ID: 1165764000

View in Genome Browser
Species Human (GRCh38)
Location 19:38338901-38338923
Sequence ATGGAGTCTCACTCTGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 914
Summary {0: 1, 1: 14, 2: 63, 3: 216, 4: 620}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165763997_1165764000 18 Left 1165763997 19:38338860-38338882 CCCTGTCTTTGTTTTTATTAATT No data
Right 1165764000 19:38338901-38338923 ATGGAGTCTCACTCTGTTGTTGG 0: 1
1: 14
2: 63
3: 216
4: 620
1165763998_1165764000 17 Left 1165763998 19:38338861-38338883 CCTGTCTTTGTTTTTATTAATTA 0: 1
1: 1
2: 11
3: 164
4: 1586
Right 1165764000 19:38338901-38338923 ATGGAGTCTCACTCTGTTGTTGG 0: 1
1: 14
2: 63
3: 216
4: 620

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165764000 Original CRISPR ATGGAGTCTCACTCTGTTGT TGG Intronic
900196589 1:1379569-1379591 ATGGGGCCTCACTATGTTGCAGG - Intergenic
900583156 1:3419188-3419210 ACGGAGTCTCACTCTGCCTTTGG - Intronic
900823319 1:4906957-4906979 ATGGAGTCTTGCTCTGCTGCAGG - Intergenic
901034418 1:6327797-6327819 ATGGAGTCTCGCTCTGTCCCAGG + Intronic
901458932 1:9380007-9380029 ACGGGGTTTCACTATGTTGTTGG - Intergenic
901550844 1:9995206-9995228 ATGGAGTATCCCTGTGTTGCCGG - Intergenic
901605883 1:10458876-10458898 ACAGTGTCTCACTCTGTTGCAGG + Exonic
901609057 1:10482457-10482479 ATGGAGTCTCGCTCTGTCACCGG + Intronic
901886193 1:12224968-12224990 ATGGAGTCTTGCTCTGTTGCAGG + Intergenic
901941321 1:12664390-12664412 ATGGAGTCTCACTCTCTCCCAGG + Intronic
903144205 1:21359576-21359598 ACTGAGTCCCACTCTGTTGCTGG - Intergenic
903565291 1:24260488-24260510 ACAGAGTCTCACTCTGTCGCTGG - Intergenic
903874484 1:26464020-26464042 ACGGAATCTCACTCTGTCGCTGG + Intronic
904056510 1:27674176-27674198 ACAGGGTCTCACTCTGTTGCCGG + Intergenic
904157059 1:28492734-28492756 ATGGAATCTCGCTCCGTTGCTGG - Intronic
904552530 1:31331634-31331656 ATGGAGTCTCGCTCTGTTGCCGG + Intronic
904750504 1:32738965-32738987 ATGGAGTCTCACACTGTCACCGG + Intergenic
905014572 1:34768492-34768514 ACGGAGTCTCGCTCTGTTGCCGG - Intronic
905804417 1:40865429-40865451 ATGGAGTCTCACTCTGTCGCTGG - Intergenic
906131456 1:43460971-43460993 ATGGAGTCTCACTCTGTCCCAGG - Intergenic
906288715 1:44605271-44605293 ACGGAGTCTCACTCTGTCACAGG - Intronic
906426853 1:45722041-45722063 ACGGAGTCTCACTCTGTGCCAGG - Intronic
906625049 1:47318270-47318292 ACAGAGTCTCACTCTGGTGCCGG + Intergenic
906990411 1:50731392-50731414 ATGGAGTCTCACTCTGTCCCCGG + Intronic
907014733 1:51001447-51001469 ACAGGGTCTCACTCTGTTGCAGG + Intergenic
907438854 1:54466014-54466036 ATGGAGTTTTGCTCTGTTGCTGG + Intergenic
907727764 1:57035866-57035888 ACAGGGTCTCACTCTGTCGTGGG + Intronic
907818264 1:57941344-57941366 CTAGAGTCTCACTTTTTTGTAGG + Intronic
908969758 1:69813423-69813445 ATTGACTCTCCCTCTGTTCTGGG + Intronic
909007571 1:70295271-70295293 ACGGAGTCTCACTCTGTCTCAGG + Intronic
909113220 1:71505309-71505331 ATGGAGTCTCGCTCTTTCGCCGG + Intronic
909795855 1:79735048-79735070 ATTGAGTTTCACTCTGAGGTAGG - Intergenic
910353503 1:86327566-86327588 ATGAAATATCACTATGTTGTTGG - Intergenic
911069216 1:93819089-93819111 ATGGAGTCTCACTCTGTTGCCGG + Intronic
911223950 1:95283772-95283794 GAAGAGACTCACTCTGTTGTGGG + Intergenic
911262104 1:95698989-95699011 TTGGAGTATCCCTGTGTTGTAGG + Intergenic
911419094 1:97616908-97616930 ACGGAGTCTCCCTCTGTTGCCGG + Intronic
911433952 1:97830682-97830704 ATGGAGTCTCACTCTGTCCCCGG - Intronic
911894951 1:103421554-103421576 ACAGAGTCTCACTCTGTTGCAGG - Intergenic
912393953 1:109325260-109325282 ATGGAGTCTCACTCTGTCACCGG + Intronic
912763766 1:112390734-112390756 ACGGAATCTCGCTCTGTTGCTGG - Intergenic
912832935 1:112969661-112969683 ACAGAGTCTTACTCTGTCGTTGG - Intergenic
912916298 1:113818187-113818209 ATGGAGTCTCGCTCTGTTGCCGG + Intronic
914096359 1:144547462-144547484 ACGGAGTCTCGCTCTGTCGGCGG + Intergenic
914302156 1:146386506-146386528 ACGGAGTCTCGCTCTGTCGGCGG - Intergenic
915160488 1:153916249-153916271 GTGGAGTCTCACTCTGTCACTGG - Intronic
915355330 1:155252225-155252247 ACAGAGTCTGACTCTGTTGCTGG + Intronic
915482754 1:156198472-156198494 ATGGAGTCTCACTGTCTCCTAGG + Intronic
916033817 1:160903111-160903133 ACAGGGTCTCACTCTGTTGCTGG - Intergenic
916222756 1:162461057-162461079 ACGGAGTCTCGCTCTGTCGCCGG - Intergenic
916805572 1:168256854-168256876 ACAGAGTCTCACTCTGTCCTAGG - Intergenic
916886355 1:169072178-169072200 ATGGAGTCTCTCTCTGTGCCAGG - Intergenic
916972595 1:170040849-170040871 ATGGAGTCTCGCTCTGTGCCAGG + Intronic
917013508 1:170502915-170502937 ACGGAGTCTCACTCTGTCACTGG + Intergenic
917250410 1:173053444-173053466 ACGGAGTCTCACTCTGTCGCCGG - Intergenic
917828296 1:178847981-178848003 ATAGAGTCTATATCTGTTGTAGG + Intronic
918074205 1:181158217-181158239 ATGGAGTCTCACTCTGTCCCAGG + Intergenic
918914199 1:190614516-190614538 ACAGAGTCTCACTCTCATGTAGG + Intergenic
919251134 1:195057482-195057504 ACGGAGTCTCTCTCTGTTAACGG - Intergenic
919370219 1:196714719-196714741 ATGGAGTCTTGCTCTGTCGTCGG + Intronic
920151765 1:203915387-203915409 ATGGAGTCTTGCTCTGTTGCCGG + Intergenic
920498000 1:206469075-206469097 ATGGGGTTTCACTGTGTGGTTGG - Intergenic
920498025 1:206469219-206469241 ATGGGGTTTCACTGTGTGGTTGG - Intergenic
920765335 1:208826857-208826879 ATGGAGTCTCGCTCTGTCCCAGG - Intergenic
920906623 1:210175839-210175861 ATGGGGTCTCACTCTGTCGCCGG + Intergenic
920969446 1:210730606-210730628 CTGGAGTCTTACTATTTTGTGGG + Intronic
921168007 1:212521047-212521069 ATGGAGTCCCACTATGTTGCTGG - Intergenic
922970030 1:229728457-229728479 ATAGGGTCTCACTATGTTGCTGG + Intergenic
923182268 1:231530862-231530884 ATGGAGTCTCATTCTGTCGCCGG - Intronic
923185925 1:231573395-231573417 ATGGAGTCTTGCTCTGTTGCTGG + Intronic
924228009 1:241938443-241938465 ATGGAGTCTTGCTCTGTTGCTGG + Intergenic
924410591 1:243800691-243800713 ACTGAGTCTCACTCTGTCGCTGG - Intronic
924470797 1:244340925-244340947 ATGATGTCTCACTATGTTGCTGG - Intergenic
924719412 1:246608054-246608076 ACGGAGTCTTGCTCTGTTGCCGG - Intronic
924784992 1:247186589-247186611 ATGGAGTCTCGCTCTGTTGCTGG - Intergenic
1062849787 10:735446-735468 CTGGAGCCTCACTCTGTCCTGGG - Intergenic
1063207451 10:3847520-3847542 ATGGAGTCTCACTGTGTTGGAGG + Intergenic
1063454696 10:6174839-6174861 ACGGAGTCTCACTCTCATGTAGG + Intronic
1063823496 10:9865766-9865788 ATGGAGGCTGACTGTATTGTTGG - Intergenic
1063976462 10:11421320-11421342 ATGGAGTCTCACTCTGGCTTAGG - Intergenic
1064048434 10:12040230-12040252 ATGGGGTTTCACCATGTTGTTGG - Intronic
1064049519 10:12048228-12048250 ATAGAGTCTCACTCTGTCATCGG + Intergenic
1064119558 10:12606850-12606872 ATGGAGTCTCGCTCTGTCACCGG + Intronic
1064269511 10:13852266-13852288 ATGGAGTCTTGCTCTGTTGCTGG + Intronic
1064338499 10:14465642-14465664 ATAGAGTCTCACTCTGTCACTGG - Intergenic
1064820917 10:19331889-19331911 ACGGAATCTCACTCTGTTGCAGG + Intronic
1064962448 10:20980617-20980639 ATAGAGGCTCTCTCTGTTCTAGG - Intronic
1064979088 10:21148548-21148570 ACAGAGTCTCACTCTGTTGCCGG + Intronic
1065123384 10:22549813-22549835 ATGGATTCTCACTGTCTTCTAGG - Intronic
1065627660 10:27648354-27648376 ATAGAGTCTCGCTCTGTCGCTGG - Intergenic
1066138490 10:32477231-32477253 ATGGAGTCTCGCTCTGTCGCTGG + Intronic
1067323319 10:45243396-45243418 ATGGAAACTAGCTCTGTTGTTGG + Intergenic
1067907166 10:50304798-50304820 ATAGAGTTTCACTCTTTTGCTGG + Intergenic
1068499660 10:57828469-57828491 ACGGAGTCTCACTCTGTCTCTGG + Intergenic
1069380209 10:67835663-67835685 ATGGAGTCTCACTCTGTTGCCGG - Intronic
1069591072 10:69642291-69642313 TTGGAGTCTCTCTCCGTTGCTGG - Intergenic
1070040922 10:72778992-72779014 ATGGAGTCTCACTCTGTTGCTGG + Intronic
1070204115 10:74238884-74238906 ACGGAGTCTCGCTCTGTTCCAGG + Intronic
1071581342 10:86773566-86773588 ACGGAGTCTTGCTCTGTTGCTGG - Intronic
1071761693 10:88615602-88615624 GTGGAGTCTCACACTGTTGCTGG - Intergenic
1072226071 10:93370339-93370361 ACAGAGTCTCACTCTGTTGCTGG + Intronic
1073020712 10:100441434-100441456 ATGGAGTCTCACTCTCATCCAGG - Intergenic
1073089338 10:100921239-100921261 ATGGAGTCTCACTGTCTCCTAGG + Intronic
1073191538 10:101654094-101654116 ACGGAGTCTCGCTCTGTCGCCGG - Intronic
1073564225 10:104521485-104521507 ATGGGGTTTCACCATGTTGTTGG + Intergenic
1075216585 10:120541796-120541818 ATGGAGTCTCGCACTGTTGCTGG + Intronic
1075684208 10:124352872-124352894 ATGGAGCCTCGCACTGTTGCTGG - Intergenic
1075833408 10:125430456-125430478 ACAGAGTCTCACTCTGTTGCCGG - Intergenic
1076403829 10:130199896-130199918 ATGGAGGCTCTCACTGGTGTCGG + Intergenic
1076708509 10:132316975-132316997 ATGGAGTCTCACTCTGTCCCAGG - Intronic
1077262166 11:1628625-1628647 CTGGAGCCCCACTCTGTTCTGGG - Intergenic
1077934301 11:6767714-6767736 TTGTAGACTCACTCTGTGGTAGG - Intergenic
1078366511 11:10711075-10711097 ATGGAGTCTCACTCTGTCACAGG + Intergenic
1079207598 11:18430340-18430362 ATGGGGTCTCACTCTGAGATGGG + Intronic
1079280377 11:19081965-19081987 ATGGGGTCTCACTATGTCCTAGG + Intergenic
1079330498 11:19528903-19528925 ATGGAGTCTCACTCTGTCACCGG - Intronic
1079554428 11:21741127-21741149 ACAGAGTCTCACTCTGTTGCCGG - Intergenic
1079788348 11:24703801-24703823 ATGGAGTCTCACTCTGGCCCAGG - Intronic
1080467830 11:32514571-32514593 ATGGAGTCTCGCTCTGTTGCTGG - Intergenic
1081053060 11:38370302-38370324 ATGCACTCTCTTTCTGTTGTTGG - Intergenic
1081130730 11:39377008-39377030 ACAGAGTCTTACTCTGTTGCCGG + Intergenic
1082029179 11:47592563-47592585 AAGGAGTCACTCTCTGATGTAGG + Intronic
1082192243 11:49260408-49260430 ATGGAGGCTCACTCTATTTGGGG - Intergenic
1082705531 11:56490281-56490303 ATGGAGTTTCTCTCTGTCTTAGG - Intergenic
1082756062 11:57077912-57077934 ATAGAGTCTCACTCTGTCACAGG + Intergenic
1082840561 11:57685995-57686017 ATGTAGTCTCACACTGTCGCTGG - Intronic
1083232269 11:61330685-61330707 ATGGAGTCTCGCTCTGTCACCGG + Intronic
1083485080 11:62978369-62978391 ACAGAGTCTCACTCTCTTGCTGG + Intronic
1083835899 11:65267178-65267200 ATGGAGTCTCGCTCTGTCCCAGG - Intronic
1083875291 11:65520368-65520390 ATGGAGTCTCCCTCTGTCCCAGG + Intergenic
1084405642 11:68971276-68971298 GTGGAGGCTGACTCTGTTGGAGG + Intergenic
1084614819 11:70228616-70228638 ATGGAGTCTCGCACTGTCCTGGG - Intergenic
1084619208 11:70257357-70257379 ATGGAGTTTTGCTCTGTTGCTGG + Intergenic
1084621928 11:70277933-70277955 ATGGAGTCTCGCTCTGTCGCCGG + Intronic
1084814214 11:71636575-71636597 ACGGAGTCTCGTTCTGTTGCCGG + Intergenic
1084849427 11:71927054-71927076 ATGGGGTCCCACTATGTTGCTGG - Intronic
1084877562 11:72144489-72144511 ACAGAGTCTCACTCTGTCATGGG + Intergenic
1085412740 11:76301258-76301280 ATGGAGTCTCACTCTGTCTCAGG - Intergenic
1085794933 11:79530526-79530548 ATGGGGTTTCACTATGTTGTTGG + Intergenic
1086200444 11:84195186-84195208 ATGGAGTCCCACTCTGTTGCCGG + Intronic
1086336056 11:85801842-85801864 ATGGAGTCTTACACTGTCGCTGG + Intronic
1086469452 11:87092218-87092240 ATGGAGTTTTACTCTCTAGTGGG + Intronic
1086673883 11:89580635-89580657 ATGGAGGCTCACTCTATTTGGGG + Intergenic
1087454321 11:98363533-98363555 ACGGAGTCTCACTCTGTCCCAGG - Intergenic
1087511984 11:99107400-99107422 ATGGAGTATCTCTATGTTCTTGG + Intronic
1087759677 11:102092383-102092405 ACAGAGTCTCACTCTGTCGCGGG + Intergenic
1087782432 11:102315557-102315579 ATGCAGTCTCACTCTGTTCCAGG + Intergenic
1087923587 11:103894536-103894558 ACGGAGTCTCGCTCTGTCGCTGG + Intergenic
1088283099 11:108156467-108156489 AGAGGGTCTCACTCTGTTGCAGG - Intergenic
1089508882 11:118983049-118983071 ATGGAGTCTCACTCTTTCCCAGG + Intergenic
1089841858 11:121425609-121425631 ACAGAGTCTCGCTCTGTTGCCGG + Intergenic
1090170429 11:124597747-124597769 CTGGAGTCTGTCTCTGTTGCTGG - Intergenic
1092048647 12:5452118-5452140 ACGGAGTCTCACTCTCTTGCCGG + Intronic
1092705755 12:11282616-11282638 ACGGAGTCTCACTCTGTCCCAGG + Intergenic
1092729457 12:11514918-11514940 ATGGAGTCTCTCTCTGTCACCGG - Intergenic
1092814994 12:12304805-12304827 ACGGAGTCTCCCTCTGTCGCCGG - Intergenic
1092889963 12:12960205-12960227 ATGGAGTCTCGCTCTGTCCCAGG - Intergenic
1093191367 12:16078677-16078699 GTGGGGTATCACTCTGTGGTAGG + Intergenic
1094322228 12:29198249-29198271 ACTGAGTCTCACTTTGTTGCCGG + Intronic
1094462562 12:30712926-30712948 ATGGGGTTTCACCCTGTTGGTGG + Intronic
1094604678 12:31940113-31940135 ACGGAGTCTCACACTGTTGCAGG - Intergenic
1094646122 12:32326055-32326077 ATGGAGTCTCACTCTCTCCCAGG - Intronic
1095367956 12:41430442-41430464 ATGGAGTCTCGCTCTGTCACCGG - Intronic
1095480077 12:42625576-42625598 ATGGAGTCTTGCCCAGTTGTTGG - Intergenic
1095519489 12:43045756-43045778 ATGGTATCTCACTGTGGTGTTGG - Intergenic
1095556711 12:43514535-43514557 ATAGAGTCTCACTCTGTCACCGG - Intronic
1096211189 12:49767143-49767165 ATGGAGTCTCACTCTGGCCCAGG + Intergenic
1096221317 12:49829815-49829837 ATGGAGTCTCACTCTGTCCCAGG + Intergenic
1096284625 12:50287687-50287709 ACGGAGTCTCACTCTGTCTCAGG - Intergenic
1096315171 12:50558170-50558192 ACGGGGTCTCACTATGTTGCTGG - Intronic
1097203717 12:57302249-57302271 ATGGAGTCTTACTCTGTAGCCGG - Intronic
1097673529 12:62570755-62570777 ACAGAGTCTCACTCTGTTGCCGG + Intronic
1098263162 12:68692282-68692304 CAAGAGTCTCACTCTGTTGCCGG + Intronic
1098473730 12:70874895-70874917 ATGGAGTCTCACTCTGTCACTGG - Intronic
1098548850 12:71740745-71740767 ATGGAGCCTCGCTCTGTCGCCGG - Intergenic
1099201333 12:79680922-79680944 ATGGGGTCTCAGTATGTTGCTGG - Intronic
1099213385 12:79821725-79821747 ATGGGGTCTCACTCTGTCCCAGG - Intronic
1099440884 12:82698395-82698417 TTTGAGTCTCACTCTGTGGTTGG - Intronic
1099984929 12:89651293-89651315 ACAGGGTCTCACTCTTTTGTGGG + Intronic
1100087587 12:90930457-90930479 ATGGAATCTCACTGTGGTTTTGG - Intronic
1100115396 12:91297233-91297255 ACGGAGTCTCACTCTGTCACCGG + Intergenic
1100260111 12:92925242-92925264 ACAGGGTCTCACTCTGTTGCTGG + Intronic
1100664733 12:96738633-96738655 ACGGGGTCTCACTCTGTCGCCGG + Intronic
1101158260 12:101947889-101947911 ATGAAGTCTCACTCTGTTGCTGG - Intronic
1101597011 12:106176958-106176980 ACAGAGTCTCACTCTGTTGCTGG + Intergenic
1102012996 12:109630536-109630558 ATGGGGTCTCACTGTGTTGCTGG + Intergenic
1102069319 12:110004132-110004154 ATGGAGTCTCATACTGTTGCCGG - Intronic
1102282311 12:111628009-111628031 ATGGGGTCTCACTATGTTGCTGG + Intergenic
1102312939 12:111861352-111861374 ATGGAGTCTCACTCTGTCACAGG + Intronic
1102339697 12:112111907-112111929 ATGGAGTCTCACTCTGTTGCAGG - Intergenic
1102628869 12:114259100-114259122 ATGGAGCCTCACTCTGTCCCTGG - Intergenic
1103311681 12:120014664-120014686 ATGGAGTCTCGCTCTGTCACAGG - Intronic
1103361238 12:120355377-120355399 ACGGAGTCTCACTCTTTCGCAGG - Intronic
1103444229 12:120983567-120983589 ATGGAGTCTCACTCTGTTGCTGG + Intronic
1103622096 12:122193354-122193376 ACGGAGTCTCGCTCTGTCGCCGG - Intronic
1103654231 12:122457518-122457540 ATGAAGTCTTGCTCTGTTGCTGG - Intergenic
1103772452 12:123338657-123338679 ATGGAGTCTCGCTCTGTCACAGG - Intronic
1103777612 12:123377975-123377997 ATGAAGTCTCACTCTGTCACCGG - Intergenic
1103821611 12:123703208-123703230 ATGGAGTCTCACTTTGTTGCTGG + Intronic
1104941718 12:132398353-132398375 ATGGCCTCTCACCCTGGTGTGGG + Intergenic
1105030102 12:132876148-132876170 ATGGAGTTTCACTGTGTTGCAGG - Intronic
1105351849 13:19622981-19623003 ACGGAGTCTCGCTCTGTCCTAGG - Intergenic
1105726693 13:23169652-23169674 ATGGAGTCTCTCTCTGTTGCTGG - Intergenic
1105896702 13:24722463-24722485 ATGGAGTCTCACTCTGTCGCAGG - Intergenic
1106007909 13:25788253-25788275 AGGAAGGCTCACTCTGTGGTCGG - Intronic
1106405744 13:29471311-29471333 ATGGAGTCTCGCTCTGTTGCTGG - Intronic
1106504814 13:30361651-30361673 ACGGAGTCTCACTCTGTTGCCGG - Intergenic
1106539208 13:30674920-30674942 ATGGAGTCTTGCCCTGTTGCTGG + Intergenic
1106624956 13:31410914-31410936 ATGGAGTCTCGCTCTGTCGCCGG + Intergenic
1107584588 13:41831225-41831247 ATGTAGGCTAACTCTATTGTGGG - Intronic
1107645767 13:42492973-42492995 ATGGGGTCTTACTGTGTTGCTGG - Intergenic
1108084157 13:46767560-46767582 ATAGAGTCTCAGTCCGTTGCTGG + Intergenic
1108366877 13:49724619-49724641 ATAGGGTCTCACTCTGTCGCCGG + Intronic
1108444948 13:50498750-50498772 ATGGAGTCTCGCTCTGTTGCTGG - Intronic
1108834054 13:54518384-54518406 ATGGAGTCTCACTCTGTCCCAGG - Intergenic
1108963798 13:56271260-56271282 ATGGAGTCTCACTCTGTCCCAGG - Intergenic
1109108798 13:58290009-58290031 ACGGATTCTCACTCTGTTGCGGG + Intergenic
1109532204 13:63664632-63664654 CTGGACTCTCATTTTGTTGTGGG + Intergenic
1109850158 13:68052936-68052958 ACGGAGTCTCACACTATCGTCGG + Intergenic
1110058078 13:71003269-71003291 ATGGGGTTTCACTATGTTGTTGG - Intergenic
1110460095 13:75735484-75735506 ATGGAGTCTCACTCTGTCGCTGG + Intronic
1110857331 13:80311005-80311027 AAGGAGTCTTGCTCTGTTGCCGG + Intergenic
1111691497 13:91568776-91568798 AAGGAGTCTCTCTCTGTCGCTGG + Intronic
1111750311 13:92321575-92321597 ATGGAGTCTCGCTCTGTCCCAGG - Intronic
1111924508 13:94448056-94448078 ATGGGGTCTCACTCTGTTGCTGG - Intronic
1111943443 13:94638269-94638291 ATGGAGTCTCATTGTGGTTTTGG + Intergenic
1112492679 13:99881450-99881472 ACAGGGTCTCACTCTGTTGCTGG + Intronic
1112524885 13:100135414-100135436 ACGGAGTCTCACTCTGTCACCGG - Intronic
1112754559 13:102616934-102616956 ACGGAGTCTCGCTCTGTTCCAGG + Intronic
1113143741 13:107184000-107184022 ACAGAGTCTCACTCTGTTGCCGG + Intronic
1113466334 13:110515989-110516011 ACAGAGTCTCGCTCTGTTGTGGG - Intergenic
1113693370 13:112327527-112327549 ACAGAGTCTCACTCTGATCTTGG - Intergenic
1113882078 13:113632750-113632772 ACGGAGTCTCGCTCTGTCGTGGG - Intronic
1114187071 14:20410845-20410867 ACGGAGTCTCACTCTATTGCTGG + Intronic
1115493643 14:33982339-33982361 ATGGAGACTAGCTCTGTTGCTGG + Intronic
1115564451 14:34613017-34613039 ATAGAGTCTCACTCTGTCACTGG - Intronic
1115654928 14:35434276-35434298 ACGAAGTCTCACTCTGTCGCTGG + Intergenic
1116669637 14:47824286-47824308 ACAGGGTCTCACTCTGTTGCAGG + Intergenic
1116851969 14:49917725-49917747 ATGGAGTCTCGCTCTGTGCCAGG - Intergenic
1116910745 14:50461047-50461069 ACAAAGTCTCACTCTGTTGCTGG + Intronic
1117322315 14:54635716-54635738 ATGGAGTCTTGCTCTGTCGCTGG - Intronic
1117387828 14:55233760-55233782 ATGAAGTCACAGTATGTTGTGGG + Intergenic
1118297471 14:64583786-64583808 ATGGAGTTTCACTCTTGTCTAGG - Intronic
1118648510 14:67865259-67865281 ATGGAGTCTTGCTCTGTTGCCGG + Intronic
1119242699 14:73074733-73074755 AGAGAGTCTCACTCTGTCGCTGG + Intronic
1119360091 14:74042068-74042090 ATGGGGTCTCATTATGTTGCTGG + Intronic
1119365447 14:74087388-74087410 ATGGAGTCTCGCTCTGTCCCAGG - Intronic
1119760830 14:77150597-77150619 ACGGAGTCTCTCTCTGCTGGAGG + Intronic
1120032555 14:79659007-79659029 CTGGAGTCTGACCCTGGTGTCGG + Intronic
1120272817 14:82336293-82336315 ACGGAGTCTCCCTCTGTCGCGGG + Intergenic
1120974687 14:90238175-90238197 ATGGAGTCTCACTCTGGCCCAGG - Intergenic
1121543121 14:94743322-94743344 ACGGAGTCTCACTCTGTCCCAGG - Intergenic
1122424406 14:101597341-101597363 ATGGAGCCTCACTCTGTTGCTGG + Intergenic
1122564368 14:102641574-102641596 ACAGGGTCTCACTCTGTTGTTGG - Intronic
1122564958 14:102647339-102647361 ATGGAGTCTCGCTCTTTCGCTGG + Intronic
1122715046 14:103691492-103691514 GTGGAGTCTCACTCTTGCGTAGG + Intergenic
1122737356 14:103850508-103850530 ACGGAGTCTCACTCTGTTGCCGG - Intergenic
1122752537 14:103948863-103948885 ATGGAGTCTCACTCTGTCACAGG - Intronic
1122758450 14:104001631-104001653 ACGGAGTCTCACTCTGTCGCTGG + Intronic
1124390626 15:29253470-29253492 ATGGAGTCTCACTCTGTCGCTGG + Intronic
1124908086 15:33891077-33891099 ACAGAGTCTCACTCTGTTGCTGG - Intronic
1125689178 15:41582654-41582676 ATGGAGTCTCACTCTTGTCCAGG - Exonic
1125707830 15:41755991-41756013 ATGGAGTCTCACTGTGTCTCAGG - Intronic
1125912544 15:43454178-43454200 GTGGAGTCTTGCTCTGTTGCTGG - Intronic
1126113635 15:45189416-45189438 ACGGAGTCTCACTCCGTCGCTGG + Intronic
1126138176 15:45412373-45412395 ACGGAGTCTCACTCTGTCCCAGG - Intronic
1126140921 15:45437964-45437986 GTGGAGTCTCACTCTGTCGCAGG - Intronic
1126220681 15:46209228-46209250 ATGGAGTCTTGCTCTGTCCTAGG + Intergenic
1126860485 15:52878100-52878122 ATCAAGTCTCATGCTGTTGTGGG + Intergenic
1126873502 15:53013560-53013582 ATGGAGTCTAAGTTTGTTGGGGG + Intergenic
1126980569 15:54238098-54238120 ACAGAATCTCACTCTGTTGCAGG + Intronic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1127379609 15:58419614-58419636 ACAGAGTCTCTCTCTGTTGCCGG + Intronic
1127476748 15:59340991-59341013 ATGGAGTCTCGCTCTGTCCCAGG - Intronic
1127667869 15:61166682-61166704 AGGGAGTCTCCCTCTGTTAGAGG + Intronic
1128507160 15:68281639-68281661 ACGGAGTCTCGCTCTGTCGCCGG + Intronic
1128999941 15:72323719-72323741 ATGCAATGTCACTCTGTTCTTGG + Intronic
1129197325 15:73976817-73976839 ATGGAGTCTCGCTCTGTTGCTGG + Intergenic
1129440058 15:75575014-75575036 ACGGAGTCTCGCTCTGTCGGCGG + Intronic
1129626416 15:77204878-77204900 ACAGAGTCTCACTCTGTTGCCGG - Intronic
1129799119 15:78400247-78400269 ATGGGGTCTCGCTGTGTTGTGGG - Intergenic
1129995077 15:79997477-79997499 ATGGAGTCTCGCTCTGTTGCCGG - Intergenic
1130378028 15:83347648-83347670 ACAGAGTCTCACTTTGTTGCCGG + Intergenic
1130772872 15:86942502-86942524 ATGGACTCTCACTCAGTTCCAGG + Intronic
1131505429 15:93013903-93013925 ACAGAGTCTCACTCTGTCGCAGG - Intronic
1131589515 15:93732881-93732903 ATGGGGTCTCACTATGTTGCTGG + Intergenic
1131630455 15:94170940-94170962 ATGGAGTCTCGCTCTGTTGCCGG - Intergenic
1131766522 15:95681428-95681450 ATGGAGTCTCGCTCTGTCACTGG - Intergenic
1131890683 15:96968780-96968802 ACGGAGTCTCACTCTGTCACAGG - Intergenic
1132202707 15:99965815-99965837 ATGGAGTCTCACTCTGTCCCAGG + Intergenic
1132503339 16:294435-294457 ATGGAGTCTCACTCTTGCCTAGG - Intronic
1132611757 16:820379-820401 ATGGAGTCTCACTCTGTCACCGG + Intergenic
1132825156 16:1901054-1901076 ATGGGGTTTCACCATGTTGTTGG - Intergenic
1133957198 16:10454383-10454405 ATGGAGTCTCACACTGTCACTGG - Intronic
1133962909 16:10510171-10510193 ATGGAGTCTCGCTATATTGCTGG - Intergenic
1134866344 16:17610734-17610756 ACAGAGTCTCACTCTGTCATCGG + Intergenic
1135010330 16:18871747-18871769 ATGGTGTTTCACCATGTTGTTGG - Intronic
1135021047 16:18963246-18963268 ATGGGGTCTCACTATGTTGCTGG + Intergenic
1135317183 16:21458910-21458932 ATGGTGTTTCACCATGTTGTTGG - Intergenic
1135441708 16:22479970-22479992 ATGGTGTTTCACCATGTTGTTGG + Intronic
1135592418 16:23713731-23713753 ATGGGGTCTCACTATGTTGCTGG - Intergenic
1135627829 16:24011538-24011560 ACAGGATCTCACTCTGTTGTTGG + Intronic
1135635174 16:24069549-24069571 ATGGGGTCTCACTATGTTGCAGG - Intronic
1135863086 16:26075166-26075188 ACAGAGTCTCACTCTGTTGCCGG - Intronic
1135866946 16:26111990-26112012 GTGGAGTCTCACTCTGTCGCCGG - Intronic
1136015356 16:27395978-27396000 ATGGAGTCTCACTCTGGTGCAGG - Intergenic
1136313997 16:29439065-29439087 ATGGTGTTTCACCATGTTGTTGG - Intergenic
1136327436 16:29540830-29540852 ATGGTGTTTCACCATGTTGTTGG - Intergenic
1136341396 16:29646183-29646205 ATAGAGTCTCACTCTGTCCCAGG + Intergenic
1136341456 16:29646596-29646618 ATGGGGTCTCACTCTGTCCCAGG + Intergenic
1136442126 16:30280828-30280850 ATGGTGTTTCACCATGTTGTTGG - Intergenic
1136911748 16:34149695-34149717 ACGGAGTCTCACTCTGGTTGAGG + Intergenic
1138264879 16:55653245-55653267 GAGGAGTTTGACTCTGTTGTAGG + Intergenic
1138374083 16:56550650-56550672 ACGGAGTCTCGCTCTGTTACTGG - Intergenic
1138479330 16:57291533-57291555 ATGGAGTCTCCCTCTGTCGCCGG + Intergenic
1139485398 16:67253546-67253568 ATGGAGTCTCACTCTTGTCCAGG + Intronic
1139688006 16:68619279-68619301 ATGGGGTCTCACTATGTTGCCGG - Intergenic
1139716084 16:68814208-68814230 ACGAAGTCTCACTCTGTTGCCGG - Intronic
1139888933 16:70234558-70234580 ATGGTGTTTCACCATGTTGTTGG - Intergenic
1139929349 16:70512950-70512972 ACGGAGTCTCACTCTTTTGCCGG - Intronic
1140016746 16:71194384-71194406 ACGGAGTCTCACTCTGTTGCTGG - Intronic
1140407631 16:74721579-74721601 ATGGAGACTCACACAGCTGTGGG + Intronic
1140773963 16:78232864-78232886 ATGGAGTCTCGCTCTGTCACCGG + Intronic
1141516068 16:84545907-84545929 ATGGAGTCTCGCTCTGTCCCAGG - Intronic
1142797408 17:2319370-2319392 ATGGACTCTTTCTATGTTGTGGG + Intronic
1142815577 17:2422408-2422430 ATGGAATCTCACTCTGTCACTGG + Intronic
1142838632 17:2609197-2609219 ATGGGGTCTCACTCTGGTGCTGG + Intronic
1142865343 17:2787443-2787465 ATGGGGTCTTACTATGTTGCTGG + Intronic
1142983187 17:3683149-3683171 GTGGAGTCTCCCTCTGCTGGAGG - Intronic
1143807505 17:9441462-9441484 ATGGAGTCTCGCTCTGTGCCAGG - Intronic
1143821738 17:9569920-9569942 ATGGAGTCTCACAGTGTCGCCGG - Intronic
1143838630 17:9713112-9713134 ACAGAGTCTCACTCTGTCGCAGG + Intronic
1144027801 17:11293908-11293930 ATGGAGTCTCACTCTCTCATCGG + Intronic
1144216555 17:13060431-13060453 ACTGAGTCTCACTCTGTCGCCGG + Intergenic
1144410671 17:14997844-14997866 ACAGAGTTTCACTCTGTGGTAGG + Intergenic
1144487452 17:15678899-15678921 ACGGAGTCTCACTCTGTTGCTGG + Intronic
1144488784 17:15689589-15689611 ATGGAGTCTCGCTCTGAAGATGG + Intergenic
1144687994 17:17238712-17238734 ATGGAGTCTCGCTCTGTGCCAGG - Intergenic
1144912234 17:18692711-18692733 ATGGAGTCTCGCTCTGAAGATGG - Intergenic
1144913583 17:18703405-18703427 ACAGAGTCTCACTCTGTTGCTGG - Intronic
1145836443 17:27957560-27957582 ACAGAGTCTCACTCTGTTCCAGG + Intergenic
1146119562 17:30180024-30180046 ACGGGGTCTCACTATGTTGCCGG + Intronic
1146242958 17:31247168-31247190 ATGGAGTCTTGCTCTGTTGCCGG - Intronic
1146685693 17:34840153-34840175 ACAGAGTCTCACTCTGTCGCTGG - Intergenic
1147031335 17:37639715-37639737 ACTGAGTCTCACTCTGTGGCTGG - Intronic
1147747710 17:42705543-42705565 ATGGAATCTCACTCTGTCCCAGG + Intronic
1147866654 17:43557480-43557502 GTGAAGTCTCACTCTATTGCCGG + Intronic
1147917034 17:43894390-43894412 ATGGAATCTCACTCTGTCACTGG - Intronic
1148066803 17:44877002-44877024 ATGGGGTCTCGCTCTGTTGCCGG - Intronic
1148544892 17:48510209-48510231 ATGGAGTCTCACTCTTGTCCAGG - Intergenic
1148910154 17:50938024-50938046 ATGGGATCTCACTCTGTTGCCGG - Intergenic
1149026311 17:52031173-52031195 ATGGAGTCTCACTCTCGTGCAGG + Intronic
1149026752 17:52035935-52035957 ATGGACTCTCAGGCTGTAGTTGG + Intronic
1149037063 17:52146645-52146667 ACGGAGTCTCGCTCTGTCGGTGG - Intronic
1149039939 17:52176056-52176078 ATGGAATCTCACTCTGTTGCTGG + Intergenic
1149286871 17:55174996-55175018 ATGGAGTCTCGCTCTGTCGCAGG - Intergenic
1149702855 17:58669758-58669780 ATGAAGTCTCAAGCTGTTGCTGG - Intronic
1149817201 17:59737009-59737031 ATGGAGTCTTACTCTGTTGCTGG - Intronic
1150237425 17:63604310-63604332 ATGGAGTCTCACTCTGTTGCTGG - Intronic
1150247573 17:63687908-63687930 ATGGAGTCTCGCTCTGCTGCCGG - Intronic
1150481905 17:65517244-65517266 ATGGAGTCTCGCTCTGTTGCTGG + Intergenic
1150589890 17:66553003-66553025 ACAGAGTCTCACTCTGTTGCTGG + Intronic
1150706224 17:67489767-67489789 ATGGAGTCTCGCTCTGTCCCAGG + Intronic
1150706479 17:67491647-67491669 ACGGAGTCTTACTATGTTGCTGG - Intronic
1150735390 17:67732596-67732618 ATGGAGTCTTACTCTGTTGCAGG + Intronic
1150943610 17:69720446-69720468 ATTCATTCTCACACTGTTGTAGG - Intergenic
1151186496 17:72368284-72368306 AGACAGTCTCACTCTGTTGCCGG - Intergenic
1151209387 17:72533031-72533053 ATGGAGTCTCGCTCTGTCCCAGG - Intergenic
1151372628 17:73658135-73658157 ACAGAGTCTCCCTCTGTTGCCGG + Intergenic
1151631609 17:75314814-75314836 TTGGAGTCTGGCTCTGTTGCTGG - Intergenic
1151844511 17:76642897-76642919 ACGGAGTCTCACTCTGCTGCCGG - Intronic
1152679910 17:81661833-81661855 ACAGAGTCTCACTCTGTCGCAGG - Intronic
1152819777 17:82431349-82431371 GTGGGGTCTCACTATGTTGCTGG + Intronic
1153027309 18:683476-683498 AGGGGGTCTCACTCAGCTGTTGG - Intronic
1153225421 18:2896197-2896219 ATGGAGTCTCCCTTTGTTGCTGG + Intronic
1153533486 18:6074615-6074637 ATGAAGCCTGACTATGTTGTTGG + Intronic
1153664569 18:7357380-7357402 ATGGAGTCTCACACTGTCGCCGG - Intergenic
1154168941 18:12036909-12036931 ATGGAGTCTCGCTCTGCTCTTGG + Intergenic
1154212027 18:12387635-12387657 ACGGAGTCTCGCTCTGTCGCTGG - Intergenic
1154955117 18:21245906-21245928 ATGGGGTTTCACTGTGTTGCAGG + Intronic
1156408163 18:36802650-36802672 ATGGAGTCTTGCTCTGTTGCTGG + Intronic
1157363646 18:47043201-47043223 ACGGAGTCTCGCTCTGTCGCCGG - Intronic
1157942320 18:51942768-51942790 ATGGAGTCTCACACTGTCACTGG + Intergenic
1157997712 18:52578954-52578976 ACGGAGTCTCACTCTGTTGCTGG - Intronic
1158218808 18:55128904-55128926 GTGGAGTCCCAGTCTGTTGATGG + Intergenic
1159264582 18:66063845-66063867 ATGGAGACTTACTCTACTGTAGG + Intergenic
1159614706 18:70568079-70568101 ATGGAATCTCACTCTGTACCAGG - Intergenic
1160136796 18:76278814-76278836 ATGGAGTTTCACTCCATTCTGGG - Intergenic
1160211520 18:76884375-76884397 ATGGAGTCTCACACTGTCGCCGG - Intronic
1161197122 19:2993185-2993207 ACGGAGTCTCGCTCTGTTGCCGG - Intronic
1161204204 19:3032262-3032284 ACGGAGTCTCATTCTGTCGCTGG + Intronic
1161497749 19:4596906-4596928 ACGGAGTCTCACTCTGTCTCAGG + Intergenic
1161528953 19:4775373-4775395 TTTGAGTCTTACTATGTTGTGGG + Intergenic
1162082666 19:8227884-8227906 ACGGAGTCTCACTATGTTGCTGG + Intronic
1162388595 19:10375899-10375921 ATGGAGTCTCGCTCTGTCCCAGG - Intronic
1162471581 19:10875351-10875373 ATGGAGTCTCGCCGTGTTATAGG + Intronic
1162617363 19:11813190-11813212 ATGGAGTCTCACTGTGTCTCAGG + Intergenic
1162653306 19:12108229-12108251 ACGGAGTCTCACTCTGTTGCCGG + Intronic
1162679793 19:12332368-12332390 ACGGAGTCTCTCTCTGTCGCCGG + Intronic
1162689750 19:12419538-12419560 ATGGAGTCTTACTGTGTTGCTGG + Intronic
1163001654 19:14372023-14372045 ATGGAGTCTCACTCTTGTCCAGG - Intergenic
1163067985 19:14813529-14813551 ACGGAGTCTCACTCTGTCGCTGG - Intronic
1163069712 19:14829226-14829248 ACAGAGTCTCGCTCTGTTGCCGG + Intronic
1163134031 19:15296227-15296249 ATGGAGTCTCGCTCTGTCGCCGG - Intronic
1163447586 19:17356283-17356305 ATGGAGTCTCACTCTGTCGCTGG - Intronic
1163586206 19:18165337-18165359 ACGGAGTCTCACTCTGTCCCAGG - Intronic
1163705709 19:18811795-18811817 ATGGAGTCTCACTCTGGCCCAGG + Intergenic
1163707912 19:18827085-18827107 ACAGGGTCTCACTCTATTGTGGG - Intergenic
1163789549 19:19298470-19298492 ATGGAGTCTCACTCTGGTCCAGG - Intronic
1163858635 19:19727343-19727365 ATGGGGTCTCCCTATGTTGCTGG + Intronic
1163888559 19:19990881-19990903 GTGGTGTCTCTCTCTGATGTTGG + Intergenic
1164072283 19:21779314-21779336 ACGGAGTTTCACCATGTTGTTGG - Intergenic
1165417502 19:35703785-35703807 ACGGGGTCTCCCTCTGTTGCCGG - Intergenic
1165764000 19:38338901-38338923 ATGGAGTCTCACTCTGTTGTTGG + Intronic
1165880387 19:39038529-39038551 ATGGAGTCTCGCTCTGTTGCCGG + Intergenic
1166549167 19:43653788-43653810 ATGGGGTCTCACTATGTTGCCGG - Intronic
1166730881 19:45058408-45058430 ATGGAGTCTTGCTCTGTTACCGG + Intronic
1167079231 19:47267869-47267891 ACGGAGTCTCGCACTGTTGCCGG + Intronic
1167167660 19:47810229-47810251 ATGGAGTCTCACTCTGTCGCCGG - Intronic
1167210611 19:48131959-48131981 ATGGAGTCTCACTCTTATCGTGG + Intronic
1167714611 19:51134178-51134200 AAGGAGTCTAGCTCTGTTGCCGG + Intronic
1167856035 19:52240746-52240768 ACAGAGTCTCACTCTGTTGCCGG + Intergenic
1167869765 19:52358206-52358228 ACGGAGTCCCACTCTGTCGCCGG + Intronic
1167895942 19:52581096-52581118 ATGGAGTCTCACTCTGTCACTGG - Intronic
1168043932 19:53780472-53780494 ACGGAGTTTCTCTCTGTTGCCGG - Intergenic
1168162378 19:54520083-54520105 ATGGAGTCTCTCTCTATTGCAGG - Intergenic
1168561340 19:57386245-57386267 ACGGAGTCTCACTCTGTCGCTGG - Intronic
1168639366 19:58020499-58020521 ATGGGGTTTCACTATGTTGTTGG - Intergenic
1168657853 19:58144410-58144432 ACGGAGTCTCGCTCTGTAGCTGG + Intronic
926059339 2:9795406-9795428 ATTCAGTCTCACAATGTTGTGGG + Intergenic
926176307 2:10595338-10595360 ACAGAGTCTCACTCTGTTACTGG + Intronic
926247314 2:11131011-11131033 ACGGAGTCTCACTCTGTTGCTGG - Intergenic
927241462 2:20923153-20923175 ATGGAGACTGACTGTCTTGTTGG + Intergenic
927346679 2:22052151-22052173 ATGCAGCTCCACTCTGTTGTCGG + Intergenic
927587996 2:24327319-24327341 ATGGAGTCTCACTCTTTCCCAGG + Intronic
927821719 2:26271943-26271965 ATGGAGTCTCACTCTGTCCAAGG + Intronic
927898642 2:26802689-26802711 ACGGAGTCTTGCTCTGTTGCAGG + Intergenic
927902719 2:26832465-26832487 ATGGAGTCTTGCTCTGTTACAGG - Intergenic
927915845 2:26935666-26935688 ATGGAGTCTTGCTCTGTCGCCGG - Intronic
927969208 2:27293996-27294018 ACAGAGTCTCACTCTGTCGTCGG - Intronic
927995397 2:27482005-27482027 ATGGAGTCTCACTCTGTCGCCGG + Intronic
928249410 2:29661932-29661954 ATGGAATCTCACTCTGTCGCTGG + Intronic
928505401 2:31946815-31946837 ATGGAGTCTCACTCTCTTCAGGG - Intronic
928873534 2:36010489-36010511 ACAGAGTCTCACTCTGTCTTCGG - Intergenic
928933978 2:36655359-36655381 ATGGAGTCTCGCTCTGTCACTGG - Intergenic
929144956 2:38698568-38698590 ATGGGAGCACACTCTGTTGTTGG + Intronic
929190481 2:39135035-39135057 ACGGAGTCTCCCTCTGTTCCAGG - Intergenic
929849788 2:45575727-45575749 ATGGAGTCTCACTGTCTTCCAGG + Intronic
930102165 2:47611651-47611673 ATGGAGTCTCACTCTCTTCCAGG - Intergenic
930133642 2:47878789-47878811 ATGGGGTTTCACCATGTTGTTGG - Intronic
931012250 2:57930067-57930089 CTGGTGTCTCACTAAGTTGTGGG + Intronic
931342809 2:61418102-61418124 ATGGAGTCTCACTCTATTCCAGG + Intronic
931777375 2:65552207-65552229 ACAGAGTCTCACTCTGCTGCCGG - Intergenic
932684994 2:73861541-73861563 ACAGAGTCTCGCTCTGTTGCCGG + Intronic
933066945 2:77809147-77809169 ATGGAGTCTCATTCTGTGCTCGG - Intergenic
933507869 2:83202117-83202139 ACAGAGTCTCACTCTGTTGCTGG + Intergenic
933672746 2:85024447-85024469 ATAGAGTCTCACTCTGTCGCCGG - Intronic
933734259 2:85482527-85482549 GCAGAGTCTCACTCTGTTGCTGG - Intergenic
933757434 2:85650866-85650888 ATGGAGTCTCACTCTTGTCCAGG + Intergenic
934098747 2:88631155-88631177 ATGCAGTCTCTCTCTGTTAAGGG - Intergenic
934175254 2:89573483-89573505 ATGGAGTCTCACACTGTCACCGG + Intergenic
934285570 2:91647842-91647864 ATGGAGTCTCACACTGTCACCGG + Intergenic
935572524 2:104676903-104676925 ATGGAGTCTCACTCTGTTTGGGG - Intergenic
935968845 2:108510432-108510454 ACGGAGTCTCACTCTGTCACCGG - Intergenic
936007367 2:108902182-108902204 ACGGAGTCTCACTCTGTCCCAGG - Intronic
936601767 2:113903558-113903580 ACGGAGTCTCGCTCCGTTGCTGG + Intronic
936689227 2:114866085-114866107 ACAGAGTCTCACTCTGTTACTGG - Intronic
936747860 2:115601697-115601719 ACGGAGTCTTTCTCTGTTGCCGG + Intronic
936975729 2:118219948-118219970 ATGGTGCCTCACTATGTTCTTGG + Intergenic
937110666 2:119364881-119364903 ATGGGGTCTTGCTATGTTGTTGG - Intronic
937138193 2:119573668-119573690 ATGAGGTCTCGCTCTGTTGCAGG - Intronic
937509539 2:122578422-122578444 ATGGAGTCTTGCTTCGTTGTTGG - Intergenic
937969390 2:127537623-127537645 ATGGAGTCTCCCCATGTTGTGGG - Intronic
937995234 2:127689559-127689581 CTGGAGTCTCACTCTGGCCTAGG + Intergenic
938247406 2:129789462-129789484 ATGGGGTCTCACTCTGTCACTGG + Intergenic
938604720 2:132880602-132880624 ATGGAGTCTCACTATCTTCCAGG - Intronic
938930739 2:136084463-136084485 ATGGAGTCTCACTCTGTCACTGG + Intergenic
939061313 2:137425238-137425260 ACGGAGTCTTGCTCTGTTGCTGG + Intronic
939145450 2:138409151-138409173 ATGGAGTCTCACTCTGTCGCTGG - Intergenic
939337403 2:140847739-140847761 ATGCAGTCTCACTCTGTCCCAGG - Intronic
939615728 2:144360472-144360494 ATGGAGTCTCGCTCTGTTACCGG + Intergenic
939795477 2:146639349-146639371 ACGGAGTCTTGCTCTGTTGCTGG - Intergenic
940277600 2:151955713-151955735 ATGGGGTCTCACTATGTTGCCGG - Intronic
940421610 2:153485705-153485727 ATGGGGTCTCGCTGTGTTGCTGG - Intergenic
940631836 2:156250102-156250124 ATGGAGTCTCACTCTCGCCTAGG - Intergenic
940914725 2:159241734-159241756 ATGGAGTCTCACATTGTCGCCGG + Intronic
941955801 2:171202987-171203009 ATGGATTCTCTCTCAGTGGTGGG + Intronic
942589346 2:177524716-177524738 ATGGATTCTCACTTTGCAGTAGG - Intronic
942753183 2:179310970-179310992 ATGGTATATCATTCTGTTGTCGG + Intergenic
942833716 2:180266720-180266742 ACGGAGTCTCGCTCTGTCGCCGG - Intergenic
942981721 2:182091945-182091967 ATTGAGTGTCACTATGTTCTAGG - Intronic
943463206 2:188195598-188195620 ACAGAATCTCACTCTGTTGCAGG + Intergenic
943645507 2:190405345-190405367 GTGGAGTCTCACTATGTTTTAGG - Intergenic
945659571 2:212668880-212668902 ATGGAGTCTCCCTCTGTCCCAGG - Intergenic
946074628 2:217063825-217063847 ATGTAGTCTGACCCTATTGTTGG + Intergenic
946262782 2:218509553-218509575 ATGGGATCTCACTATGTTGCAGG - Intronic
946618386 2:221533962-221533984 ATGGAGTGTCACGCAGATGTGGG - Intronic
946667914 2:222070479-222070501 AAGGAGTCTCACTCTGTCAGTGG + Intergenic
946752503 2:222906637-222906659 ATGGAATCTTGCTCTGTTGCTGG + Intronic
946962621 2:225000948-225000970 ATGGAGTCTCACTCTTGCCTAGG - Intronic
947192187 2:227518448-227518470 ATGCAGTCACACTTTGTTTTCGG + Intronic
947416764 2:229904390-229904412 ATGGAGTCTCACTCTTTCCCAGG - Intronic
947679306 2:232015394-232015416 AGGGAGTTTCAGTCTCTTGTTGG + Intronic
947871748 2:233442628-233442650 GTGGAGTCTTGCTCTGTTGCTGG + Intronic
1168822075 20:781311-781333 ACAGAGTCTCGCTCTGTCGTGGG + Intergenic
1169096963 20:2909554-2909576 ATGGAGTCTCACTCTCATCCAGG - Intronic
1169229484 20:3877989-3878011 ACGGAGTCTCACACTGTTGCCGG - Intergenic
1169321494 20:4636540-4636562 AAAGAGTCTCACTCTGTTGCAGG - Intergenic
1169839947 20:9924185-9924207 ACGGAGTCTCACTCTGTCACTGG - Intergenic
1172087858 20:32402248-32402270 ATGGAGTCTTGCTTTGTGGTTGG + Intronic
1172474046 20:35224210-35224232 ACAGAGTCTCACTCTGTTACTGG + Intergenic
1173057981 20:39635060-39635082 ACGGAGTCTCGCTCTGTGGCCGG + Intergenic
1173266972 20:41492889-41492911 ATGGAGTCTTGGTCTGTTGCTGG - Intronic
1173674862 20:44824920-44824942 ATGGAGCCTCACTGTGTCGCAGG + Intergenic
1173894928 20:46543516-46543538 ATGGGGTTTCACCATGTTGTTGG + Intronic
1174161872 20:48556861-48556883 ATAGAGTCTGACCCTGTTCTAGG - Intergenic
1174191071 20:48741030-48741052 ACGGAGTCTCACACTGTTGCAGG + Intronic
1174244083 20:49163165-49163187 ATGGAGTCTCGCTCTGTCGCCGG - Intronic
1174807255 20:53615440-53615462 ATAGGGTTTCACTATGTTGTTGG + Intergenic
1174815953 20:53687057-53687079 ATGGAGTTTCACCATGTTGGAGG - Intergenic
1174872633 20:54197465-54197487 ATGAAATCTCATTCTGTTATTGG + Intergenic
1176054871 20:63139700-63139722 ACAGAGTCTCTCTCTGTCGTAGG - Intergenic
1176158804 20:63638031-63638053 ATGGAGTCTCACTGTCTTCCAGG + Intergenic
1176174773 20:63715263-63715285 ACAGAGTCTCACTCTGTCGCCGG + Intronic
1176186895 20:63785205-63785227 TTTGAGTCTCGCTCTGTTGCCGG - Intronic
1176914839 21:14612207-14612229 ACGGAGTCTCACTCTGTTGCCGG - Intronic
1177536149 21:22431153-22431175 ATGGAGTCTCATTCTGTCAATGG + Intergenic
1178116925 21:29427261-29427283 ATGGAGTCTTACTCTGTGGCTGG + Intronic
1178155404 21:29847562-29847584 ACAGAGTCTCACCCTGTTGCTGG - Intronic
1178858199 21:36267647-36267669 ATGGAGTCTTGCTCTGTTATTGG + Intronic
1178878534 21:36430717-36430739 ATGGGGTTTCACTGTGTTGCTGG + Intergenic
1179590119 21:42402547-42402569 CTGGAGTCTCACTCTGTCCCAGG + Intergenic
1179812226 21:43879322-43879344 ATAGAGTCTCACTCTGTTGTAGG - Intronic
1179878880 21:44285361-44285383 ATGGAGGCTCAGTCTGATGCAGG - Intergenic
1180166178 21:46031108-46031130 ACAGAGTCTCACTCTGTGGCTGG + Intergenic
1180629342 22:17216733-17216755 GTGGAGTCTTGCTCTGTTGCCGG - Intronic
1180757711 22:18174248-18174270 ACGGAGTCTCGCTCTGTTGCCGG + Intronic
1181074062 22:20363209-20363231 ACGGAGTCTCGCTCTGTTGCCGG - Intronic
1181302241 22:21889066-21889088 ACAGAGTTTCACTCTGTTGCCGG + Intergenic
1181385441 22:22541916-22541938 ACGGAGTCTCGCTCTGTCGCAGG - Intergenic
1181945865 22:26517195-26517217 ATGGAGTCTCGCTCTGTCACCGG + Intergenic
1182019889 22:27072796-27072818 TTGCAGTCTCACTCTGCTATGGG - Intergenic
1182793760 22:32975348-32975370 GCGGAGTCTCACTCTGTCGCTGG - Intronic
1182872992 22:33664832-33664854 ATGGAGTCTCGCTCTGTCACCGG - Intronic
1182944120 22:34306033-34306055 ATGGGGTCTCACTCTGTCACCGG - Intergenic
1182946527 22:34328013-34328035 ATGAAGTCTCACTCTGTTCCTGG + Intergenic
1183528020 22:38335787-38335809 ACGGAGGCTCACTCTGTTGCTGG - Intronic
1183572526 22:38664445-38664467 ATGGAGTCTCCCTCTGTCATCGG - Intronic
1183851718 22:40595142-40595164 AAGGAGTCTCGCTCTGTCGCCGG + Intronic
1183945276 22:41322211-41322233 ATGGAGTCTCACTCTTGTCCAGG + Intronic
1184079203 22:42206382-42206404 ACAGAATCTCACTTTGTTGTGGG - Intronic
1184375630 22:44110627-44110649 ATGGAGTCTTGCTCTGTTGCTGG + Intronic
1185323594 22:50214739-50214761 ACGGAGTCTTGCTCTGTTGCCGG - Intronic
949106566 3:206532-206554 ATGGAGTCTTGCTGTGTTGCTGG - Intronic
949752994 3:7375833-7375855 CTGGAGACTCACTCTGGTTTGGG - Intronic
949983665 3:9521423-9521445 ACGGAGTCTCACTCTGCTGCTGG + Intronic
949984824 3:9532527-9532549 ATGGAGTCTCACTCTCTTTCTGG + Intronic
950342791 3:12262252-12262274 ACGGAGTCTCACTCTGTCCCAGG - Intergenic
951533967 3:23724933-23724955 AGGGGGTCTCACTCTGTTGAGGG + Intergenic
951737789 3:25886894-25886916 AGAGAGTCTCACTCTGTCGCAGG - Intergenic
952025430 3:29074993-29075015 ATGGAGTCTCGCTCTCTGGAGGG - Intergenic
952270152 3:31822886-31822908 TGGGGGTCTCACTCTGTTGGAGG - Intronic
952397669 3:32935199-32935221 ATGGAGTCTTGCTCTGTCGCTGG - Intergenic
952851513 3:37733488-37733510 ACGGAGTCTCACTCTGTTCATGG - Intronic
953252336 3:41257440-41257462 ATGAGGTCTCACTATGTTGCTGG - Intronic
953926284 3:46984284-46984306 ACGGAGTCTCGCTCTGTCGCCGG - Intronic
954119997 3:48492125-48492147 ATGGAGTCTTGCTCTGTTCCCGG - Intronic
954268782 3:49491197-49491219 ATGGGGTCCCACTATGTTGCCGG + Intronic
954332759 3:49899597-49899619 ACGGAGTCTCACACTGTTGCTGG + Intronic
954353261 3:50063408-50063430 ATGGAGTTTCACCATGTTGCTGG - Intronic
954691080 3:52395960-52395982 ACGGAGTCTCACTCTGTCACCGG + Intronic
955388285 3:58498003-58498025 ATGGAGTCTCGCACTGTTGCAGG + Exonic
956177621 3:66488302-66488324 TTGAAGTCTGACTCTGTTTTTGG - Intronic
956325477 3:68047876-68047898 ATTGAGTCTCCCTCTCTCGTAGG - Intronic
956597641 3:70985560-70985582 ATTGTGTGACACTCTGTTGTCGG - Intronic
956660380 3:71591525-71591547 ATGAGGTCTCACTATGTTGCTGG - Intergenic
957724041 3:84041853-84041875 ACGGAGTCTCGCTCTGTCGCCGG + Intergenic
957818960 3:85344354-85344376 ATGGTGTCTCACTCTGTCGCTGG - Intronic
958674576 3:97251502-97251524 ACGGAGTCTCCCTCTGTCGTCGG - Intronic
958699099 3:97565993-97566015 ACGGTGTCTCGCTCTGTTGCCGG - Intronic
959007296 3:101034852-101034874 ATGGTGTCTCACTGTGGTTTCGG - Intergenic
959012856 3:101098586-101098608 ACGGAGTCTCACTCTGTCACAGG + Intergenic
959239858 3:103776407-103776429 ATGGAGTCTCGCCCTGTTGCTGG + Intergenic
959392592 3:105794938-105794960 ATGGAGTCTCACTCTGTCGCCGG + Intronic
959459626 3:106609046-106609068 ATGGAGTCTCACTCTTATCCAGG - Intergenic
959777308 3:110182333-110182355 ACGCAGTCTCACTCTGTTGCCGG + Intergenic
960527317 3:118724392-118724414 ATGGAGTCTCACACTGTCACAGG - Intergenic
962120064 3:132551972-132551994 ATGGAGTCTCACTCTGTTGCCGG + Intergenic
962773773 3:138639224-138639246 ACGGAGTCTCGCTCTGTTGCTGG + Intergenic
963703382 3:148655048-148655070 ATGGAGTCTCACTCTGTCACAGG + Intergenic
964406043 3:156350481-156350503 ACAGGGTCTCACTCTGTTGCTGG - Intronic
965526169 3:169720674-169720696 ATGGAATCTCACTGTGATTTTGG + Intergenic
965765851 3:172129159-172129181 ATGGAGTCTCACTATGTTGCTGG + Intronic
966795357 3:183708349-183708371 ATGGGGTTTCACCATGTTGTTGG + Intronic
966997341 3:185296044-185296066 CTGGAGTCTCACTGTGTTGCTGG - Intronic
967192597 3:186997729-186997751 ACAGAGTCTCACTCTGTCCTAGG - Intronic
967731653 3:192912481-192912503 ATGGGGTTTCACCATGTTGTTGG - Intronic
968384199 4:122049-122071 ATGGGGTTTCACCATGTTGTTGG - Intergenic
968630966 4:1651197-1651219 ATGGAGTCTCGCTCTGTCCCAGG - Intronic
968820675 4:2848187-2848209 ACGGAGTCTCACTCTGTCCCAGG - Intronic
970059319 4:12012819-12012841 ATGGGGTTTCACCGTGTTGTTGG + Intergenic
970125386 4:12803675-12803697 ACAGGATCTCACTCTGTTGTAGG - Intergenic
970316622 4:14834174-14834196 ATGAAGTCTCACTCTGTCAGTGG - Intergenic
970716001 4:18923750-18923772 ATGGAGTCTCTCTCTGTTGCTGG - Intergenic
971387403 4:26153922-26153944 AGGGAGTCTCACTCTGTCACCGG - Intergenic
972331308 4:38066899-38066921 ATGGAGTCTCGCTCTGTCGCCGG + Intronic
972519275 4:39838530-39838552 ATGGGATCTCACTATGTTGCCGG - Intronic
972808473 4:42555798-42555820 ACAGAGTCTCACTCTGTCGCTGG - Intronic
974209372 4:58749840-58749862 ATGGCGTCTCACTCTGTCGCAGG + Intergenic
974244135 4:59291401-59291423 ATGGAGTATGATTCTGTTGCAGG - Intergenic
974540065 4:63222128-63222150 ACGGAGTCTCACTCTGTCACCGG - Intergenic
975572223 4:75829588-75829610 ATAGAGTCTCACTCTGTCACTGG + Intergenic
975584231 4:75934338-75934360 ATGGAGTCTCACTCTGTCACTGG + Intronic
975817219 4:78230976-78230998 ACGGAGTCTCACACTGTTGCCGG + Intronic
976173030 4:82324221-82324243 AAGGAGTCTCAATGTCTTGTAGG + Intergenic
976186061 4:82443700-82443722 CTGGAGTCTCACTCTGTCCCAGG - Intronic
976434358 4:84999797-84999819 AGGGAGTCTCACCCTGTCGCTGG - Intergenic
976658502 4:87514162-87514184 ATGGAGTCTCACTCTATTGCTGG - Intronic
976712568 4:88087834-88087856 ACGGAGTCTCACTCTGTCTCAGG - Intergenic
976870427 4:89786595-89786617 ACAGAGTCTCACTCTGTCTTTGG - Intronic
978345172 4:107759408-107759430 ACGGAGTCTCGCTCTGTCGCTGG - Intergenic
978580982 4:110231120-110231142 ATGGAGTCTCGTTCTGTTGCCGG + Intergenic
979040117 4:115780015-115780037 ATGGGGTCTCACTCTGTCCCAGG + Intergenic
979080941 4:116340210-116340232 ATGGAGTGTTACTGTGTTGCTGG + Intergenic
979716879 4:123850767-123850789 ATGGAGTCTCTCTGTCATGTGGG + Intergenic
979794373 4:124828200-124828222 ATGGAGTTTCACTCTGTCACCGG - Intergenic
981017801 4:139992553-139992575 ATGGAGTCTCACTCTGTTGCCGG + Intronic
981042207 4:140233578-140233600 ACAGATTCTCACTCTGTTGCTGG - Intergenic
981159373 4:141479131-141479153 ATGGAGTCTCAATCTGTCACCGG + Intergenic
981855731 4:149289556-149289578 ACAGAGTCTCACTCTGTTGCTGG - Intergenic
981880586 4:149606232-149606254 AAGGAGTCTCTCTCTGTACTGGG - Intergenic
981918147 4:150057203-150057225 ATGTGGTCTCACTCTATTGCTGG - Intergenic
981986549 4:150863962-150863984 ACAGAGTCTCGCTCTGTTGCAGG + Intronic
982793665 4:159620942-159620964 ATGGAGTCTCGCTCTGTCGCCGG + Intergenic
983205031 4:164902737-164902759 ATGGTGTCTCTCTCTGCTGTCGG + Intergenic
983212274 4:164971075-164971097 ATAGAGTTTCACTCTGTCGCTGG - Intronic
983229935 4:165119327-165119349 ATGGAGTCTCACTCTGTTGCTGG + Intronic
983241141 4:165234638-165234660 ATGGAGTCTCGCTCTGTACCAGG + Intronic
983316156 4:166134843-166134865 ACGGAGTCTCACTCTGTAGCTGG + Intergenic
983390604 4:167125689-167125711 ACGGAGTCTCCCTCTGCTGCCGG - Intronic
983488852 4:168364094-168364116 ATGGAGTCTCTCTCTGTCACTGG - Intronic
983597900 4:169491111-169491133 ATGGAGTCTTCCTCTGTTGCTGG - Intronic
983605608 4:169579762-169579784 ATGGAGTCTTGCTCTGTCGCCGG - Intronic
984448126 4:179864236-179864258 ATGGATCCTCACATTGTTGTTGG + Intergenic
984705864 4:182846650-182846672 ATGGAGGCTAAATCTGTTCTTGG + Intergenic
984884229 4:184435999-184436021 ACAGAGTCTCGCTCTGTCGTTGG + Intronic
984996805 4:185440972-185440994 ATGGAGTCTCACTCTTTGCCCGG + Intronic
985105298 4:186493594-186493616 ACGAGGTCTCACTCTGTTGCAGG + Intronic
985201629 4:187490182-187490204 ATGGAGTCTCACTCTCTCCTAGG - Intergenic
985342295 4:188968079-188968101 ACGGAGTCTCACTCTGGCCTAGG + Intergenic
986473427 5:8098168-8098190 ATGGTCTCTCACTCTGAAGTGGG - Intergenic
986544715 5:8883016-8883038 GTGGAGTCTCACTATGTTAGTGG + Intergenic
986562758 5:9079831-9079853 ATGGTGTCTCATTGTGTTTTTGG - Intronic
986885121 5:12225401-12225423 ATGGAGTTTCTCTCTGCAGTGGG + Intergenic
987096737 5:14557093-14557115 ACGGAGTCTCCCTCTGTCGCCGG + Intergenic
987218428 5:15764171-15764193 ATTGAGTATCAATATGTTGTTGG + Intronic
987567750 5:19615120-19615142 ATGGAGTCTCCCTCTGTCACCGG - Intronic
987705994 5:21462617-21462639 ATGGAGTCTCGCTTTATTGCTGG + Intergenic
988307331 5:29509444-29509466 ATGAATTCTAACTCTGTTGAGGG + Intergenic
988320908 5:29695495-29695517 ATGGAATCTCACTGTTATGTAGG + Intergenic
988401287 5:30763536-30763558 ACAGGGTCTCACTCTGTTGCAGG - Intergenic
989057884 5:37382434-37382456 ATGGAGTCTCGCTTTATTGCTGG + Intronic
989064248 5:37443825-37443847 ATGGAGTCTCTCTCTGTTGCTGG - Intronic
989782219 5:45281610-45281632 ACGGAGTCTCACTCTGTTGCCGG + Intronic
990207829 5:53449182-53449204 ATGGAGTCTCTTTATGTTGCTGG - Intergenic
990214543 5:53515501-53515523 AGAGAGTCTCTATCTGTTGTTGG - Intergenic
990385509 5:55257448-55257470 ATGGAGTCTCACTCTCGCCTAGG + Intronic
990777174 5:59315446-59315468 ATTGAGTCTCACACTCTTGAGGG + Intronic
991001850 5:61790948-61790970 AGGCTGTCTCACCCTGTTGTGGG - Intergenic
991144000 5:63279879-63279901 ACGGAGTCTCACTCTGTCGCAGG + Intergenic
991530600 5:67609609-67609631 ACGGAGTCTCACTCTGTCCCAGG - Intergenic
991648453 5:68826308-68826330 ACAGAGTCTCACTCTGTTGAGGG + Intergenic
991687453 5:69194770-69194792 ATGGAGTCTCACTATCATGCAGG + Intronic
991975650 5:72181743-72181765 ACGGAGTCTCGCACTGTTGTCGG + Intronic
992438188 5:76775210-76775232 ATAGAGTCTCACTCTGATCCAGG - Intergenic
992465476 5:76999957-76999979 AGGGAGTCTCACTCTGTCACTGG + Intergenic
993122351 5:83791602-83791624 ACGGAGTGTCAATCTGTTGATGG + Intergenic
993921510 5:93810591-93810613 ATGGGGTCTTACTATGTTTTCGG + Intronic
994418057 5:99499656-99499678 ACGGAGTCTCTCTCTGTTGCTGG - Intergenic
994461908 5:100075497-100075519 ACGGAGTCTCTCTCTGTTGCTGG + Intergenic
995264100 5:110138536-110138558 TGGGGGTCTCACCCTGTTGTGGG + Intergenic
995941092 5:117585050-117585072 ACGGAGTCTCACTTTGTTGCCGG - Intergenic
996194445 5:120586146-120586168 ATGGAGTCTCGCTCTGTTGCTGG - Intronic
996535354 5:124571736-124571758 ACGGAGTCTCACTCTGTCCCAGG + Intergenic
996729882 5:126706659-126706681 ACGGAGTCTCGCTCTGTAGATGG - Intergenic
996778302 5:127156897-127156919 ATGGAATTCCACTCTGTTGCCGG + Intergenic
997308909 5:132863462-132863484 ACAGAGTCTCGCTCTGTTGCCGG + Intronic
997313289 5:132909146-132909168 ATGGAGTTTCACACTCCTGTAGG + Intronic
997446964 5:133947390-133947412 TTGGTGTCTCACTCTGCTCTAGG - Intergenic
997579720 5:135009715-135009737 ATAATGTCTCCCTCTGTTGTGGG + Intronic
997939421 5:138143447-138143469 ACAGGGTCTCACTCTGTTGCTGG - Intronic
998408861 5:141892545-141892567 ATGGGGTTTCACTGTGTTGCAGG - Intergenic
998535689 5:142928960-142928982 ACGGAGTCTCGCTCTGTCGCCGG + Intronic
998667649 5:144316850-144316872 ACGGAGTCTCACTCTGTCACTGG + Intronic
998831693 5:146166512-146166534 ATGGAGTCTCACTATGTTGCTGG - Intronic
999174275 5:149620804-149620826 AAGGAGTCTCACTCTGTCTCCGG - Intronic
1000256138 5:159540393-159540415 ATGGAGTCTTGCTCTGTTCCAGG - Intergenic
1000267048 5:159647713-159647735 ACGGAGTCTCACTCTGTTGCCGG + Intergenic
1001026125 5:168225733-168225755 ATGGAGTCTCACTCTGTCCCAGG - Intronic
1001118986 5:168963190-168963212 ATGGAGTCTCACTCACTGTTTGG + Intronic
1001151679 5:169234430-169234452 ATGCAGTCTCACTCTGTCCCAGG + Intronic
1001739066 5:174035040-174035062 ATGGGGTCTCACCCAGTTGGGGG + Intergenic
1001770164 5:174289510-174289532 ATGGAGTCTCCCTATGTTGCTGG + Intergenic
1001829716 5:174775567-174775589 ACGGAGTCTCACTCTGTTGCCGG + Intergenic
1001876767 5:175208322-175208344 ATGGAGTCTCACTCTGTCGCCGG - Intergenic
1002055560 5:176596402-176596424 ATGCAGTCTCTCCCTGTTCTGGG + Exonic
1002390093 5:178903964-178903986 ATGGAGTCTCACTCTGTTGCCGG - Intronic
1002520612 5:179791548-179791570 ATGGAGTCTTGCTATGTTGCAGG - Intronic
1002531023 5:179845514-179845536 ACAGAGTCTCACTCTGGTGCAGG + Intronic
1004640083 6:17506612-17506634 ATGGAGTCTCACTCTGTCCCAGG - Intronic
1005302205 6:24482122-24482144 ATGGAGTCTCACACTGTCACCGG + Intronic
1005396448 6:25386939-25386961 ATGGGGTTTCACCATGTTGTTGG - Intronic
1005587029 6:27286969-27286991 ATGGAGTCTCACTCTCTCCCTGG - Intronic
1005962188 6:30702231-30702253 ATGGAGTCTCACTCTCAGGCTGG - Intronic
1006306544 6:33224241-33224263 ATGGAGTCTCGCTCTGTTGCTGG + Intergenic
1006868725 6:37231083-37231105 ATGGAGTCTTACTCTGTCCCAGG + Intronic
1008585006 6:52940750-52940772 TGGGGGTCTCACTCTGTTGTTGG - Intergenic
1009022290 6:57958262-57958284 ATGGAGTCTCGCTTTATTGCTGG - Intergenic
1010223455 6:73467844-73467866 ACGGAGTCTCACTCTGTGCCAGG + Intronic
1010823542 6:80445457-80445479 ATTGAGTCTCACTCAGCTGTGGG - Intergenic
1011050483 6:83142780-83142802 ATGAGGTCTCACTTTGCTGTTGG + Intronic
1011780135 6:90779613-90779635 ATTATGTCTCACTCTGTAGTGGG - Intergenic
1012105302 6:95149838-95149860 ACAGAGTCTCACTCTGTCGGAGG + Intergenic
1013090075 6:106892341-106892363 ATGGAGTATCGCACTGTTGCTGG - Intergenic
1013128593 6:107209611-107209633 ATGAGGTTTCACTATGTTGTTGG + Intronic
1013135239 6:107276089-107276111 ATAGGGTCTCACTCTGTGCTAGG - Intronic
1013581478 6:111539026-111539048 AGACAGTCTCACTCTGTTGCCGG - Intergenic
1013777658 6:113696537-113696559 ATGGAGTCTCACACTGTCGCCGG + Intergenic
1014127746 6:117795826-117795848 ATGGTGTCTGGCTCTGTTCTAGG - Intergenic
1015253314 6:131149861-131149883 ATGGAGAGTCATTCTGCTGTTGG + Intronic
1016339988 6:143051872-143051894 ACGGAGTCTCGCTCTGTTGCCGG - Intergenic
1016374159 6:143403450-143403472 ATGGAGGCTCCTTCTCTTGTAGG - Intergenic
1016906302 6:149153671-149153693 ATGGTGTCTTAGTCTGTTTTGGG - Intergenic
1017014114 6:150085875-150085897 ACGGAGTCTCGCTCTGTTGGTGG - Intergenic
1017107863 6:150905061-150905083 ACAGGGTCTCGCTCTGTTGTTGG + Intronic
1017827460 6:158092572-158092594 ATGAGGTCTCACTATGTTGCTGG - Intronic
1020799913 7:12720665-12720687 ATGGGGTTTCACTGTGTTGAGGG - Intergenic
1020829397 7:13075216-13075238 ACGGAGTCTCACTCTGTTGCTGG + Intergenic
1021180881 7:17504398-17504420 ATGGGGTTTCACCATGTTGTTGG + Intergenic
1021223797 7:18004966-18004988 ATGGAGTCTCACTTTTTCATCGG + Intergenic
1021603113 7:22384264-22384286 ATGGAGTCTCGCTCTGTCCCAGG + Intergenic
1022244164 7:28541634-28541656 ATGGGGTTTTACTCTGTTGCTGG - Intronic
1022436190 7:30388053-30388075 ATGGAGTCTCACTCTGTCCCAGG - Intronic
1023419992 7:39969037-39969059 ATGGAGCCTCGCTCTGTGGCTGG + Intronic
1024239867 7:47426256-47426278 ACAGAGTCTCACTCTGTTGCCGG - Intronic
1024257475 7:47549468-47549490 ATGGAGTTTCCCTCTGTTGCCGG - Intronic
1024329857 7:48144910-48144932 ACAGAGTCTCACTCTGTTGCTGG + Intergenic
1024750628 7:52461028-52461050 ATGGAGTCGTGCTCTGTTGCCGG - Intergenic
1024919013 7:54537217-54537239 ATGGAGTCTCACTCTGTCACTGG + Intergenic
1024940831 7:54761325-54761347 ATGGAGTACTATTCTGTTGTGGG - Intergenic
1025008146 7:55371260-55371282 ACAGGGTCTCACTCTGTTGTAGG + Intronic
1026017920 7:66685177-66685199 ATGGAGTCTTGCTCTGTCGCTGG + Intronic
1026106523 7:67425013-67425035 AAGGAGTCTCACTCTGTTGCAGG + Intergenic
1026174364 7:67982981-67983003 ACGGAGTTTCACCATGTTGTTGG + Intergenic
1026235106 7:68520520-68520542 ATAGAGTCTCAATCTATTGAGGG + Intergenic
1026345615 7:69471373-69471395 ACAGGGTCTCACTCTGTTGCCGG - Intergenic
1026357377 7:69570301-69570323 ATGGGGTCTCGCTATGTTATAGG - Intergenic
1026617161 7:71915707-71915729 ACGGAGTCTCGCTCTGTTGCGGG - Intronic
1026646456 7:72174944-72174966 ACGGAGTCTCGCTCTGTCTTTGG + Intronic
1026730674 7:72909195-72909217 ATAAAGTCTCACTGTGTTGCAGG - Intronic
1026775559 7:73229033-73229055 ATGGAGTCTCGCTCTGTCACTGG - Intergenic
1026853889 7:73740642-73740664 ATAGAGTCTTACTATGTTCTAGG + Intergenic
1026914922 7:74114215-74114237 ATGGAGTCCCACTCTGTTGCTGG - Intronic
1027016416 7:74782407-74782429 ATGGAGTCTCGCTCTGTCACTGG - Intronic
1027071612 7:75163534-75163556 ATGGAGTCTCGCTCTGTCACTGG + Intergenic
1027294493 7:76754746-76754768 ACGGAGTCTCGCTCTGTCGCAGG + Intergenic
1027392149 7:77715244-77715266 ACAGAGTCTTACTCTGTTGCAGG - Intronic
1027524192 7:79245918-79245940 ATGGAGTCTCTTTCTGTGCTGGG - Intronic
1028423955 7:90665258-90665280 ACAGTGTCTCACTCTGTTGCCGG - Intronic
1028463050 7:91117720-91117742 ATTGAGCCTCACACTGTTCTGGG - Intronic
1029062178 7:97809905-97809927 GTGGAGTCTCACTCTGTCGCCGG - Intergenic
1029269895 7:99370931-99370953 ATGGAGTCTTGCTCTGTTATCGG + Intronic
1029433842 7:100550280-100550302 ACGGAGTCTCGCTCTGTCGCCGG - Intronic
1030049257 7:105523312-105523334 AGAGAGTCTCACTCTGTTGCAGG + Intergenic
1030555261 7:111017095-111017117 AAAGAGTCTCGCTCTGTTGCTGG + Intronic
1030781686 7:113609078-113609100 ATGGAGTAACACTCTTTTATAGG + Intergenic
1031080515 7:117252944-117252966 ATGGAGTCTCACTCTGTCATGGG + Intergenic
1031366897 7:120912106-120912128 ATGGAGTCTCACTGTCTCCTGGG - Intergenic
1032103439 7:129003014-129003036 AGGGAGTCTCGCTCTGTCGCCGG - Intronic
1032134169 7:129259709-129259731 ACGACGACTCACTCTGTTGTGGG + Intronic
1032705847 7:134420787-134420809 ATGGAGCCTCAACCTGATGTAGG + Intergenic
1033311913 7:140267791-140267813 ATGGAGTCTCGCTTTGTGGAAGG - Intergenic
1033974870 7:147088751-147088773 ATGGGGTCTCTCTATGTTGCAGG - Intronic
1034495344 7:151417592-151417614 ATGGAATCCCACTCTGTTCAAGG - Intergenic
1034496125 7:151423693-151423715 ACAGAGTCTTGCTCTGTTGTCGG + Intergenic
1034592244 7:152151351-152151373 GTGGTGTCTCTCTCTGATGTTGG + Intronic
1034604742 7:152301482-152301504 ATGGAGTCTCACACTGTCAGCGG - Intronic
1034785270 7:153920584-153920606 ATGGAGTCTCACTCTGTCCCAGG + Intronic
1035518495 8:256795-256817 ATGGGGTCTCACTATGTTTCAGG + Intergenic
1035630386 8:1103123-1103145 CTGGAGTCTGACTCTGGTGGAGG + Intergenic
1035908230 8:3537026-3537048 ATGGAGTCTTTCTCTGTTGCCGG + Intronic
1035997202 8:4561347-4561369 ATGGAGTCTCATTCTGTCACCGG - Intronic
1036611197 8:10351276-10351298 ACGGAGTCTCGCTCTGTTGCCGG + Intronic
1037760135 8:21736518-21736540 ACAGGGTCTCACTCTGTTGCTGG + Intronic
1037798294 8:22015500-22015522 ACAGAGTCTCACTCTGTCGCTGG + Intergenic
1038196496 8:25373022-25373044 ACGGAGTCTCGTTCTGTTGCCGG + Intronic
1038240366 8:25802610-25802632 ATGGAGTCTCACTGTTGTCTAGG + Intergenic
1038426195 8:27465454-27465476 GCGGAATCTCACTCTGTTATCGG + Intronic
1038462642 8:27729763-27729785 ATGGAGTCTTGCTCTGTCATGGG - Intergenic
1038824051 8:30981651-30981673 ACGGAGTCTCGCTCTTTTGCTGG + Intergenic
1039183046 8:34887861-34887883 ATGGGGTCTCACTCTAATCTAGG - Intergenic
1039497377 8:37991151-37991173 ATGGAGTCACACTCTGTTGCCGG + Intergenic
1039722579 8:40180534-40180556 ATAGTGTCTCACTCTGTCGCTGG + Intergenic
1039983205 8:42426667-42426689 ATGGAGTCTCACTCTCATCCAGG - Intronic
1040280982 8:46043233-46043255 ATGGGAGCACACTCTGTTGTCGG + Intergenic
1040561607 8:48527707-48527729 ATGGAGTTTCACTCTGTCCCCGG - Intergenic
1040628387 8:49178978-49179000 ACGGAGTCTCGATCTGTTGCTGG - Intergenic
1040837269 8:51745778-51745800 ATGTAGTCTCACTCTGTCGCTGG + Intronic
1041054660 8:53971584-53971606 ATGGAATCTTGCTCTGTTGCTGG - Intronic
1041102329 8:54408716-54408738 ATGGAGTCTCACTCTCACCTGGG - Intergenic
1041149172 8:54913689-54913711 ACGGAGTCTCGCTCTGTCGTTGG - Intergenic
1041469332 8:58191285-58191307 ATGGAGTCTCACTCTGTCGCTGG - Intronic
1042072709 8:64954077-64954099 ATGGAGTCTCTTTCTGTAGCTGG - Intergenic
1042540182 8:69900429-69900451 ATGGAATCTCACTCTGTCATAGG + Intergenic
1043770653 8:84195413-84195435 ATGGAGTCTCGCTCTGTCGCTGG - Intronic
1044469205 8:92546467-92546489 ACGGAGTCTTGCTCTGTTGCCGG - Intergenic
1044563832 8:93640980-93641002 ACAGAGTCTCCCTCTGTTGCAGG - Intergenic
1044639910 8:94368217-94368239 ATAGGGTCTCACTATGTTGCTGG - Intergenic
1044706084 8:95010110-95010132 ATGGAGTTTCACTCTGTCACTGG + Intronic
1044732868 8:95245712-95245734 ATGGAGTGTCACTCTGTTGCCGG - Exonic
1044775651 8:95684575-95684597 ATGGAGTCTCACGCTGTACCAGG - Intergenic
1044837433 8:96310188-96310210 ATGGAGTCTCACTCTGTCCCAGG + Intronic
1044862539 8:96536846-96536868 TTGGAGACTCAGTCTGCTGTTGG + Intronic
1045009715 8:97947337-97947359 ACGGAGTCTCGCTCTGTTGCTGG - Intronic
1045011253 8:97960731-97960753 ACAGAATCTCACTCTGTTGCTGG - Intronic
1045257036 8:100534791-100534813 ACAGAGTCTCACTCTGTCGCTGG + Intronic
1045492014 8:102677071-102677093 ACAGAGTCTCGCTCTGTTGCCGG - Intergenic
1045754190 8:105522723-105522745 ATGGAGTCTTGCTCTGTTGCTGG - Intronic
1046071462 8:109260211-109260233 AGAAGGTCTCACTCTGTTGTAGG + Intronic
1046077033 8:109325062-109325084 ATGAAGTCTCACTCTGTCCCAGG - Intronic
1047482466 8:125297808-125297830 ACAGAGTCTCACTCTGTTGATGG - Intronic
1047736186 8:127767402-127767424 ATGGAGTCTCCCTCTGTCCATGG + Intergenic
1049113330 8:140664007-140664029 ATGGAGTCTCACTCTGTTGCAGG + Intronic
1049870026 8:144967245-144967267 ACGGAGTCTCGCTCTGTAGCAGG - Intergenic
1049912343 9:281222-281244 ACAGAGTCTCACTCCGTTGCTGG - Intronic
1051306030 9:15710619-15710641 ATGGAGTCTCACTCTTCTCCAGG + Intronic
1051422774 9:16905218-16905240 ATGGAGTCTCACTCTGTCCCAGG + Intergenic
1051429677 9:16969082-16969104 ATGTAGTCTCACTCAGCTGGAGG - Intergenic
1051627667 9:19113793-19113815 ATGGAGTCTCGCCCTGTCGCTGG + Intronic
1052320102 9:27158682-27158704 GTGGAGTCTCACTCTGTCACCGG + Intronic
1052952088 9:34220656-34220678 ATGGGGTCTCACTATGTTGCTGG + Intronic
1053048681 9:34940560-34940582 ATGGGGTCTCACTATGTTGCTGG - Intergenic
1053257937 9:36634920-36634942 ATGGAGTCTCACTCTCCTCCCGG - Intronic
1053394861 9:37764343-37764365 ACAGAGTCTCACTCTGTTGCCGG + Intronic
1054759321 9:68990686-68990708 ACAGAGTCTCACTTTGTTGCCGG + Intronic
1055149172 9:72974608-72974630 TTGGTGCCTCAGTCTGTTGTAGG + Intronic
1055340029 9:75271476-75271498 ATGGAGTCTCACTCTGTATCTGG - Intergenic
1055340373 9:75275334-75275356 ATAGAGTCTCACTCTGTCCCAGG + Intergenic
1055965034 9:81858090-81858112 ATGGAGTCTTGCTCTGTTGCAGG + Intergenic
1056520790 9:87399392-87399414 ATGGGGTCTTGCTCTGTTGCTGG - Intergenic
1056573844 9:87839760-87839782 ATGGAGTCTCGCTCTGTTGTCGG + Intergenic
1057077972 9:92149583-92149605 ACAGAGTCTCACTCTGTGGCTGG + Intergenic
1057209525 9:93192286-93192308 ACGGAGTCTCGCTCTGTCGCCGG - Intronic
1057296710 9:93849579-93849601 ATGGAATCTCACTCTGTCGCCGG + Intergenic
1057413341 9:94838934-94838956 ATGGAATCTCACTCTGTGCCAGG + Intronic
1057622783 9:96651252-96651274 ATGGAGTCTCACTCTGTTGCTGG - Intronic
1058003353 9:99889977-99889999 ACGGAGTCTCACACTGTCGCTGG + Intergenic
1058050355 9:100400459-100400481 ATGGTGTCTCTCTCTGTTCCAGG + Intergenic
1058112823 9:101050097-101050119 TTGGAGTCTCACTCTGTTGCAGG - Intronic
1058245620 9:102621361-102621383 ATGGAGTCTCGCTCTGTCATCGG + Intergenic
1058356634 9:104091512-104091534 AAGGAGTCTCACTCTGTCTCAGG - Intergenic
1058682270 9:107450460-107450482 ATGGAGTCTCACTCTGTCATAGG + Intergenic
1058695213 9:107553314-107553336 ACGGAGTCTTCCTCTGTGGTAGG - Intergenic
1059103395 9:111490924-111490946 AAAGAGTCTCACTCTGTCGTCGG - Intergenic
1059495291 9:114704217-114704239 ATGGGGTCTCACTATGTTGATGG + Intergenic
1059586535 9:115613703-115613725 ATGGAAGCTTACACTGTTGTGGG - Intergenic
1059619432 9:115987296-115987318 ACAGAGTCTCACTCTGTTGCCGG + Intergenic
1059899025 9:118901670-118901692 ATGAGATCTCACTTTGTTGTGGG + Intergenic
1061316805 9:129801560-129801582 ATTGAGTCTCACCCCTTTGTCGG + Intergenic
1061348700 9:130046750-130046772 ATAAAGTCTCACTCTGTTGCCGG - Intergenic
1061571568 9:131480973-131480995 ACAGGGTCTCACTCTGTTGCTGG - Intronic
1061783767 9:133011328-133011350 ACCGAGTGTCACTCTGTTGCTGG - Intergenic
1062301192 9:135871375-135871397 ATGGGGTCTCACTATGTTGTCGG + Intronic
1062608741 9:137362523-137362545 ATAGAGTCTCACTCTGTCCCCGG + Intronic
1185478693 X:430316-430338 AAGGAGTCTCGCTCTGTTGCAGG - Intergenic
1185510375 X:659779-659801 ACGGAGTCTCGCTCTGTTGCAGG + Intergenic
1185539020 X:887351-887373 ATGGAGTCTCGCTCTTGTCTAGG - Intergenic
1185564929 X:1087884-1087906 ATGGAGTCTCGCTCTGTCACTGG + Intergenic
1185676227 X:1851475-1851497 ATGGAGTCTCGCTCTGTTTCCGG - Intergenic
1185914857 X:4024534-4024556 ATGTTGTCTCACACTGTTGCTGG + Intergenic
1186139561 X:6556688-6556710 ATGCAATCTAACTCTGTTTTGGG - Intergenic
1186856568 X:13632190-13632212 ACGGAGTCTCACTCTGTTGCTGG - Intronic
1186942639 X:14527588-14527610 ATGGAGTCTCACTCTGTCACCGG - Intergenic
1187129957 X:16492941-16492963 ATGGAGTCTTTCTCTGTCGCCGG - Intergenic
1187529381 X:20082650-20082672 ACGGAGTCTCGCACTGTTGTCGG + Intronic
1187884792 X:23879408-23879430 ATGGAGTCTCACTCTTGCCTAGG - Intronic
1188057822 X:25562450-25562472 AAGGAGTCTCACTCTGTCACTGG + Intergenic
1188634406 X:32411154-32411176 ATAGAGTCTCGCTCTGTTCCAGG + Intronic
1189343766 X:40224573-40224595 ACAGAGTCTCGCTCTGTTGCCGG - Intergenic
1189866928 X:45340100-45340122 ATGGAGTCTCACTCTCTCCCAGG - Intergenic
1189963137 X:46344300-46344322 ATGGAGGCTCAGTTTGCTGTTGG - Intergenic
1190570291 X:51774753-51774775 AGGGAGTCTCACTCTGTGCCAGG - Intergenic
1190650017 X:52559804-52559826 ATGCAGTCTCACTCTGTCACTGG - Intergenic
1191811384 X:65192816-65192838 ATGGAGTCTCGCTCTATTGCTGG + Intergenic
1191847045 X:65554806-65554828 ATGGAGTCTCACTCTTGCCTAGG + Intergenic
1192407650 X:70902543-70902565 ATGGGGTCTCACTCTGTCACTGG + Intronic
1194110428 X:89826426-89826448 ACGGAGTCTCATTCTGTTGCCGG - Intergenic
1194852822 X:98890405-98890427 ATGGAGTCTTGCTCTGTCGTTGG - Intergenic
1195042338 X:101025924-101025946 ATGGAGTCTCACTCTCGCCTAGG - Intronic
1195053013 X:101115308-101115330 ATGGGGTCTCACTCTTGTGCAGG + Intronic
1195393184 X:104384512-104384534 ATGTAGTCTTACTCTGTCGCCGG + Intergenic
1196054055 X:111335927-111335949 TCGGAGTCTCTCTCTGTTGCCGG - Intronic
1198030093 X:132746471-132746493 ACGGAGTCTCGCTCTGTTGCTGG - Intronic
1198670218 X:139071984-139072006 ATGGAATCTCGCTCTGTGGCTGG - Intronic
1198755119 X:139974405-139974427 ACGGAGTCTCGCTCTATTGCTGG - Intergenic
1198870361 X:141172199-141172221 AGAGAGTCTCACTCTGTCGCCGG - Intergenic
1200298897 X:154952565-154952587 ACGGAGTCTCACTCTGTCGCCGG + Intronic
1201059437 Y:10032444-10032466 ACGGAGTCTTGCTCTGTTGCTGG + Intergenic
1201365277 Y:13198650-13198672 ATGGAGTCTCACTCTGTCTCAGG - Intergenic
1201522618 Y:14892713-14892735 ATGGAGTCTCACTCTTTCGCCGG - Intergenic
1201687145 Y:16717993-16718015 ATGGAGTCTTACTCTGTTGCCGG + Intergenic
1201890284 Y:18936271-18936293 ATGGAATGTCACTCTGTTGCCGG + Intergenic
1202012783 Y:20365420-20365442 ATGGAGTCTCCCTCAGTTACAGG - Intergenic
1202051219 Y:20782725-20782747 AGACAGTCTCACTCTGTTGCTGG + Intergenic