ID: 1165760056

View in Genome Browser
Species Human (GRCh38)
Location 19:38315831-38315853
Sequence GGCCGGCGGAGGAGATCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165760056_1165760064 1 Left 1165760056 19:38315831-38315853 CCGCCCGATCTCCTCCGCCGGCC 0: 1
1: 0
2: 2
3: 26
4: 212
Right 1165760064 19:38315855-38315877 CGTACGCCACTTACGCAGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 12
1165760056_1165760063 0 Left 1165760056 19:38315831-38315853 CCGCCCGATCTCCTCCGCCGGCC 0: 1
1: 0
2: 2
3: 26
4: 212
Right 1165760063 19:38315854-38315876 ACGTACGCCACTTACGCAGCCGG 0: 1
1: 0
2: 0
3: 0
4: 5
1165760056_1165760065 2 Left 1165760056 19:38315831-38315853 CCGCCCGATCTCCTCCGCCGGCC 0: 1
1: 0
2: 2
3: 26
4: 212
Right 1165760065 19:38315856-38315878 GTACGCCACTTACGCAGCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165760056 Original CRISPR GGCCGGCGGAGGAGATCGGG CGG (reversed) Intronic