ID: 1165761843

View in Genome Browser
Species Human (GRCh38)
Location 19:38326192-38326214
Sequence GATGAAGCCATGTGTAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165761835_1165761843 15 Left 1165761835 19:38326154-38326176 CCTGGGACAGGAGGGGATGTGGG 0: 1
1: 0
2: 6
3: 79
4: 598
Right 1165761843 19:38326192-38326214 GATGAAGCCATGTGTAGGTGTGG 0: 1
1: 0
2: 0
3: 24
4: 209
1165761833_1165761843 21 Left 1165761833 19:38326148-38326170 CCATCACCTGGGACAGGAGGGGA 0: 1
1: 0
2: 1
3: 27
4: 274
Right 1165761843 19:38326192-38326214 GATGAAGCCATGTGTAGGTGTGG 0: 1
1: 0
2: 0
3: 24
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165761843 Original CRISPR GATGAAGCCATGTGTAGGTG TGG Intronic
900326121 1:2109539-2109561 GATGCAGCCAGGTGTGGGTCCGG + Intronic
902667390 1:17949029-17949051 GATGATCCCATTTGTATGTGTGG + Intergenic
903768585 1:25750061-25750083 GCTAAGGCCATGAGTAGGTGAGG - Intronic
906328995 1:44868772-44868794 GATGAAGGCAAGTGTAGTTCTGG + Intronic
906787502 1:48628828-48628850 GATTAATCCATGTGGGGGTGGGG - Intronic
907561775 1:55397538-55397560 GCTGAGGCTATGTGTATGTGAGG - Intergenic
911292697 1:96077312-96077334 GATGAAGCTATTTGTAAGAGAGG + Intergenic
911432302 1:97806808-97806830 GATGAAGAGATGAATAGGTGAGG - Intronic
911438883 1:97899641-97899663 AATTAAGCCATGTGAAGGAGTGG - Intronic
914324537 1:146598870-146598892 GATGAAGTCATGTCCAGGAGTGG + Intergenic
916738335 1:167627987-167628009 TAGGCAGCCATGAGTAGGTGTGG - Intergenic
919440160 1:197623660-197623682 GAGGAAGCCATGGGTGTGTGAGG - Intronic
920788560 1:209066357-209066379 GAAGAAGCCAATTTTAGGTGGGG - Intergenic
1063913300 10:10854391-10854413 GAAGGAGCCATTTGTAGGTTTGG - Intergenic
1065968431 10:30786972-30786994 GGTGAAGCCATGGTCAGGTGTGG - Intergenic
1067733132 10:48828227-48828249 GATGTAGCCAGTTGTAAGTGGGG - Intronic
1067809841 10:49418022-49418044 CATGCAGCCAAGTGTGGGTGGGG + Intergenic
1068586528 10:58805902-58805924 GATGTAGTCAAGTGTATGTGAGG - Intronic
1068957048 10:62827643-62827665 GATGAAGCCATTTGTGTTTGTGG + Intronic
1069726403 10:70583029-70583051 GTGGAAGCCCTGGGTAGGTGGGG + Intergenic
1070578490 10:77699309-77699331 GATGAACCTAAGTGTGGGTGAGG + Intergenic
1070827351 10:79399012-79399034 GATGGAGGCTTGTGTTGGTGGGG + Intronic
1071848285 10:89542130-89542152 CATGAAGCTCTGTGAAGGTGAGG + Intronic
1074119411 10:110482348-110482370 GCTGAAGCCATGTGTCGGGGTGG + Intergenic
1074919136 10:117989402-117989424 GATGATGCCAAGTGTTGGTGGGG - Intergenic
1075469030 10:122673895-122673917 GAGGCAGCCATGTGGAGCTGGGG - Intergenic
1075536700 10:123277600-123277622 GATGAGGCCCTGTGGGGGTGGGG - Intergenic
1075547569 10:123366759-123366781 GATGAAGCCTTGTGGAAGTAAGG + Intergenic
1075573578 10:123562589-123562611 GAGGCAGCCATGTGGAGATGTGG - Intergenic
1076777000 10:132703422-132703444 GGTGAAGCTGTGTGTATGTGGGG - Intronic
1076777022 10:132703557-132703579 GGTGAAGCCACGTGTGTGTGTGG - Intronic
1076777069 10:132703814-132703836 GGTGAAGCCACGTGTGTGTGTGG - Intronic
1076777086 10:132703888-132703910 GGTGAAGCCACGTGTGTGTGTGG - Intronic
1077078748 11:713237-713259 GTAAAAGCCATGTGTACGTGGGG + Intronic
1077695066 11:4386151-4386173 GCTGAGGACATGTGCAGGTGAGG - Exonic
1078092743 11:8277536-8277558 AATGAAGCCATTTGGAGGTGGGG - Intergenic
1080000828 11:27346971-27346993 GATAAAGGCATCTGTAGGTTTGG - Intronic
1080308753 11:30865884-30865906 GAAGAAGGCTTGTGTGGGTGAGG + Intronic
1081499322 11:43650459-43650481 GATGATGCCAAGTATTGGTGGGG + Intronic
1081653920 11:44844487-44844509 GATGATGCCAAGTGTGGATGAGG - Intronic
1083713399 11:64562238-64562260 GATGCAGACACGTGCAGGTGAGG - Intronic
1085550351 11:77364281-77364303 GATGGATCTATGTGTAGGTAGGG - Intronic
1085849762 11:80106439-80106461 GATGAAAGCATGTATAGCTGGGG + Intergenic
1086414471 11:86575021-86575043 GATGCAGCAAGGTGTGGGTGTGG + Intronic
1089644724 11:119871221-119871243 GTGGAAGCCATCTGAAGGTGGGG + Intergenic
1090048831 11:123359440-123359462 GATGAAGGAATGAGAAGGTGTGG + Intergenic
1091463232 12:661823-661845 GAGGAAGCCATGAGTTGGAGAGG - Intronic
1092792552 12:12082347-12082369 GAAGAAGCCATGGCTGGGTGAGG - Intronic
1098872521 12:75833008-75833030 GAGGAAGCCTGGAGTAGGTGAGG - Intergenic
1099342456 12:81454687-81454709 CATGAAACCATGTGTGGATGGGG - Intronic
1100672237 12:96828587-96828609 GATGCAGCCATGTTCATGTGTGG - Intronic
1101395137 12:104340622-104340644 GATGAGGCCATGTGAAGAGGGGG - Intronic
1101847464 12:108374177-108374199 GATGAAGGGCTGTGTTGGTGAGG - Intergenic
1102731984 12:115119478-115119500 CATGAAGAAATGTGGAGGTGAGG + Intergenic
1104369370 12:128209752-128209774 TATGCAGCCATCTGCAGGTGGGG - Intergenic
1104449777 12:128859592-128859614 GATGAACCCTTCTCTAGGTGGGG + Intronic
1104580403 12:130007269-130007291 GATGATGCCATGAGTTGGGGCGG + Intergenic
1105070454 12:133231417-133231439 GCTGAAGCAAAGTGGAGGTGAGG - Intronic
1105298601 13:19113411-19113433 GAGGAAGCCCAGTGCAGGTGGGG - Intergenic
1106877852 13:34094665-34094687 GAAAAAGCCAAGTGTTGGTGAGG + Intergenic
1107507473 13:41048868-41048890 GATGAAGAAATGAGTAGGTGAGG - Intronic
1107758314 13:43649987-43650009 GATGAAGGCATGTGGAGCAGAGG - Intronic
1110552496 13:76825021-76825043 GAGGATGCCACGTGAAGGTGGGG - Intergenic
1111512322 13:89282451-89282473 GAGGAGGCCATGTGAAGATGGGG + Intergenic
1112316375 13:98365990-98366012 GATTAAGGAATGTGTAGGGGAGG + Intronic
1112410559 13:99159578-99159600 GATGACCCCATGTGTAAATGTGG + Intergenic
1112555261 13:100461918-100461940 GAGGAAGCCCTGTGGAGTTGAGG - Intronic
1113908365 13:113830625-113830647 GATGGAGCCATGGGGAGGAGGGG - Intronic
1113908393 13:113830700-113830722 GATGGAGCCATGGGGAGGAGGGG - Intronic
1113908420 13:113830776-113830798 GATGGAGCCATGGGGAGGAGGGG - Intronic
1117090722 14:52247432-52247454 CAGGAAGCTATGTGTAGGTGTGG + Intergenic
1117152715 14:52905624-52905646 GGTGATGAGATGTGTAGGTGAGG + Intronic
1117465922 14:55993988-55994010 GATGATACCAAGTGTTGGTGAGG - Intergenic
1119200260 14:72746826-72746848 CAAGACGCCATGTGCAGGTGGGG + Intronic
1122530207 14:102419887-102419909 GACGCAGCAATCTGTAGGTGTGG + Intronic
1124619913 15:31267802-31267824 GATGAGACCATGTGAAGGGGAGG - Intergenic
1125388170 15:39161170-39161192 GGGGAGGCCATGTGTATGTGGGG - Intergenic
1127006520 15:54576727-54576749 GATGAATCCATGTGCTGGTGGGG - Intronic
1127536170 15:59891894-59891916 GAAGCAGTCATGTGCAGGTGTGG + Intergenic
1127732229 15:61811824-61811846 GAGGCCCCCATGTGTAGGTGTGG + Intergenic
1128746479 15:70118478-70118500 CATCAAGCCATGAGAAGGTGAGG + Intergenic
1129028483 15:72601530-72601552 GATGAAGACATGTGCAGGCCAGG - Exonic
1131015241 15:89052595-89052617 GAGAAAGCCATGTGAAGATGAGG + Intergenic
1131027151 15:89153083-89153105 GAGGCAGCCATGTGAAGGTCTGG - Intronic
1131027179 15:89153337-89153359 GATGAATACATGAATAGGTGAGG + Intronic
1131152421 15:90055344-90055366 GAAGAGGCCGTGTGCAGGTGAGG + Intronic
1132950372 16:2558616-2558638 CATGAAGCCGTGTGTGGTTGTGG + Intronic
1132963976 16:2641554-2641576 CATGAAGCCGTGTGTGGTTGTGG - Intergenic
1133696819 16:8272433-8272455 GGTCAAGCCATCTGTAAGTGAGG + Intergenic
1136385178 16:29920730-29920752 GATGATGCCATGTCTTGATGAGG + Intronic
1138308668 16:56004293-56004315 GTTGAAGCCATGTGAGGGAGTGG - Intergenic
1139370283 16:66463292-66463314 GATAATGCCAAGTGTTGGTGAGG - Intronic
1139500095 16:67355978-67356000 AAGAAAGCCATGTGTCGGTGTGG + Intronic
1139961372 16:70719714-70719736 GATGATACCAAGTGTTGGTGAGG + Intronic
1140009026 16:71111977-71111999 GATGAAGTCATGTCCAGGAGTGG - Intronic
1140557897 16:75942620-75942642 GAGGGAGCCATGTGGAGGTCTGG + Intergenic
1141118410 16:81331654-81331676 GGTGCAGCCATGTGTATGAGGGG - Intronic
1141569130 16:84923600-84923622 GAGAAAGCCATGTGAAGGTGAGG - Intergenic
1142103091 16:88285892-88285914 GATGAAGACATCTGTAGCTGAGG - Intergenic
1144204193 17:12967684-12967706 AATGAAGTGATGTGTTGGTGAGG - Intronic
1145059374 17:19723023-19723045 AATGAAGCTATTTATAGGTGTGG + Intergenic
1146889128 17:36493590-36493612 GTTGGAGCCATGTTGAGGTGGGG + Intronic
1146919109 17:36698143-36698165 TATGAAGCCTTGGGTGGGTGGGG + Intergenic
1151361437 17:73591607-73591629 GATGAAGCAATGTTTATCTGAGG + Intronic
1151491415 17:74433931-74433953 GATGAAGCCACTTGTTGCTGGGG + Intronic
1151799616 17:76370346-76370368 GAGGAAGCCATGGGTCAGTGGGG - Intronic
1151932418 17:77241063-77241085 CATGAAGCCATCTGGGGGTGGGG + Intergenic
1153547833 18:6227184-6227206 GATTAAGTCATCTGTAAGTGTGG - Intronic
1157017540 18:43735384-43735406 GATGAAGCCATGGATAGGCTGGG + Intergenic
1161148770 19:2695591-2695613 GATGGAGCCAAGTGGGGGTGGGG + Intronic
1162064438 19:8116668-8116690 CATGAGGACATGTGTTGGTGAGG - Exonic
1162522018 19:11186729-11186751 GATAAAGCCATATGTTGGTGAGG + Intronic
1165761843 19:38326192-38326214 GATGAAGCCATGTGTAGGTGTGG + Intronic
1168331045 19:55568925-55568947 GATGAATCCCTCTTTAGGTGGGG - Intergenic
925033975 2:672299-672321 GATGAAGCCAGGGGTAGAGGAGG + Intronic
925458938 2:4043331-4043353 GCTGAAGCCATCTGTCTGTGAGG + Intergenic
925496531 2:4456321-4456343 GATGCTGCCATGTGTAAGTTTGG + Intergenic
925587048 2:5474865-5474887 GAGGCAGGCATGTGTGGGTGGGG - Intergenic
925772649 2:7298313-7298335 GCTGAGGCCATGTGTTGGTGAGG + Intergenic
927321229 2:21748147-21748169 GATCAAGCCATGCGTACTTGGGG + Intergenic
927412897 2:22846789-22846811 TATGAAGCCAAGTGTATTTGGGG - Intergenic
929074229 2:38064843-38064865 GGTCATGCCATGTGTTGGTGGGG + Intronic
931140747 2:59454992-59455014 GATACACCCATGTGTAGGGGTGG + Intergenic
932725218 2:74173976-74173998 GATGGGGCCATGGCTAGGTGCGG + Intronic
932726219 2:74182021-74182043 GAAGATGCCCTGTGTGGGTGAGG - Intergenic
932791126 2:74654915-74654937 GATGGACCCAGGTGTATGTGCGG - Intronic
933565572 2:83946403-83946425 GATGAAGCCATGTTGGGGAGGGG - Intergenic
935141753 2:100359391-100359413 GATGGAGACATGTGTAGATAAGG + Intergenic
937556807 2:123168169-123168191 GAAGAAGCCATGTGTAAATATGG - Intergenic
939061532 2:137428293-137428315 GATGAAAACAGGTGTTGGTGAGG + Intronic
939133636 2:138268078-138268100 AATTAAGCCATGTGTGGGAGAGG - Intergenic
940130454 2:150375491-150375513 TATAAAGCTATGTGGAGGTGGGG + Intergenic
941194275 2:162427361-162427383 GATGAAACCAAGTGTTGGAGAGG - Intronic
943081555 2:183263791-183263813 GAGGAAGCCACGATTAGGTGAGG + Intergenic
946059263 2:216927609-216927631 CATGAAGCCATGTGTGAGGGTGG + Intergenic
946232712 2:218302480-218302502 GATCAAGCTATGTGAAGGTGTGG + Intronic
946351418 2:219156978-219157000 GATGTAGAGATGTGTAAGTGAGG - Intronic
1169960861 20:11158776-11158798 AATGAAGCCATTGGTAGGTACGG + Intergenic
1170000208 20:11606778-11606800 GAGGAAGCCAAGATTAGGTGAGG - Intergenic
1170735953 20:19014447-19014469 GAAGAATCCATGTCTAGGTAAGG + Intergenic
1171152209 20:22837232-22837254 CAAGAAGCCATCTGCAGGTGTGG - Intergenic
1173269856 20:41523558-41523580 GATGAAGCCATGTGGAAGACAGG - Intronic
1173570043 20:44070154-44070176 GATGCAGCCATTTTGAGGTGGGG + Intergenic
1174306878 20:49619568-49619590 GATGAATGGATGTGTGGGTGGGG + Intergenic
1174658949 20:52193986-52194008 GATGCAGCCATGTGAGGATGAGG + Intronic
1175809788 20:61851817-61851839 GAAGAAGCCATCAGTGGGTGTGG - Intronic
1181877373 22:25950259-25950281 GATGTAGACATCTGTGGGTGGGG + Intronic
1182875910 22:33690860-33690882 GATGGAGCCATGGAAAGGTGTGG - Intronic
1183298533 22:37046510-37046532 GATGAAGCCATGTTTGGGTTGGG - Intergenic
1184781572 22:46652245-46652267 GAGGAGGCCATGTGAGGGTGGGG + Intronic
1184966426 22:47975691-47975713 GCTGAAACCATGTGTGGATGAGG - Intergenic
1184977760 22:48075147-48075169 AATGAAGCCATGTGCAGGGGTGG + Intergenic
1185327511 22:50234292-50234314 GATGCTGCCATGGGTGGGTGTGG - Intronic
951632934 3:24740974-24740996 AAAGAAGCAATGGGTAGGTGGGG + Intergenic
952112605 3:30141417-30141439 GAGAAAGCCACGTGTAGGAGTGG + Intergenic
952906255 3:38140876-38140898 AATGAGGGAATGTGTAGGTGGGG + Intronic
957899054 3:86464211-86464233 GCTGAAGCCATGTGTATGAGTGG + Intergenic
966947614 3:184788262-184788284 GGTGAAGCCATGTTTAGTAGAGG + Intergenic
967016326 3:185485358-185485380 AATGAAGCCATGGGTAAGAGGGG - Exonic
967814589 3:193788232-193788254 GACGAAGCCCTGTGTTGCTGGGG + Intergenic
969371500 4:6734154-6734176 GAGGACACCATGTGTGGGTGTGG + Intergenic
970882288 4:20946301-20946323 GAAGAAGCCATGTGTAGATAAGG + Intronic
977118895 4:93071597-93071619 GATGAAGGAATATCTAGGTGAGG + Intronic
977952378 4:102987529-102987551 GATAAAAACATGTGTAGGTTAGG + Intronic
978398552 4:108307933-108307955 GATGAAATCATGGGGAGGTGAGG + Intergenic
978532296 4:109727647-109727669 GATTAAGCCAGGTGTAGTGGGGG + Intronic
980321403 4:131282940-131282962 GATTAAGCCATGGGCAGGTTTGG - Intergenic
985820390 5:2156147-2156169 GAGGAGGCCACGTGAAGGTGAGG - Intergenic
986235074 5:5902007-5902029 GAAGAATCCAAGTGAAGGTGAGG - Intergenic
986349656 5:6866016-6866038 GATGTAACCAAGTGAAGGTGAGG + Intergenic
986668915 5:10126532-10126554 GATGCAGCCATGTTGAGATGAGG - Intergenic
986936732 5:12897730-12897752 GCCGAAGGCATGTGGAGGTGGGG - Intergenic
989232678 5:39103965-39103987 GAGGAATACATGTGTGGGTGGGG + Intergenic
989753583 5:44923920-44923942 GATGATGACATTGGTAGGTGAGG + Intergenic
989804819 5:45590368-45590390 GAGGAAGCTATGTGTGTGTGAGG - Intronic
989826535 5:45863476-45863498 GATGATGCTATCTGTAGATGGGG - Intergenic
990546054 5:56822741-56822763 CATGTAGCCAGGTGTAGGTCTGG - Intronic
991957790 5:72013266-72013288 GAAGAAGACGTGTGTTGGTGGGG + Intergenic
992187256 5:74256272-74256294 GATGGAGCCAGGTGGAGGAGGGG - Intergenic
993509882 5:88757995-88758017 GATGGAGCCAGGTGTAGCTAAGG - Intronic
993810540 5:92470702-92470724 GATGAAGAGACGTGTAGGTATGG + Intergenic
999104225 5:149055509-149055531 GATAAAGCCAAGTGTTTGTGAGG + Intronic
999983057 5:156976323-156976345 AATGAAGTCATGTCTAGGGGTGG - Intergenic
1001969126 5:175939542-175939564 AATGAAGCCGTGAGTAGGTGAGG - Intronic
1001975701 5:175996830-175996852 CATGAAGCCGTGAGTAGGTGAGG - Intronic
1002241727 5:177846942-177846964 CATGAAGCCGTGAGTAGGTGAGG + Intergenic
1002248314 5:177904201-177904223 AATGAAGCCGTGAGTAGGTGAGG + Intergenic
1003687631 6:8320281-8320303 GATGATGGCATGAGGAGGTGGGG - Intergenic
1006247930 6:32756651-32756673 GATGCAGATATGTGGAGGTGGGG + Intronic
1010767492 6:79792971-79792993 GAGGAAGGCATGTGTGGGTTTGG - Intergenic
1016859828 6:148706365-148706387 GATGAAGACATGAGGTGGTGAGG - Intergenic
1018854557 6:167666299-167666321 AATGAAGAGATGTGTAGGTGAGG - Intergenic
1018909568 6:168094288-168094310 GGGGAGGCCATGTGTGGGTGGGG - Intergenic
1018909584 6:168094330-168094352 GGGGAGGCCATGTGTGGGTGGGG - Intergenic
1018909592 6:168094350-168094372 GGGGAGGCCATGTGTGGGTGGGG - Intergenic
1019511449 7:1419648-1419670 GAAGAAGCCATGTCCAGGTGGGG + Intergenic
1020858008 7:13452847-13452869 GATGGAGCCATTTGTAGTTCAGG + Intergenic
1020993281 7:15229480-15229502 GATGAGGGGATGTGTAGATGGGG - Intronic
1021464842 7:20930561-20930583 GATGAAGCTATGCTAAGGTGGGG - Intergenic
1022194636 7:28052507-28052529 GGAGAAGCCACTTGTAGGTGAGG - Intronic
1023223472 7:37944859-37944881 TATGTAGCCATGTGCAGGAGAGG - Intronic
1023994587 7:45151503-45151525 GATGAAGCCCTGTGAGAGTGAGG - Intergenic
1026490469 7:70858928-70858950 GATAAAGCCAAGTGTTGGTGAGG + Intergenic
1028608378 7:92680830-92680852 GATGAAGCAATATGTGAGTGAGG - Intronic
1032546628 7:132749189-132749211 AAGGAAGCCATGTGTGGCTGGGG - Intergenic
1039824961 8:41165247-41165269 AATGAAGGAATGTGTGGGTGAGG - Intergenic
1042915185 8:73868385-73868407 GATGAAGCTATGCATATGTGAGG - Intronic
1042968446 8:74381049-74381071 GATGAAGAAATGTGGGGGTGAGG + Intronic
1044394033 8:91688354-91688376 GATGAAGAGATGCGTAGTTGAGG + Intergenic
1046399332 8:113684319-113684341 GAGGAAGGCAGGTGGAGGTGGGG - Intergenic
1046476916 8:114757615-114757637 GAACCAGCAATGTGTAGGTGAGG + Intergenic
1048121131 8:131582982-131583004 CATGAAACCAGGTGCAGGTGAGG - Intergenic
1048619173 8:136113016-136113038 GATGAAGCTATTCGGAGGTGGGG + Intergenic
1051430827 9:16978539-16978561 GAAGAAATCAAGTGTAGGTGGGG - Intergenic
1052377448 9:27733015-27733037 GATATAGCCATCTGTAGGAGTGG + Intergenic
1053613496 9:39740056-39740078 GCTGAAGCTATGTACAGGTGTGG - Intergenic
1053871537 9:42498013-42498035 GCTGAAGCTATGTACAGGTGTGG - Intergenic
1054240018 9:62602341-62602363 GCTGAAGCTATGTACAGGTGTGG + Intergenic
1054554151 9:66636867-66636889 GCTGAAGCTATGTACAGGTGTGG + Intergenic
1057113039 9:92492560-92492582 GATGATGCCATTTGAAGGAGAGG + Intronic
1057508102 9:95653051-95653073 GATGAAGCCATGGAAAGGTGTGG + Intergenic
1058825610 9:108773801-108773823 GAAGAAGCCATGTGTAGAGTAGG - Intergenic
1185925366 X:4139876-4139898 GATGAGGCTTTGTGAAGGTGGGG + Intergenic
1187269348 X:17765655-17765677 GATTATGCCATATGTAGGTGTGG - Intergenic
1187269409 X:17766129-17766151 GATTACACCATGTGTTGGTGTGG - Intergenic
1188786888 X:34357664-34357686 GATGAGGTCATGTGTATGTTTGG - Intergenic
1190827868 X:54034226-54034248 GATTAAGCCATGTCTTAGTGTGG - Intronic
1192173358 X:68870601-68870623 GATGTCACCAGGTGTAGGTGGGG - Intergenic
1192783135 X:74314190-74314212 GATGAAGCCAAGTGTATGGCTGG - Intergenic
1193300452 X:79882144-79882166 GCTGATGACATGTGTAAGTGTGG + Intergenic
1195247038 X:103004191-103004213 GCTGAAGCCAAGTGGTGGTGTGG - Intergenic
1195783511 X:108490401-108490423 GATAACGCAATGTGTTGGTGAGG - Intronic
1198507695 X:137317619-137317641 GATCAAGCCATGTGAAAGTCTGG - Intergenic
1198659130 X:138947841-138947863 AATGAGGCCATATGTGGGTGGGG + Intronic