ID: 1165764586

View in Genome Browser
Species Human (GRCh38)
Location 19:38342879-38342901
Sequence GCATCCCTGGGAGGTTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165764578_1165764586 2 Left 1165764578 19:38342854-38342876 CCCTTTTCTATTCAGCCAGGATC No data
Right 1165764586 19:38342879-38342901 GCATCCCTGGGAGGTTGTCCAGG No data
1165764572_1165764586 27 Left 1165764572 19:38342829-38342851 CCATCTCCACTCTAAGCGCTCCC No data
Right 1165764586 19:38342879-38342901 GCATCCCTGGGAGGTTGTCCAGG No data
1165764571_1165764586 28 Left 1165764571 19:38342828-38342850 CCCATCTCCACTCTAAGCGCTCC No data
Right 1165764586 19:38342879-38342901 GCATCCCTGGGAGGTTGTCCAGG No data
1165764576_1165764586 5 Left 1165764576 19:38342851-38342873 CCACCCTTTTCTATTCAGCCAGG No data
Right 1165764586 19:38342879-38342901 GCATCCCTGGGAGGTTGTCCAGG No data
1165764575_1165764586 6 Left 1165764575 19:38342850-38342872 CCCACCCTTTTCTATTCAGCCAG No data
Right 1165764586 19:38342879-38342901 GCATCCCTGGGAGGTTGTCCAGG No data
1165764579_1165764586 1 Left 1165764579 19:38342855-38342877 CCTTTTCTATTCAGCCAGGATCC No data
Right 1165764586 19:38342879-38342901 GCATCCCTGGGAGGTTGTCCAGG No data
1165764574_1165764586 7 Left 1165764574 19:38342849-38342871 CCCCACCCTTTTCTATTCAGCCA No data
Right 1165764586 19:38342879-38342901 GCATCCCTGGGAGGTTGTCCAGG No data
1165764573_1165764586 21 Left 1165764573 19:38342835-38342857 CCACTCTAAGCGCTCCCCACCCT No data
Right 1165764586 19:38342879-38342901 GCATCCCTGGGAGGTTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165764586 Original CRISPR GCATCCCTGGGAGGTTGTCC AGG Intronic