900557617 1:3288224-3288246 TGCTGGGCCTGGGGGCATGAGGG - Intronic
900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG + Intronic
900778471 1:4601642-4601664 TGCTGGGGCTTGAATCCAGAGGG - Intergenic
900937101 1:5773411-5773433 TGCTGGGTCTGGCTCCTAGAGGG - Intergenic
901748952 1:11394092-11394114 GGCTGGGTCTGCTGGGCAGAGGG - Intergenic
901800103 1:11703642-11703664 TGCTGGGTCTGGGGACAGGATGG + Intronic
901840832 1:11952906-11952928 TCATGGTTCTGGAGGCCGGAAGG + Intronic
904385742 1:30140852-30140874 AGCTGGAGCTGGAAGCCAGACGG + Intergenic
904610628 1:31724356-31724378 GGCTGGGTCTGGAAGGCTGAAGG + Intergenic
904638745 1:31905301-31905323 AGCTGGGACTGTAGTCCAGATGG + Intergenic
905276967 1:36824686-36824708 GGCTGGGGCTGGAGCCCAGAGGG + Intronic
905283546 1:36864599-36864621 TGCTGCCTCTGGAGACCAGAAGG - Intronic
905695505 1:39970565-39970587 TGGTGGGGCTGGAGGCCTGTGGG + Intergenic
906157482 1:43622224-43622246 AGGTGGGTCTGGTGGACAGAAGG - Exonic
906246883 1:44282589-44282611 TGCTGAGTCTGGAGGCCCAGGGG - Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
910240380 1:85079838-85079860 TACTGGGACTGGCAGCCAGATGG + Intronic
910805105 1:91181933-91181955 TCATGGCTCTGGAGGCCAGGAGG + Intergenic
911043164 1:93607881-93607903 TGCTGTGTCTGGTGGGCGGATGG - Intronic
912932055 1:113973009-113973031 TGCTGGTTCTGGAAGAAAGAAGG - Exonic
914889953 1:151612992-151613014 TACTTGGTCTGGAGGGCAGAAGG - Intronic
915236926 1:154490635-154490657 AGATGGGTCTAAAGGCCAGAAGG + Intronic
915338197 1:155160305-155160327 TGCAGGGTCTGGGGGCAGGATGG + Intergenic
915437295 1:155917599-155917621 GGCTGGGGCTGGGGGCCAGCAGG + Exonic
918044937 1:180935911-180935933 TGCTGGGCCTGAAGGCCCCAAGG - Exonic
919800891 1:201354052-201354074 TCCTGGGTCTAGATGCCAGCAGG - Intergenic
920091016 1:203453300-203453322 TCCTGGGGCTGGTGGCCAGGAGG - Intergenic
920293844 1:204943814-204943836 TGCTGGGCCTGCAGGCCAATAGG + Intronic
920630718 1:207649000-207649022 TGCTGGGTGTTGTGGCCACATGG + Intronic
920641496 1:207755934-207755956 TGCTGGGTGTTGTGGCCACATGG + Intronic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
922575948 1:226660705-226660727 TGCTGGGCCCGGAGGCTAGGAGG + Intronic
923043136 1:230333916-230333938 TGCTGGGACAGAAGGCCACAGGG + Intronic
923105430 1:230850425-230850447 TGCTGAGTCTGGAGGGCAAGTGG + Intronic
923347317 1:233066863-233066885 TCCTGGGTAAGGAGGCCACATGG + Intronic
923920449 1:238558599-238558621 TCCTGGGTCTGCAGGTCAGTGGG + Intergenic
924617351 1:245623240-245623262 TCCTGGGTCTGGAGACAGGAAGG - Intronic
1062935229 10:1380521-1380543 GGCTGAGTCTGGACGCCTGAAGG - Intronic
1063165980 10:3462771-3462793 TACTGAGTCTAGAGGCCAGGAGG + Intergenic
1064012257 10:11743833-11743855 TTCTGGGCATGGCGGCCAGATGG + Intronic
1064479676 10:15726695-15726717 TGATGGGGCTGGAGGTAAGACGG + Intergenic
1065332732 10:24619649-24619671 TGCGGTGTCTGGCGTCCAGATGG + Exonic
1065513850 10:26505912-26505934 TGCAGGGACTGGAGGCCACTGGG - Intronic
1065935183 10:30514973-30514995 TGTTTGGTCTGGAGGCCAGGAGG - Intergenic
1066415044 10:35213957-35213979 GCTTGGGTCTGGAGGACAGAGGG + Intergenic
1066438510 10:35415512-35415534 AGCTGGGTCCTGAGGGCAGAAGG + Intronic
1067154100 10:43760491-43760513 GGCTGGGTCCTGAGGCCTGACGG + Intergenic
1067531956 10:47080597-47080619 TGCTGGGGCAGGTGACCAGATGG + Intergenic
1067539721 10:47142697-47142719 TCCTGGTTCTGCAGGCCATACGG - Intergenic
1067564563 10:47327247-47327269 TGCTCTGGCTGGAGGTCAGAGGG - Intergenic
1067705520 10:48604222-48604244 TGCAGGGTCTGGGGGCAGGACGG - Intronic
1067851225 10:49755951-49755973 TGATGGGTCCTCAGGCCAGAAGG + Intronic
1069818991 10:71216216-71216238 TGGTGGGTCTCCAGCCCAGATGG - Intronic
1069914244 10:71777635-71777657 TCCTTGGTCAGGTGGCCAGAGGG - Intronic
1070706829 10:78645868-78645890 TGCTGGGCCTGGATCTCAGAGGG + Intergenic
1070809486 10:79290484-79290506 TGCTAGCTCTGGAGGGCAGCAGG - Intronic
1072391579 10:94992935-94992957 ATCAGGGGCTGGAGGCCAGAAGG + Intergenic
1074769628 10:116724898-116724920 TTCAGGGTCTGGGGGCCAGGTGG - Intronic
1075309854 10:121405061-121405083 TGCTGGTTGTGGAGGCCTTAAGG + Intergenic
1075673620 10:124281184-124281206 TGCTGGGTCTGCATCCCAGGAGG - Intergenic
1075771812 10:124944856-124944878 TACTAAGTCTGGAGGTCAGAAGG - Intronic
1075786514 10:125053639-125053661 TGCTGTCTCTGAAGCCCAGAGGG - Intronic
1076065104 10:127442326-127442348 GGCTGGGTCTGGGGGCCTGGTGG - Intronic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1077076857 11:706006-706028 GGCTGGGGCTGGAGCCCAGGCGG + Intronic
1077508434 11:2942885-2942907 TTCTGGTCCTGGAGGCCAGGGGG - Intergenic
1078091512 11:8267447-8267469 TGCTGGGGCAGGAGGCTGGAAGG - Intronic
1078233191 11:9460993-9461015 TGCGGGGCCTGGGGGCCGGACGG + Exonic
1078431262 11:11290456-11290478 GGCTAGGCCTGGAGGCCACAGGG - Intronic
1078468363 11:11567595-11567617 GGCTGGGTTTGGGGCCCAGAGGG - Intronic
1080109845 11:28554323-28554345 TGCTGGTTCTGGAGGCTCTAGGG + Intergenic
1080283842 11:30586205-30586227 GGCTGGGGCTGGGGGCCAGGGGG + Intronic
1080897636 11:36459535-36459557 AGCTGGGACTGGAGCACAGATGG - Intronic
1081617029 11:44597208-44597230 TGGGGAGTCTGGAGTCCAGAGGG - Intronic
1081700571 11:45150065-45150087 TGCAGAGTCTGGAGGGCAGCTGG - Intronic
1081882121 11:46462574-46462596 TGATGGGTCTGGAGAGCAGTGGG - Intronic
1083198938 11:61107929-61107951 TGCTTGCTCTGGAGTACAGATGG - Intronic
1083294458 11:61707635-61707657 GGCTGGGGCTGAAGGCCAGCTGG + Intronic
1083443299 11:62690850-62690872 TGCAGGGCCTGAAGGCCAGGAGG - Exonic
1083459218 11:62799681-62799703 TGCTGGGCGTGGAGGCCACGGGG - Intronic
1083769296 11:64857476-64857498 TGCCGGCTCTGGAGGACAGAGGG - Intronic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1084075339 11:66770797-66770819 CGATGGGTAAGGAGGCCAGAAGG - Intronic
1084561476 11:69907913-69907935 TGCTGGGGCTGCAACCCAGAGGG + Intergenic
1085329595 11:75636847-75636869 AGTTGGGTCAGGAGGCAAGAAGG - Intronic
1085462176 11:76700792-76700814 GGGTGGCTCTGGAGGCAAGAGGG + Intergenic
1085769107 11:79309369-79309391 TCCTGGCCCTGGAGGTCAGATGG + Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088952993 11:114589357-114589379 GGCTGGCTCTGGTGTCCAGAAGG - Intronic
1088964056 11:114700122-114700144 TGCTGTGTCTGGAATACAGAAGG - Intronic
1089055894 11:115584516-115584538 GGTTGGGGCTGGAGGCCAGGGGG + Intergenic
1089338751 11:117743586-117743608 AACTGGGCCTGGAGCCCAGAGGG - Intronic
1090207671 11:124894917-124894939 GGCAGGGTCTGGAAGCCAGTGGG + Intronic
1090262501 11:125331551-125331573 TCCTGGTTCAGGAAGCCAGATGG + Intronic
1090441270 11:126727490-126727512 TGGTAAGTCTGGAGGCCTGAAGG + Intronic
1090804921 11:130196911-130196933 TGCTGGGACTGCAACCCAGAAGG - Intronic
1090873234 11:130766443-130766465 TGCTGGGCCAGGAGGACACAGGG + Intergenic
1090962898 11:131572962-131572984 TGCTGGCTCTGGAGGCTGCAGGG - Intronic
1091237607 11:134032622-134032644 TGCTGGGCCTGGAGTCAACAAGG - Intergenic
1091254455 11:134171811-134171833 TGCTGTGTTTGGAGGACAGCCGG - Intronic
1091671581 12:2456010-2456032 TACTGTGTCTGGAGGTCAGTGGG - Intronic
1092275902 12:7060789-7060811 TGCTGTCCCTGGGGGCCAGAGGG + Intronic
1092698346 12:11199453-11199475 TGCTTGGTGAGGAGGTCAGATGG - Intergenic
1093210381 12:16300956-16300978 TGCTGGGATTTGAAGCCAGATGG + Intergenic
1093518659 12:20021607-20021629 TCCTGGTTCTGGAGGCTAGAAGG - Intergenic
1095852845 12:46830046-46830068 TGCTGGGACAGGAGGCAAGCTGG - Intronic
1096117747 12:49065326-49065348 TGCTGGGCCTGAAGACTAGAAGG - Intronic
1096716379 12:53493837-53493859 TGCTGGCCCTGGATACCAGAAGG - Exonic
1096867838 12:54575769-54575791 TCCTGGGTTAGGAGGCCAGGGGG + Intronic
1097284760 12:57868859-57868881 TGCTGGGTCGCGTGGCCAGCCGG - Intergenic
1101527485 12:105544774-105544796 TGCTGGGCCTGCTGGCCTGAGGG + Intergenic
1102467251 12:113137134-113137156 TGCTGGGTGGGGAGTCAAGAAGG - Intergenic
1102819691 12:115897299-115897321 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819700 12:115897335-115897357 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819709 12:115897371-115897393 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1103578176 12:121894368-121894390 TGCTGGCCCTGGAAGCTAGAGGG - Intronic
1105640792 13:22261869-22261891 TACTGTGTCTGGGTGCCAGAAGG - Intergenic
1106186666 13:27415775-27415797 TGCAGGGGCTGGAGGCCACCAGG + Intergenic
1106195442 13:27490398-27490420 TTCTGGATCTGGAGCCCAGGAGG - Intergenic
1107221143 13:37982166-37982188 TGCAGGCTATGGAGGCCACAGGG + Intergenic
1107298919 13:38945613-38945635 TTTTGGCTCTGGAGGACAGATGG - Intergenic
1107298935 13:38945706-38945728 TTTTGGCTCTGGAGGACAGATGG - Intergenic
1110400386 13:75083155-75083177 TTCTGGTCCTGGAGGCCAGATGG + Intergenic
1111527580 13:89492279-89492301 TCTGGGGTCTGGAGGACAGATGG + Intergenic
1112737252 13:102434732-102434754 AGCAGGGCCTGGAGGCCAGGAGG - Intergenic
1113056681 13:106275601-106275623 TTCTGGGTTAGGAGGCAAGAAGG - Intergenic
1113571689 13:111362444-111362466 GGCTGGGGCTGAAGGGCAGAGGG + Intergenic
1113638861 13:111943192-111943214 TGCTCGGTCTGCAGGGGAGAAGG + Intergenic
1114534477 14:23414095-23414117 TCCTCCGTCTGGGGGCCAGAGGG + Exonic
1114674299 14:24430410-24430432 AGCTCGGCCTGGAGGCCAGAAGG - Intronic
1115141643 14:30178185-30178207 TGCTGGGGCCAGAGGCAAGAGGG - Intronic
1116935857 14:50739438-50739460 TGCTGGTTATGGAGCCCTGATGG + Exonic
1119124728 14:72115310-72115332 TGCTGGGACCTGAGGCCAGCAGG + Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121183232 14:91945322-91945344 TTGTGGGTGTGGATGCCAGATGG + Intronic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122691607 14:103534389-103534411 AGCTGGGACTGCAGGGCAGAGGG - Intronic
1123581953 15:21723373-21723395 TGATGGGACTGGAGTACAGAAGG + Intergenic
1123618602 15:22165973-22165995 TGATGGGACTGGAGTACAGAAGG + Intergenic
1126186218 15:45832709-45832731 TGCTGGGTCTAAAGGGCTGATGG + Intergenic
1127110907 15:55669396-55669418 TGATGTGTCTGGAGGGCAGTAGG - Intronic
1127366930 15:58299847-58299869 TGCAGGGGATGGAGGCCACAAGG + Intronic
1128220054 15:65962733-65962755 TGCTGAGGCTAGAGGCCACAGGG + Intronic
1128611240 15:69075057-69075079 TGCTGGCTCTGGAGGGCAATGGG - Intergenic
1128739638 15:70074600-70074622 TGCTGGTGCTGGAGGGAAGAGGG + Exonic
1129194355 15:73955323-73955345 TGCTGGGTCAGGAGTGAAGATGG - Intergenic
1129364948 15:75048478-75048500 TGCAGGGTCTGGAGGGCGGTGGG + Intronic
1129703771 15:77782999-77783021 GGCTGTGTCTGGAGACCAGGAGG - Intronic
1130760844 15:86818166-86818188 TTATAGCTCTGGAGGCCAGAAGG - Intronic
1130853280 15:87819026-87819048 TGCCTGGTCTGTAGGACAGAGGG + Intergenic
1132638519 16:966070-966092 GGCTAAGTCTGAAGGCCAGAAGG + Intronic
1132796477 16:1726160-1726182 TGACGAGTCTGGGGGCCAGAGGG + Intronic
1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG + Exonic
1132855618 16:2043377-2043399 TGCTGGGGCAGGAGGTCACATGG - Intronic
1133099688 16:3471632-3471654 GCCCGGGTCTGGAGGCCACAGGG - Intronic
1133230163 16:4362595-4362617 TGCTGGGTAAGGAGGCAGGACGG - Exonic
1133417623 16:5618837-5618859 TGCTGTGTCTGGATACCAGTGGG + Intergenic
1133873215 16:9708986-9709008 ACCTAGGTCAGGAGGCCAGAAGG + Intergenic
1134005828 16:10818447-10818469 TGCTGGGGCTGGAGGCGGGGCGG - Intronic
1134438931 16:14286042-14286064 GGCTGGGTCTGCAGTCCAGGGGG - Intergenic
1136280170 16:29203761-29203783 TGCTGGGACTGAGGGGCAGACGG - Intergenic
1136317039 16:29460528-29460550 TGTTTGTTCTGGAGCCCAGATGG + Intronic
1136319058 16:29470773-29470795 TGCTTGTCCTGGAGCCCAGATGG + Intergenic
1136431614 16:30199870-30199892 TGTTTGTTCTGGAGCCCAGATGG + Exonic
1136433629 16:30210117-30210139 TGCTTGTCCTGGAGCCCAGATGG + Intergenic
1136922994 16:34346704-34346726 TTCTGGGCCTAGAGGCCAGCTGG + Intergenic
1136981579 16:35065102-35065124 TTCTGGGCCTAGAGGCCAGCTGG - Intergenic
1137853309 16:51767918-51767940 AGCTGGGAATGAAGGCCAGAAGG - Intergenic
1138584848 16:57962947-57962969 TGCTGGGGCTGGAGGCTGAAGGG - Intronic
1139254202 16:65525385-65525407 TGCTAGGGCTGGAGCCCAAAAGG + Intergenic
1139384044 16:66552697-66552719 TGCTGGGTCTGCAGACGCGATGG + Exonic
1140127133 16:72127050-72127072 TTCTGAGTCTGGAAGCCAGAGGG + Intronic
1141117513 16:81323050-81323072 TGATGGAGCTGGAGGCCAGCAGG + Intronic
1141429178 16:83962140-83962162 TGATGGGGCAGGAAGCCAGATGG - Intronic
1141939468 16:87265260-87265282 TGCTGGGTTTAGAGGCCAATAGG - Intronic
1141964777 16:87434462-87434484 CGCTGGGTCTGGAGGCCACCTGG + Intronic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1142749419 17:1978285-1978307 TGCTGGGTTTGGATCCCAGTGGG - Intronic
1143733644 17:8895471-8895493 AGCAGGGTCAGGAGGGCAGAGGG - Intronic
1143915864 17:10292352-10292374 TGCTGGGTCTGAGTGCCAGCTGG + Intergenic
1144160563 17:12553620-12553642 TTCACAGTCTGGAGGCCAGAAGG + Intergenic
1144291986 17:13835361-13835383 TGCTGAGTCTTGTGCCCAGAAGG + Intergenic
1144471227 17:15543196-15543218 TGCTGGGTTTGGTAGCCTGAAGG - Intronic
1145258723 17:21342260-21342282 GGCAGGGCCTGGAGCCCAGAGGG - Intergenic
1145264098 17:21371268-21371290 TGCTGGGTCTGCAGGAAAGCAGG - Intergenic
1145317906 17:21745744-21745766 GGCAGGGCCTGGAGCCCAGAGGG + Intergenic
1146000901 17:29129732-29129754 TGCTGCCTCTGGATGCCACAAGG + Intronic
1146079878 17:29769950-29769972 TGGTGGATCTGTAGGCTAGAAGG - Intronic
1146185922 17:30724178-30724200 TCCTAGTTCTGGAGGCCAGAAGG - Intergenic
1146261537 17:31425425-31425447 TTCAAGGTCTGAAGGCCAGATGG - Intronic
1146676907 17:34780034-34780056 TGCTGGGATAAGAGGCCAGATGG - Intergenic
1146884781 17:36463787-36463809 TGCTGGGCTTGGATGCCAGTGGG + Intergenic
1146892158 17:36513253-36513275 TGCTGAGTCTGGAGACCAGGTGG - Intronic
1147388496 17:40095570-40095592 TGCAGGGCCAGGAGGCCAGGTGG + Exonic
1147416802 17:40297473-40297495 TGTTGGGGGTGGAGGCCAAAGGG + Intronic
1147459294 17:40558083-40558105 CCCCAGGTCTGGAGGCCAGAGGG - Intronic
1147596074 17:41718389-41718411 GGCTGGGTCTGGTAGCCAGTGGG + Intronic
1147728273 17:42580450-42580472 TGCTGAGGCTGATGGCCAGATGG + Exonic
1147755232 17:42762967-42762989 TGCTGGGAATGGAAGCCAGGTGG + Exonic
1148178136 17:45585045-45585067 GGCCGGGTGGGGAGGCCAGAGGG + Intergenic
1148342447 17:46881323-46881345 TCCTGGGCCTGGAGACCAGCTGG + Intronic
1148581902 17:48750015-48750037 GGCTGGGTCTGGAGGGCTGGCGG + Intergenic
1149606044 17:57925947-57925969 GGCTGGGGCTGCAGGCCTGATGG + Intronic
1149663012 17:58345664-58345686 TGCCAGGTCTCGAGGGCAGAAGG + Exonic
1149996277 17:61407618-61407640 TGCAGGCTCTGAAGGGCAGAGGG - Intronic
1150408033 17:64919335-64919357 GGCCGGGTGGGGAGGCCAGAGGG + Intronic
1150613652 17:66752697-66752719 TGCTGGGGCTGGAGGGCCCAAGG + Intronic
1150635023 17:66906862-66906884 TGCTGGATCTGGACACCAGAGGG - Intergenic
1151802828 17:76387747-76387769 TCCTGGGTCAGGAGCCCAGCTGG + Exonic
1152531862 17:80923496-80923518 TGCTGGTGCTGGACGCCGGAGGG - Exonic
1152709243 17:81862066-81862088 TGTAGGGGCTGGAGGACAGAAGG + Intergenic
1152713241 17:81885464-81885486 GGCTGGGTCTGGAAGCCACCGGG - Intergenic
1152768900 17:82155712-82155734 TGCTGGGAAAGGAGCCCAGACGG - Intronic
1153642618 18:7169734-7169756 TGCTGGGGCTGCAGGCCACGTGG + Intergenic
1153933591 18:9900901-9900923 TGCTGGGTGTGGAGATGAGATGG + Intergenic
1155437868 18:25832037-25832059 TGCTGGGTTTATAGTCCAGAAGG - Intergenic
1157116100 18:44864092-44864114 TCCTGGGGCAGGAGGACAGAGGG + Intronic
1157204775 18:45688795-45688817 TGCTGGGTCTTCAGGATAGAAGG - Intergenic
1157574464 18:48734213-48734235 TGCTGGGGGTGGGGGACAGAAGG - Intronic
1157726261 18:49966366-49966388 TGCTTGGTCTGGAGTGCACAGGG - Intronic
1158423594 18:57319071-57319093 ATGTAGGTCTGGAGGCCAGAAGG - Intergenic
1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG + Intergenic
1160018745 18:75164332-75164354 TGCTGTTTCTGGAGCGCAGAGGG + Intergenic
1160275746 18:77433285-77433307 TTTTGGGTTTGCAGGCCAGATGG - Intergenic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1160684236 19:426215-426237 TGCTGGGTGACGAGGGCAGAGGG + Intronic
1160862772 19:1244722-1244744 GGCTGGCTCTGCAGGGCAGAGGG - Exonic
1162972854 19:14191551-14191573 TCCTAGTTCTGGAGGCCAGAAGG + Intronic
1163580526 19:18136038-18136060 AGCTGGGTCTGGTGCCCATATGG + Intronic
1164229660 19:23276166-23276188 TGCTGGGTCTGAGGGCAGGAAGG - Intergenic
1164710232 19:30351878-30351900 TGCTGGGTCTGGATTGCAAAGGG + Intronic
1164983036 19:32628368-32628390 TGCTGGGTGTGGAGGCCTAAAGG - Intronic
1165308691 19:35017915-35017937 TGCAGGGCTTGGAGGCCAGTGGG - Intronic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1165896476 19:39144545-39144567 GGTTTGTTCTGGAGGCCAGAAGG + Intronic
1166111716 19:40626920-40626942 TGGTGGGTGTGGGGGCCAGCAGG + Intronic
1166130612 19:40743679-40743701 TGCCAGGCCTGGAGCCCAGACGG + Intronic
1166214471 19:41326174-41326196 CGCTGGGTATGGAGGCCAACAGG + Intronic
1166366864 19:42282209-42282231 TGCAGTCTCTGGAGGTCAGAGGG + Intronic
1166648762 19:44553903-44553925 TGCAGGGTCTGGGGGTCAGGGGG + Intergenic
1166993086 19:46704877-46704899 TTCAGGGTCTGGGGGACAGATGG - Intronic
1166993116 19:46704996-46705018 TTCAGGGTCTGGGGGACAGATGG - Intronic
1167198164 19:48044976-48044998 TGCTGGCTCTCCACGCCAGATGG - Intergenic
1167266380 19:48485016-48485038 TGCTGGCTCAAGAGGCCATAAGG - Intergenic
1167726867 19:51220761-51220783 GGCAAGGTCTGGAGGGCAGATGG - Intergenic
925357185 2:3250120-3250142 TCTTGGGCCTGGAGGGCAGAAGG - Intronic
925402503 2:3585677-3585699 TGCTGAGGCAGGAGGCCAGAGGG + Intergenic
925417278 2:3679350-3679372 TGGTGGGGCTGGAGGCTGGAGGG + Intronic
925722668 2:6843851-6843873 GGCTGGCTCTGGTGTCCAGAAGG + Intronic
925743776 2:7028136-7028158 TACTGGCTCTGGGGGCCAGTGGG + Intronic
926112400 2:10191720-10191742 TGCGGGGTCTGGAGGGAACACGG + Intronic
926633568 2:15158633-15158655 GGCTGGGTCTGCAGCCCTGAGGG - Intergenic
926736538 2:16077770-16077792 GGCTTGGCATGGAGGCCAGATGG - Intergenic
927721778 2:25387729-25387751 TGCTGGGGCTGGAGGTGAGAAGG - Intronic
928316620 2:30251448-30251470 TGTTGGGACTGGAGGCCACCAGG + Intronic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
929592829 2:43158182-43158204 TACTGGGGCTGGGGGCCAGGAGG - Intergenic
931818720 2:65930325-65930347 TCCTGGGGCTGGAGCCAAGATGG - Intergenic
932314850 2:70773197-70773219 TGCTGGGTCTAGCTGCCTGAGGG - Intergenic
932685243 2:73863632-73863654 GGGTGGGTCTGGGGGCCAGCTGG + Exonic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
932748938 2:74358590-74358612 TGCTGGGTCTGGAGCTCAGCAGG - Intronic
932885658 2:75547024-75547046 TCATGGTTCTGGAGGCCAGAAGG - Intronic
933188372 2:79304052-79304074 TGCAGGGTGTGGGGGCCAGTGGG + Intronic
933547202 2:83729690-83729712 GGCTAGGTGTGGAGGCCAGAAGG + Intergenic
933938454 2:87225865-87225887 GGCTGGGTCTGGTGGGCACATGG - Intergenic
933978368 2:87529844-87529866 TCCTGCTTCTGGAGGCCAGGTGG - Intergenic
934476874 2:94599532-94599554 TAATGGGTCTGGTGGCAAGAGGG - Intronic
935958817 2:108403779-108403801 ATCAGGGGCTGGAGGCCAGATGG - Intergenic
936146346 2:109982716-109982738 TGCTGTCTCTGGACCCCAGAGGG + Intergenic
936198345 2:110388763-110388785 TGCTGTCTCTGGACCCCAGAGGG - Intergenic
936315464 2:111420957-111420979 TCCTGCTTCTGGAGGCCAGGTGG + Intergenic
936354684 2:111739909-111739931 GGCTGGGTCTGGTGGGCACATGG + Intergenic
936525975 2:113241980-113242002 TGCTGGGACAGGAGGGCAGCGGG - Intronic
936716232 2:115190600-115190622 ATCAGGGGCTGGAGGCCAGATGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
936863938 2:117055951-117055973 TGGTGGCTGGGGAGGCCAGAAGG + Intergenic
937208861 2:120254202-120254224 TGCTGACTCTGGAGCTCAGAGGG - Intronic
938036856 2:128041837-128041859 ATCAGGGACTGGAGGCCAGATGG - Intergenic
942190613 2:173465318-173465340 TGCCATGGCTGGAGGCCAGATGG + Intergenic
942601053 2:177641512-177641534 AGCTGGCTGTGGAGTCCAGATGG + Intronic
943533392 2:189116052-189116074 TGCTGGGTCAGGAAGGCTGAAGG - Intronic
944258750 2:197653318-197653340 TGAGGGGTCTGGAGACCTGACGG + Intronic
944855349 2:203761967-203761989 TCCTGGGTCTGTAGGTCAGCTGG - Intergenic
945198349 2:207257904-207257926 GGCAGGGTCTGGTGACCAGATGG - Intergenic
945483318 2:210366915-210366937 ATCAGGGGCTGGAGGCCAGATGG + Intergenic
946306064 2:218857694-218857716 GGCTGGGTCTGGAGGCAGCAGGG + Intergenic
947590688 2:231383397-231383419 TGCAGGGGCTGTAGGCCAGGGGG - Intergenic
947633561 2:231668606-231668628 TGCTGGGCCTGGCTGCCAGCTGG + Intergenic
947670961 2:231935031-231935053 GGCAGGGCCTGGAGGCCAGGCGG + Intergenic
948588107 2:239033964-239033986 GGCTGGGGCTGGAGGCCACCTGG + Intergenic
948783750 2:240340383-240340405 TGCTGGCTCTGGAGGCCCAGAGG + Intergenic
949019743 2:241734525-241734547 GGCTGGGCCTGGAGGGCAGGCGG + Intergenic
1168961961 20:1876186-1876208 TGCTGGGTCTGCATGCCTGGGGG - Intergenic
1170210127 20:13839595-13839617 TCATAGTTCTGGAGGCCAGAAGG + Intergenic
1171395172 20:24828527-24828549 ACCTGGCTGTGGAGGCCAGAGGG - Intergenic
1172620583 20:36316012-36316034 GGCTGGTCCTGGAGGCCAGCGGG + Intronic
1173089368 20:39955632-39955654 GGCTGGGTCTGGAGGTGTGAAGG - Intergenic
1173384080 20:42572381-42572403 TGGTGGGTGGTGAGGCCAGAGGG - Intronic
1174285679 20:49471313-49471335 TGCTGTGTGTGGAGACCAGACGG + Intronic
1174595119 20:51677734-51677756 TACTGTGTCTGGAGGATAGAAGG - Intronic
1175707449 20:61191132-61191154 TTCTGGGGCTGGAGGCCCTACGG + Intergenic
1175724585 20:61309186-61309208 AGCTGGGTCCTGAGGCCAGCTGG + Intronic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1176375897 21:6086740-6086762 TGCTGGGTCAGGAGACCGGTCGG + Intergenic
1176385029 21:6134908-6134930 TGCCCGGTGTGGGGGCCAGAGGG - Intergenic
1177016513 21:15795762-15795784 TGCTGGGTCTGGAAAGCACATGG + Intronic
1178169154 21:30019397-30019419 TGCTGGGGCTGGAGGCAGGATGG + Intergenic
1178378985 21:32092666-32092688 TCCTGGTTCTGGAGGCCAGAAGG + Intergenic
1178459527 21:32790085-32790107 TGCTGGGAATGCAGGCCAGCAGG + Intergenic
1179010399 21:37551965-37551987 TGCTGGGGCTGGCAGCCTGAAGG - Intergenic
1179277382 21:39904748-39904770 TGCTGTTCCTGTAGGCCAGAGGG + Intronic
1179477150 21:41654363-41654385 TGGTGGGTATTGAAGCCAGATGG + Intergenic
1179615430 21:42580225-42580247 TGCTGGGCCGGGAGGGCAGCTGG + Intronic
1179715106 21:43282355-43282377 TGCTGGGTCCACAGGCCTGAAGG - Intergenic
1179738444 21:43403344-43403366 TGCCCGGTGTGGGGGCCAGAGGG + Intergenic
1179747578 21:43451504-43451526 TGCTGGGTCAGGAGACCGGTCGG - Intergenic
1180074273 21:45454865-45454887 TGCTGGGTCTCCTGGGCAGAAGG + Intronic
1180871424 22:19149273-19149295 CGGTGGGTCTGGACGCGAGATGG + Intronic
1180953795 22:19732353-19732375 TGCTGGGTGTGGGGGCCACTGGG - Intergenic
1181115729 22:20631689-20631711 TGCTGGGTCATGAGGACACAGGG + Intergenic
1181409770 22:22710739-22710761 TGCCGGGTCTTGAGGCAGGAAGG + Intergenic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1182920265 22:34072806-34072828 TGCTGGATGTGGAGGAGAGATGG + Intergenic
1183005387 22:34897101-34897123 TGTTGGGTCTGGGTGGCAGAAGG - Intergenic
1183317270 22:37143569-37143591 TCCTGTGTCTGGAGCCAAGATGG - Exonic
1183368717 22:37420314-37420336 ACCTGGGTCTGGAGGCCGGCTGG - Intronic
1183540481 22:38426780-38426802 GGCCGGGCCTGGAGGTCAGATGG + Exonic
1183700525 22:39448512-39448534 TGCTGGGTGTGGAGGAGAGGAGG + Intergenic
1183909013 22:41064603-41064625 GGCTGGGGCTGGAGACCACAAGG + Intergenic
1184642147 22:45878424-45878446 TGCAGGGTGTGAAGGACAGAAGG - Intergenic
1184694760 22:46133159-46133181 TGCTGGGGCTGGGGGTCCGAAGG + Intergenic
1185307132 22:50125516-50125538 TGCTGGTTCTGGAGGTCCCAGGG + Exonic
949562803 3:5218302-5218324 TTGTGGGGCTGGATGCCAGAAGG + Exonic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
953449900 3:42997269-42997291 TGCTGGGTCTGAGGGTGAGAAGG + Intronic
953529469 3:43727116-43727138 TTCTGGTTCTTGAAGCCAGAAGG + Intronic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
954146838 3:48638753-48638775 TGCTGGGGGTGGGGACCAGAGGG - Intronic
955065082 3:55526933-55526955 TGATGGGTCTGCAGGCCAGCAGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
958696852 3:97538783-97538805 TCATGGGAATGGAGGCCAGATGG + Intronic
959584553 3:108014016-108014038 TGGTAGGTCTGGAGACCTGAGGG + Intergenic
960943456 3:122949789-122949811 TCCTGGGTCGGGGGGCCACAAGG - Intronic
961039014 3:123663907-123663929 TGCTGAGCCTGGAGGTCAGCAGG + Intronic
961195854 3:125000819-125000841 TCCAGCGTCTGGATGCCAGATGG + Intronic
961378112 3:126480448-126480470 GGCTTGGTATGGAGCCCAGAGGG + Intergenic
961542263 3:127608160-127608182 TGCTGAGTCTGGCCGTCAGAAGG + Intronic
961971333 3:130971739-130971761 TGCTGCTTCTTTAGGCCAGACGG + Intronic
962267671 3:133955244-133955266 GGCCGGGTTTGGAGGCCAGCCGG - Intronic
963001799 3:140688331-140688353 AGGTGGGTCTGGAGGCCTGTGGG + Exonic
966363387 3:179154215-179154237 TACTGGGTCTGCTGGCCAGGAGG - Intronic
967219375 3:187236092-187236114 TGCTGGGCCTGGTGGCCGGCTGG - Exonic
967379403 3:188840876-188840898 AGCTTGCTCTGGAGGCCAAAGGG - Intronic
968084097 3:195866978-195867000 GGCTGGGTCTGCGGCCCAGAGGG - Exonic
968603981 4:1522872-1522894 TGCTAGGGATGGAGGGCAGATGG - Intergenic
968686270 4:1961186-1961208 TGCTGGACCTGGAGCCCTGATGG + Intronic
968789308 4:2648561-2648583 AGCAGGGTCTGGATGCCAGGTGG + Intronic
968937500 4:3619803-3619825 TGCAGGATCTTGGGGCCAGAAGG + Intergenic
968955171 4:3715396-3715418 TCCTGGGTCTGGGGGCCGGTGGG + Intergenic
969394399 4:6910702-6910724 GGCTGGCTCTGGAGTCCACAGGG - Intronic
969657577 4:8507078-8507100 GCCTGGGCCTGGAGGCCAGCAGG + Intergenic
969680817 4:8642430-8642452 TGCAGGGCCTGGGGGCCAAAGGG - Intergenic
970469462 4:16362237-16362259 TTATGGGTCTGGTGGCCAGTAGG + Intergenic
971146470 4:23981941-23981963 GGTTGGGTCCTGAGGCCAGAAGG + Intergenic
973285415 4:48410656-48410678 TGCTGGTGCTGCAGGCCAGATGG - Intronic
973713263 4:53650270-53650292 TGCGGGGTGTGGAGGACATACGG + Intronic
974027300 4:56744898-56744920 TGATGGGACAGGAGGCCAGATGG + Intergenic
975379016 4:73677170-73677192 TGCTGGGTCTGGAGCCAGAAAGG + Intergenic
976226766 4:82800337-82800359 TGCTGGGTATGGGGAGCAGAGGG - Intergenic
979087483 4:116430918-116430940 TGATGGGGATGGAGGCCAGGTGG - Intergenic
979439598 4:120735573-120735595 TGCCAGGTCTGGAGGCTGGATGG + Intronic
982080158 4:151781754-151781776 TGCTGAGGCTGGAGGGCACAGGG + Intergenic
982348319 4:154385932-154385954 TGCAGAGTCTGGAGCCCAGATGG - Intronic
982584721 4:157222249-157222271 TGCTGGGGCAGGAGGCCACTGGG - Intronic
982584850 4:157222829-157222851 GGATTGGTGTGGAGGCCAGAGGG + Intronic
984815359 4:183831110-183831132 TGGTGGGTGTGGAGGCGTGAGGG + Intergenic
985043381 4:185915696-185915718 TGCTGGGGGTGGGGGGCAGAAGG - Intronic
985309855 4:188585840-188585862 GGCTGGCTCTGGAGGCCTGGAGG - Intergenic
988878388 5:35473338-35473360 GGCTGGGCCTTGAGGCAAGAGGG - Intergenic
988922254 5:35954235-35954257 TGCTGGGTGTGGTGGCCAGGTGG - Exonic
991636324 5:68709626-68709648 TGCTAGGTTTGGAGGACAGCTGG - Intergenic
991911454 5:71566577-71566599 TTTTGGGTTTGCAGGCCAGATGG + Exonic
992225542 5:74616742-74616764 GGCTGGCGCTGGTGGCCAGAGGG - Intergenic
992782557 5:80141479-80141501 GGCTGGGTCTGGCTGCCAGCTGG - Exonic
997630923 5:135368511-135368533 TGATCTGGCTGGAGGCCAGAAGG + Intronic
1001109543 5:168884225-168884247 TGCACGCTCTGGAGGCCTGATGG - Intronic
1001580474 5:172794727-172794749 TGCAGGGTCTGGAGAAGAGATGG - Intergenic
1002108287 5:176891151-176891173 TGCTGGAGCTGGGGGCCACAGGG - Exonic
1002192331 5:177484765-177484787 TGCAGAGGCTGGAGGCCAGCAGG + Intronic
1002680049 5:180954639-180954661 AGCTGAGTCTGGAGGCCAGAGGG + Intergenic
1002928875 6:1620204-1620226 TGGCGGGTCTGCAGGCCCGAAGG + Intergenic
1003146547 6:3514884-3514906 AGCTGGGGCTGCAGACCAGAGGG + Intergenic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1004311434 6:14549380-14549402 TGGTGGCTCTGGAGGACAGCAGG - Intergenic
1004478412 6:15996127-15996149 TCATGGGCCTGGAGACCAGAAGG + Intergenic
1004982229 6:21038269-21038291 TTCTGTGTGTGGAGGCCAGTAGG + Intronic
1005922667 6:30415839-30415861 TCCTGGGTCATGAGGCCAGGAGG - Intergenic
1006026924 6:31152884-31152906 GGCGGGGACAGGAGGCCAGAAGG - Intronic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006151802 6:31993859-31993881 TGCTGTGTCTCGGGGCCAGCCGG + Intronic
1006158103 6:32026597-32026619 TGCTGTGTCTCGGGGCCAGCCGG + Intronic
1006347219 6:33492406-33492428 TTGTGGGTCTGGTGGCCACAGGG - Intergenic
1006596018 6:35192863-35192885 GGATGGGACTGGAGGCCAGGAGG - Intergenic
1007600283 6:43076865-43076887 TGCTGGCTCTCGGGCCCAGATGG + Exonic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008646961 6:53524285-53524307 TGCTGGGCCTTGAGGCCAGACGG - Intronic
1010791270 6:80067913-80067935 TGCGGTGTCTGGTGTCCAGATGG + Intergenic
1013601714 6:111711591-111711613 TGGTGGCGCTGGAGGCCACAGGG - Intronic
1015547383 6:134375374-134375396 TGCTAGGTCTAAAGGGCAGAAGG + Intergenic
1017071587 6:150579790-150579812 TGTTGGCTTTGGACGCCAGACGG + Intergenic
1017637269 6:156455878-156455900 TCACAGGTCTGGAGGCCAGAGGG + Intergenic
1018910284 6:168097664-168097686 TGCTGTGTCTGCAGCCCAGCAGG - Intergenic
1019131479 6:169880290-169880312 TGCAGGCTCTGAAGGCCATACGG + Intergenic
1019472151 7:1226910-1226932 GGCTAGGGCTGGAGGCCGGAGGG - Intergenic
1019730792 7:2628314-2628336 TCACGGTTCTGGAGGCCAGAAGG + Intergenic
1023863290 7:44227632-44227654 AGGAGGGTCTGGAGGACAGAGGG + Intronic
1023922913 7:44643684-44643706 GTCTGAGTCTGGAGACCAGAAGG - Intronic
1024258447 7:47556949-47556971 GGCAGGGACTGGAGGACAGAGGG - Intronic
1024374258 7:48619690-48619712 TCCTGGGTTTGGAGGCCACTTGG - Intronic
1024433808 7:49324470-49324492 TCCTGGGAATGGAGGCCAGTAGG + Intergenic
1024539306 7:50463135-50463157 AGCTGGGTCTGGACTCCAGGAGG + Intronic
1025261984 7:57425850-57425872 GGCTCGGTGTGGGGGCCAGACGG - Intergenic
1025868850 7:65411614-65411636 TGCTTGATCTGGGGGGCAGAAGG + Intergenic
1026004552 7:66590877-66590899 TGTTGGGTGTGGAGCCTAGAAGG - Intergenic
1026203875 7:68238657-68238679 TGCTGGGATTGCAGGCCAGGCGG - Intergenic
1026486846 7:70829314-70829336 TGCACGGTCTGGACACCAGAGGG + Intergenic
1026841064 7:73670117-73670139 GGCTGGGGCTGGGGGCCAGGAGG + Intronic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1029877036 7:103765022-103765044 TGCTGGCGGTAGAGGCCAGATGG + Intronic
1031275199 7:119712520-119712542 TCTAGGGTCTGGAGGACAGATGG + Intergenic
1031317017 7:120271468-120271490 TGCTGGGCATGGAATCCAGAGGG - Intergenic
1031456135 7:121981661-121981683 TTCAGGGTTTGAAGGCCAGATGG + Intronic
1031470800 7:122166962-122166984 TGCTCAGTCTGGAAGCCAGGTGG - Intergenic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032372441 7:131370920-131370942 TGCTGGGACTGGAGATCAGCAGG + Intronic
1032505736 7:132433345-132433367 TGCTGGGTATGTAGGGTAGAAGG - Intronic
1032845158 7:135745770-135745792 TGGTGGGGCTGGGGGCCAAAGGG + Intronic
1034161037 7:148994522-148994544 AGCTGGGTGTGAAGGTCAGAGGG - Intergenic
1034316945 7:150141996-150142018 GGCTGGGGCTGGAGGACAGCAGG - Intergenic
1034404751 7:150896028-150896050 TCATGGTTCTGGAGGCCAGAAGG - Intergenic
1034438387 7:151074550-151074572 GGCTGGGTTTGGAGGCTGGAGGG - Intronic
1034466674 7:151233853-151233875 TGCTGGTCCTGGAAGCCAGCGGG + Exonic
1034553111 7:151833603-151833625 TGCTGGGGCTGGGGACCAGATGG - Intronic
1034789919 7:153958690-153958712 GGCTGGGGCTGGAGGACAGCAGG + Intronic
1035399506 7:158555593-158555615 GGCTGGGTCTGGGGGACAGCTGG - Intronic
1035438602 7:158878214-158878236 TGCTGTGTGGGGAGGCCAGGAGG + Intronic
1036614439 8:10377805-10377827 TGCTGGGTGTGGAGGCAAGTGGG + Intronic
1036711049 8:11078797-11078819 TGCTGAGACTGGAGGCCTGTGGG - Intronic
1040006048 8:42621687-42621709 TGCTGGGTGAGGAGGCCTGGAGG + Intergenic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1043431237 8:80196964-80196986 TTCTGGGTCTTGAGCCCAGATGG + Intronic
1044820469 8:96152824-96152846 GCCTGGGTCTGGAGGCCTGAGGG - Intronic
1045108852 8:98920459-98920481 GGCTGGGTCTGGGAGCCAGTGGG + Intronic
1045510386 8:102808404-102808426 AGTTGGGTCTGAAGGCCAGGAGG - Intergenic
1046819857 8:118622402-118622424 TGGTGGTTCAGGAGGCCAGGGGG - Intergenic
1046845269 8:118908434-118908456 CACTGATTCTGGAGGCCAGAAGG - Intergenic
1047104491 8:121718574-121718596 TGCAAGGTCTAGAGGCCAGGTGG - Intergenic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1049337108 8:142092405-142092427 TCCTGGGCCTGGAAGCCACAGGG + Intergenic
1049340565 8:142110144-142110166 TGCTGGATCTGCTGGTCAGATGG - Intergenic
1049340569 8:142110178-142110200 TGCTGGGTCTGCTGGTCACAGGG - Intergenic
1049340575 8:142110212-142110234 TGCTGGGTCTGCTGGTCAGTGGG - Intergenic
1049340589 8:142110312-142110334 TGCTGGGTCTGCTTGTCAGAGGG - Intergenic
1049340619 8:142110550-142110572 TGCTGGGTCTGCTGGTCAGAGGG - Intergenic
1049340662 8:142110822-142110844 TGCCGGGTCTGCTGGTCAGAGGG - Intergenic
1049340676 8:142110890-142110912 TGCCGGGTCTGCTGGTCAGAGGG - Intergenic
1049341461 8:142114817-142114839 TGTTGGGGCTGGAGGCGGGAGGG - Intergenic
1049603206 8:143517628-143517650 GGCTGGGGCTGCAGGCCAGTGGG - Intronic
1049795106 8:144493633-144493655 TCCTGGGCAGGGAGGCCAGAGGG + Intronic
1052418184 9:28204887-28204909 TCCTGGGTTTGGAGGGCATATGG + Intronic
1054453656 9:65417890-65417912 TGCAGGATCTTGGGGCCAGAAGG - Intergenic
1056766058 9:89445475-89445497 TGCTCGCTCTGGAGGCCCCAGGG + Intronic
1057081547 9:92177678-92177700 TCCTGGGTGTAGAGGGCAGAGGG - Intergenic
1057081816 9:92179125-92179147 TCCTGGGTGTGGAAGGCAGAGGG + Intergenic
1058732854 9:107867322-107867344 TGCTGAGCCTGTAGGTCAGAAGG + Intergenic
1060795140 9:126508068-126508090 TGCTGGGTCTGGAGACACCAAGG + Intergenic
1060810013 9:126606363-126606385 GCCTGGGTCTGGATGCCCGAGGG + Intergenic
1061221916 9:129257147-129257169 CTCTGAGCCTGGAGGCCAGAAGG - Intergenic
1061280013 9:129592470-129592492 TGCAGGGTCTGGATGCGGGAAGG + Intergenic
1061379163 9:130243841-130243863 TGCTGAGTCTGGGGGCAGGACGG + Intergenic
1061782368 9:133003680-133003702 TGGGGGGTCTGGAGGCCCAAGGG + Intergenic
1062273001 9:135718321-135718343 GGCGGGGTCTGGAGGCCATAGGG + Intronic
1062385696 9:136310685-136310707 TGCAGGGGCTGGGGCCCAGAGGG - Intergenic
1062393774 9:136344381-136344403 TCACGGCTCTGGAGGCCAGAAGG + Intronic
1062707636 9:137954148-137954170 TGCTGGGCCTGTGGGCCTGAGGG - Intronic
1185525448 X:774884-774906 TGCTTGTTGAGGAGGCCAGAAGG + Intergenic
1186508412 X:10111902-10111924 TGCCGGGGCGGGAGGCCTGAAGG - Intronic
1190172130 X:48120009-48120031 TGCAGGGTCTGCAGGTCAGGAGG + Intergenic
1190177782 X:48165670-48165692 TGCAGGGTCTGCAGGTCAGGAGG + Intergenic
1190183750 X:48217339-48217361 TGCAGGGTCTGCAGGACAGGAGG + Intronic
1190189667 X:48266762-48266784 TGCAGGGTCTGCAGGTCAGGAGG + Intronic
1190196894 X:48327386-48327408 TGCAGGGTCTGCAGGTCAGGAGG + Intergenic
1190199363 X:48347105-48347127 TGCAGGGTCTGCAGGTCAGGAGG - Intronic
1190204590 X:48392664-48392686 TGCAGGGTCTGCAGGTCAGGAGG + Intronic
1190205946 X:48402739-48402761 TGCAGGGTCTGCAGGTCAGGAGG - Intronic
1190654988 X:52603590-52603612 TGCCGGGTCTGCAGGTCAGGAGG + Intergenic
1190659904 X:52644740-52644762 TGCAGGGTCTGCAGGTCAGGAGG - Intronic
1190663631 X:52677748-52677770 TGCAGGGTCTGCAGGTCAGGAGG + Intronic
1190666132 X:52697587-52697609 TGCAGGGTCTGCAGGTCAGGAGG - Intronic
1190673286 X:52760823-52760845 TGCAGGGTCTGCAGGTCAGGAGG + Intronic
1190675792 X:52780674-52780696 TGCAGGGTCTGCAGGTCAGGAGG - Intronic
1190676827 X:52789604-52789626 TGCAGGGTCTGCAGGTCAGGAGG + Intronic
1192507704 X:71699070-71699092 TGCGGAGGCTGGAGGCAAGAAGG - Intergenic
1192518992 X:71782482-71782504 TGCGGAGGCTGGAGGCAAGAAGG + Intergenic
1194859564 X:98980039-98980061 AGCTGGATGGGGAGGCCAGAAGG - Intergenic
1196613775 X:117743675-117743697 GCCTGGGTGTGGAGTCCAGAGGG - Intergenic
1197727360 X:129785454-129785476 TGCTGGGTCTTGGGCCCAGTTGG - Intronic
1197755085 X:129987741-129987763 GGCTTGGACTGGAGGCCACATGG + Intronic
1198172078 X:134117176-134117198 TGCTGGAGGTGGAGCCCAGATGG + Intergenic
1199990253 X:152983756-152983778 TCCTGTGTCTGGCAGCCAGAGGG + Intergenic
1200033343 X:153313230-153313252 TCCTGTGTCTGGCAGCCAGAGGG + Intergenic
1200110222 X:153737143-153737165 TGCTGTCTCTGCAGGCCAGGTGG + Exonic
1200409757 Y:2849561-2849583 TCTTGGGGCTGGAGGACAGAAGG + Intronic