ID: 1165761843

View in Genome Browser
Species Human (GRCh38)
Location 19:38326192-38326214
Sequence GATGAAGCCATGTGTAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165761835_1165761843 15 Left 1165761835 19:38326154-38326176 CCTGGGACAGGAGGGGATGTGGG No data
Right 1165761843 19:38326192-38326214 GATGAAGCCATGTGTAGGTGTGG No data
1165761833_1165761843 21 Left 1165761833 19:38326148-38326170 CCATCACCTGGGACAGGAGGGGA No data
Right 1165761843 19:38326192-38326214 GATGAAGCCATGTGTAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165761843 Original CRISPR GATGAAGCCATGTGTAGGTG TGG Intronic