ID: 1165765195

View in Genome Browser
Species Human (GRCh38)
Location 19:38346212-38346234
Sequence CAGGAGAAACAGAGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 739
Summary {0: 1, 1: 0, 2: 3, 3: 74, 4: 661}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165765195 Original CRISPR CAGGAGAAACAGAGGCCCTG AGG Intronic
900251379 1:1671969-1671991 CTGCAGAGAAAGAGGCCCTGTGG + Intronic
900536303 1:3179397-3179419 CTGGGGAAACAGAGGCACAGGGG - Intronic
901063584 1:6484951-6484973 AAGGAGAAACAGAGGCCTCTGGG + Intronic
901252939 1:7795569-7795591 CAGCAGGCGCAGAGGCCCTGGGG + Intronic
901459353 1:9382493-9382515 AAGCAGAAACAGAGGCTCAGAGG + Intergenic
901460570 1:9388851-9388873 CAGGAGAAGCTGAGGCCCAGAGG + Intergenic
901661374 1:10799875-10799897 CAGCAGGTGCAGAGGCCCTGAGG - Intergenic
902162238 1:14540375-14540397 AAGGTGAAACTGAGGCCCCGCGG + Intergenic
902662539 1:17915146-17915168 AAGGAGAAACAGCGGCCTAGAGG - Intergenic
903008663 1:20315214-20315236 CAGCAGGGACAAAGGCCCTGGGG + Intronic
903386148 1:22928225-22928247 CAGCAGGAGCAAAGGCCCTGAGG + Intergenic
903655139 1:24944313-24944335 CAGCACAGACAAAGGCCCTGTGG - Intronic
903733691 1:25516640-25516662 CAGGAAACACTGAGGCTCTGAGG + Intergenic
903825813 1:26145153-26145175 CAGGTGAAACAGCAGCTCTGAGG + Intergenic
904296163 1:29521108-29521130 ATGGAGAAACTGAGGCTCTGAGG - Intergenic
904402794 1:30267689-30267711 CAGCAGAAGCAAAGGTCCTGAGG + Intergenic
904468213 1:30720238-30720260 CAGGTGACACAGCGGCGCTGGGG - Intronic
904811048 1:33163701-33163723 CAAGGAAAACAGAGGGCCTGAGG + Intronic
905323092 1:37131571-37131593 TAGGAGAAGCAGAGGCACAGGGG - Intergenic
905406342 1:37735188-37735210 CTGAAGAACCAGAAGCCCTGCGG + Intronic
905770275 1:40633286-40633308 GAGGAGAAACTGAGGCACAGAGG - Intronic
905882568 1:41474277-41474299 CAAGGGAAACTGAGGCCCTGGGG - Intergenic
906295749 1:44648078-44648100 CAGCAGAAACAGAGGCCAAGAGG - Intronic
906660115 1:47575945-47575967 CAGGGGAAACTGATGTCCTGGGG - Intergenic
907159667 1:52360933-52360955 CAGGAGCATCAGAGGCACAGGGG + Intronic
907400539 1:54222338-54222360 CAGCAGGAACAAAGGCCCTGGGG + Intronic
907422818 1:54358579-54358601 CAGGGGATACTGAGGCCCAGGGG - Intronic
907537016 1:55171972-55171994 GATGAGGAACAGAGGCACTGAGG + Intronic
908403708 1:63793922-63793944 CAGGAGAAGCAGAGACCCCAGGG + Intronic
910649863 1:89555053-89555075 GAGGAGAAACATGGGCCCTCTGG - Intronic
911464442 1:98233796-98233818 CATGAGAAGCTGAGGCACTGGGG + Intergenic
912389922 1:109295932-109295954 TAGGAGTGACAGAGTCCCTGTGG - Intronic
912939207 1:114030272-114030294 AAGGAGAAAAAGTGGCCGTGAGG - Intergenic
915034237 1:152909150-152909172 CAGGAGAGAAAGCAGCCCTGGGG + Intronic
915280385 1:154818409-154818431 TAGCACACACAGAGGCCCTGGGG + Intronic
915304707 1:154970638-154970660 CAGGAGTCACAGAAGTCCTGGGG + Exonic
915729783 1:158045080-158045102 CAGCAGAGGCAGAGGTCCTGAGG + Intronic
916559157 1:165918038-165918060 CAGGAGAAACTCAGGCTTTGGGG + Intergenic
917083583 1:171282292-171282314 CAGGAGAAACACAAGCTCGGTGG + Exonic
917159323 1:172040027-172040049 CAGAGAAAACAGAGGGCCTGTGG + Intronic
917351754 1:174085240-174085262 CAGGGGAACAAGAGGCACTGGGG - Intergenic
917496886 1:175548597-175548619 CAGCAGAAAGAGGGGCCCTGAGG - Intronic
917604196 1:176609657-176609679 CAGGAGACATAGAGCCCATGAGG + Intronic
917897631 1:179507038-179507060 CAGGAGAAACAGAAGGCCACAGG - Intronic
918429902 1:184448713-184448735 CAAGAGAAAAAGAAGCCCCGTGG - Intronic
918668049 1:187177291-187177313 CAGGAGAAACAGAGAGCAAGGGG + Intergenic
919127499 1:193413527-193413549 TAGCAGAAGCAAAGGCCCTGTGG + Intergenic
919417976 1:197335113-197335135 CAGCAGATGCAAAGGCCCTGAGG + Intronic
919880938 1:201900120-201900142 CCCGAGAAACAGACGCCCAGTGG - Exonic
920094514 1:203477492-203477514 GAGGGGAAACAGAAGCTCTGTGG - Intronic
920535125 1:206732205-206732227 GAAGAGAAACTGAGGCCCAGAGG + Intronic
920694166 1:208169190-208169212 CAAGGGAAAAAGAGGCTCTGAGG + Intronic
920825857 1:209423802-209423824 GAGGAGAAAGGTAGGCCCTGGGG + Intergenic
920935731 1:210432707-210432729 CTGGAGAGACGGAGACCCTGAGG - Intronic
921558909 1:216633253-216633275 CAGAAGAATCGGAGGGCCTGCGG + Intronic
921850354 1:219927707-219927729 CAGAAGAAAAAGAGGGCGTGGGG + Intronic
921936539 1:220801534-220801556 CAGGAGAAAGGGGGGCACTGAGG + Intronic
922485868 1:225972619-225972641 AGGGGGAAACAGAGGTCCTGAGG + Intergenic
923124504 1:231023288-231023310 CTGGTGAAACAGGGGCCCAGAGG + Intronic
924269503 1:242318241-242318263 CAGGATAAAAAGAGGACCAGAGG + Intronic
1062884450 10:1005492-1005514 CAGGAGTAACAGGCACCCTGGGG - Intronic
1062898898 10:1126615-1126637 AAGGAGCCACAGAGGCACTGAGG - Intronic
1063081036 10:2767342-2767364 CAGTAAAAACAGAGACCCAGGGG - Intergenic
1063409711 10:5827997-5828019 CAGAAAAAACAGGGGGCCTGAGG + Intronic
1063420994 10:5912472-5912494 CTGGAGAAGCAGAGACCGTGGGG + Intronic
1063448303 10:6134202-6134224 CAGGGGAGACGGAGGCCCTGAGG - Intergenic
1063573427 10:7238304-7238326 CATGAGAAACAGAGGACTTAAGG + Intronic
1064034307 10:11902781-11902803 CAGGAGCCTCAGAGGCCATGAGG + Intergenic
1065178644 10:23103326-23103348 GATGAGAAACAGAGGCCCAAAGG - Intronic
1066438268 10:35413933-35413955 GAGGAGAAGCAGAGCCACTGAGG + Intronic
1066666350 10:37786324-37786346 CATGAAACACAGAGGCACTGTGG - Intronic
1066715399 10:38280530-38280552 CAGGATAAAAAGAGGACCAGAGG - Intergenic
1066782696 10:38970182-38970204 CAGGATAAAAAGAGGACCAGAGG + Intergenic
1066997486 10:42577550-42577572 CTGGAGAATCAGAAGCCTTGGGG - Intronic
1067062624 10:43085654-43085676 AGGGAGAAATCGAGGCCCTGAGG + Intronic
1067064588 10:43096616-43096638 CTGGGGAAACTGAGGCCCAGAGG + Intronic
1067067895 10:43113804-43113826 GTGGAGTAACAGAGGCCCAGAGG - Intronic
1067536580 10:47114872-47114894 CAGGAGGCAGGGAGGCCCTGGGG + Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067668714 10:48300688-48300710 CAGGAGCATCAGAGGGCCTCAGG + Intergenic
1068671025 10:59723803-59723825 AAGCAGATACAAAGGCCCTGGGG - Intronic
1068774948 10:60859168-60859190 AGGGAGAAAAAGAGTCCCTGGGG + Intergenic
1068854781 10:61786299-61786321 CAGGAGGAGCAGTGGCCTTGAGG - Intergenic
1069069288 10:63977093-63977115 CAGAAAAAGCAGAGGCACTGGGG - Intergenic
1069614965 10:69801339-69801361 CAGGAGGTACAGAGCCCCCGGGG + Intergenic
1069929390 10:71872400-71872422 GAAGAGAAACTGAGGCCCAGAGG + Intergenic
1070110148 10:73478079-73478101 AAGGAGAAACAGAAGCACTAGGG + Intronic
1070496583 10:77029759-77029781 CAGCAAGCACAGAGGCCCTGAGG + Intronic
1071475668 10:86023150-86023172 TTGGAGAAATAGAGGCCCTGCGG + Intronic
1072439199 10:95438923-95438945 ATGGAAAAACTGAGGCCCTGAGG - Intronic
1072521800 10:96236130-96236152 TAGGAGCACCAGAGCCCCTGGGG + Intronic
1072633987 10:97165662-97165684 GAGGAGAAACCGAGGGCCAGCGG + Intronic
1073014379 10:100386320-100386342 AAGGAGAAAAACTGGCCCTGAGG - Intergenic
1073602568 10:104861342-104861364 CATGAGAAAGTGAGGCCCAGAGG - Intronic
1073767497 10:106699240-106699262 CCAGAGCAGCAGAGGCCCTGAGG - Exonic
1073955214 10:108862803-108862825 CAGAGGACAAAGAGGCCCTGTGG - Intergenic
1073998445 10:109342447-109342469 CAGGAAAAAAACAGGCCCTCAGG + Intergenic
1074256081 10:111803873-111803895 CAGCAGAAGCAAAGGCCCAGTGG + Intergenic
1074498669 10:114002520-114002542 CATGAGACTCAGAGGCCTTGAGG - Intergenic
1074897631 10:117791037-117791059 AAGAAGAAACAGAGGAGCTGCGG + Intergenic
1075587317 10:123667161-123667183 CAGAAGAAACAGAGGCTCGGTGG - Intronic
1075589794 10:123683382-123683404 AAGGAGACACAGAGCCCCTGGGG + Intronic
1075596846 10:123738081-123738103 CAGGAGAAAGAGAGGGCAGGGGG - Intronic
1076461008 10:130647442-130647464 CAGGAGCAGGAGTGGCCCTGTGG - Intergenic
1077301047 11:1847143-1847165 CAGGGGAGGGAGAGGCCCTGGGG - Intergenic
1077406594 11:2385136-2385158 CAGAAGAAACACTGGCCCCGGGG + Intronic
1077482283 11:2821409-2821431 CAGGACACACAATGGCCCTGTGG - Intronic
1078004610 11:7523167-7523189 CGGGAGACTCAGTGGCCCTGAGG + Intronic
1078432389 11:11298083-11298105 CAGGAGAACCTCCGGCCCTGGGG - Intronic
1080692093 11:34566687-34566709 GAGGAGAAAGAGAGGTTCTGAGG + Intergenic
1081159125 11:39732217-39732239 CAAGACAAACAGGGGCCCTCTGG - Intergenic
1081484456 11:43516741-43516763 GAGGTGACAAAGAGGCCCTGAGG - Intergenic
1083176482 11:60952932-60952954 CAGCAAAGACAAAGGCCCTGAGG - Intergenic
1083193459 11:61068889-61068911 CAGGACCAGCAAAGGCCCTGAGG - Intergenic
1083820832 11:65170478-65170500 GAGGGGAAACTGAGGCCCTCAGG - Intronic
1083870752 11:65487037-65487059 CAGGAGAAAATGAGTCCCTGGGG + Intergenic
1083998039 11:66281906-66281928 CAGGAGGAACCCAGGCCCAGAGG - Intronic
1084145308 11:67261953-67261975 CAGTAGATGCAAAGGCCCTGAGG - Intergenic
1084316004 11:68346318-68346340 GAGGACACACAGAGGACCTGAGG - Intronic
1084458884 11:69285310-69285332 CAGCACATACAAAGGCCCTGGGG - Intergenic
1084571030 11:69959930-69959952 CAGCAGGCACAAAGGCCCTGTGG - Intergenic
1084592903 11:70100672-70100694 CTGGGGAAACTGAGGCCCTGAGG - Intronic
1084816876 11:71652940-71652962 CAGGATATGCAAAGGCCCTGCGG - Intergenic
1084981217 11:72829801-72829823 CAGCAGGAAGAAAGGCCCTGAGG + Intronic
1085282986 11:75342795-75342817 CAGCAGGAACAAAGGCCCTGAGG + Intronic
1085462270 11:76701279-76701301 GAGGAGAAACAGAGGTCCCAAGG + Intergenic
1085623684 11:78056088-78056110 CAGGAAGAACTGAGTCCCTGTGG + Intronic
1088379210 11:109174636-109174658 AAAGAGAAAAAGAGGCCCTAGGG + Intergenic
1089192763 11:116666112-116666134 CACCAGAAACAGAGGCCAGGAGG + Intergenic
1089288582 11:117423417-117423439 CTGGAGATGCAAAGGCCCTGTGG - Intergenic
1089342696 11:117770132-117770154 CAGCAGAAAGAGTGGTCCTGCGG + Intronic
1089489188 11:118871280-118871302 CAGGAGAAGCAGAGGAGCTTTGG - Intergenic
1089587996 11:119522168-119522190 GATGAGAAACAGAGGGCCTGGGG + Intergenic
1089616474 11:119697640-119697662 AGGGAGAAACTGAGGCCCAGTGG + Intronic
1090395806 11:126417085-126417107 GAGGGGAAACTGAGGCCCGGAGG + Intronic
1091224361 11:133948805-133948827 CAGGAGGAACAGAGGCCTAGGGG + Intronic
1091292651 11:134450501-134450523 CAGGGTACAGAGAGGCCCTGAGG - Intergenic
1091394834 12:147664-147686 TGGCAGAAACTGAGGCCCTGGGG + Intronic
1091710292 12:2735287-2735309 CAGGAGGAACAGGTGCCCCGTGG + Intergenic
1091812244 12:3409358-3409380 CAGCAGCAACTCAGGCCCTGGGG + Intronic
1091840637 12:3617929-3617951 AAGGAGAAATAGAGCCCATGGGG - Intronic
1091948495 12:4571000-4571022 CAGGGGAAACAGAGGCCCTTTGG + Intronic
1091996994 12:5001562-5001584 CAGGAGACACAGTGGCCGTGGGG - Intergenic
1092409211 12:8241337-8241359 CAGGATATGCAAAGGCCCTGTGG - Intergenic
1094142868 12:27198939-27198961 CTGGAGCAACAGAGGCTCTGGGG - Intergenic
1095403848 12:41845550-41845572 CAGGAAATACAATGGCCCTGAGG - Intergenic
1095904782 12:47366694-47366716 AGGGAGAAACAGAGGCACAGAGG - Intergenic
1096408753 12:51362351-51362373 GAGGAGAGGCAGAGGACCTGGGG - Intronic
1096756919 12:53807339-53807361 AAGAAGAAATAGAGGCTCTGTGG - Intergenic
1096977338 12:55707158-55707180 CAGGGGAGCCAGAGGCCCTGGGG + Intronic
1097190139 12:57215906-57215928 CAGGAGAGAGAGAGGCAGTGGGG + Intergenic
1097450628 12:59733548-59733570 CAGGAGACACAGAGCCCCAAAGG + Intronic
1097625688 12:61997465-61997487 CAGTGGAAAGAGAGGCCCAGTGG + Intronic
1098160220 12:67642439-67642461 CAGCAGATGCAAAGGCCCTGAGG - Intergenic
1098232577 12:68387580-68387602 CAGCAAGTACAGAGGCCCTGAGG - Intergenic
1098570231 12:71980169-71980191 CAGCAAAAACAAAGACCCTGAGG + Intronic
1099240407 12:80131393-80131415 GAGGAGAGTCAGAGGCCCTGAGG + Intergenic
1099467879 12:83009345-83009367 CAGGAGAAAGAGAAACCCTGAGG - Intronic
1099589612 12:84570569-84570591 CAGGAGAAACTGGGGCTTTGGGG + Intergenic
1099752339 12:86791910-86791932 CAGGAGAGACACAGGCATTGTGG + Intronic
1100616508 12:96235353-96235375 CAGGAGAAACCAAGTCCCTCTGG - Intronic
1100786304 12:98082180-98082202 CAGGAGAAAATGAGGAGCTGAGG - Intergenic
1100999363 12:100342357-100342379 AGGTAGAAACAGAGGGCCTGAGG + Intergenic
1101208219 12:102510204-102510226 GAGTAGACACTGAGGCCCTGGGG - Intergenic
1102497546 12:113329966-113329988 CAGTAGATGCAAAGGCCCTGGGG - Intronic
1102513963 12:113434299-113434321 AAGGAGAAACTGAGGCCCAGAGG + Intronic
1102522820 12:113489608-113489630 CTGGAGGATCACAGGCCCTGTGG - Intergenic
1102625851 12:114234966-114234988 CAGAAGATGCAAAGGCCCTGAGG + Intergenic
1102685457 12:114721169-114721191 AATCAGAAACAGAGGCCATGGGG + Intergenic
1102693446 12:114779678-114779700 ATGGGGAAACTGAGGCCCTGAGG + Intergenic
1102905802 12:116674415-116674437 CAGCATATACAAAGGCCCTGTGG - Intergenic
1103012130 12:117465713-117465735 CAGGAAACACAGAGGGGCTGTGG + Exonic
1103088055 12:118077224-118077246 CAGCAAACGCAGAGGCCCTGAGG - Intronic
1103198664 12:119068662-119068684 CAGGAGCAATAGAAGCTCTGTGG - Intronic
1103281114 12:119758740-119758762 CAGGAGTAACAGGGGCAGTGCGG + Intronic
1103450129 12:121022855-121022877 CAGCAGAACCAGGGGCTCTGGGG - Intronic
1103938312 12:124488404-124488426 GAGGAGAAACTGAGGCTCAGAGG - Intronic
1104901648 12:132192584-132192606 AAGGAGAAACAGAGGCTCGGAGG - Intergenic
1105026638 12:132853465-132853487 CAGGAGCCCCACAGGCCCTGGGG - Exonic
1105422583 13:20266194-20266216 CAGGAGGAACAGAGGAGCGGAGG + Intergenic
1105422709 13:20266919-20266941 CAGGAGGAACAGAGGAGCGGAGG + Intergenic
1105604777 13:21917875-21917897 CCTGTGAAACAGAAGCCCTGCGG - Intergenic
1105811549 13:24000639-24000661 CAGGACATGCAGAAGCCCTGTGG + Intronic
1106138956 13:26994799-26994821 CGGCAGAAGCAGAGGCACTGGGG + Intergenic
1106683645 13:32033960-32033982 AAGTAGAAACAGAAGCCCTAAGG + Intronic
1106700337 13:32222186-32222208 CAGCAGATACAAGGGCCCTGAGG + Intronic
1107392491 13:39981803-39981825 GTGGAGAAAGAGAGGCCCTGAGG - Intergenic
1107430063 13:40332468-40332490 CAGAAGTACCAGAGGCCTTGGGG + Intergenic
1108225486 13:48285019-48285041 TAAGAGAAACAGAAGCCCTTGGG - Intergenic
1108340957 13:49497427-49497449 CGGAGGAAAGAGAGGCCCTGAGG - Intronic
1110346435 13:74453141-74453163 CAGGAGAAACAGAAGCCAAGGGG + Intergenic
1112212031 13:97387503-97387525 CAGGGGAAGGCGAGGCCCTGGGG - Intronic
1112398664 13:99056843-99056865 GAGGAAAGACAGTGGCCCTGAGG + Intronic
1112678850 13:101738599-101738621 CTGGGGAAAGAGAGACCCTGAGG + Intronic
1112727653 13:102323025-102323047 AAGGTGAAACAGAAGCCCTGTGG + Intronic
1113409325 13:110070642-110070664 CAGGAGCAGCAGATGCTCTGTGG + Intergenic
1113895994 13:113764832-113764854 CAGCAGGTACAAAGGCCCTGTGG + Intronic
1114556222 14:23563910-23563932 CTGGGGAAGCAGAGGGCCTGAGG - Intronic
1114634284 14:24178626-24178648 GAGGACCATCAGAGGCCCTGCGG + Exonic
1115416160 14:33136557-33136579 CTGAAGAAACTGAGACCCTGGGG + Intronic
1115762734 14:36591437-36591459 CAGAAGAAACGGAGGCACAGAGG + Intergenic
1117522092 14:56561106-56561128 CAGGAGGAACCCAGGTCCTGAGG - Intronic
1117909584 14:60624299-60624321 GTGGAGAAAGAGGGGCCCTGGGG - Intergenic
1117919004 14:60708068-60708090 CAGCAGGTACAAAGGCCCTGAGG - Intergenic
1118890127 14:69902136-69902158 CTGGAGAAAGACAAGCCCTGGGG + Intronic
1118971985 14:70644580-70644602 CAAGTGAGACAGAGGCCCAGAGG - Intronic
1119642798 14:76327595-76327617 GAGGAGAAAGATGGGCCCTGGGG + Intronic
1119765025 14:77182497-77182519 CTGGGGAAACTGAGGCCCAGGGG + Intronic
1119787684 14:77325328-77325350 AAGCAGAAACAAGGGCCCTGTGG + Intronic
1120144240 14:80962090-80962112 ATGGAGAAACTGAGGCCCAGAGG - Intronic
1121429929 14:93879388-93879410 CAGGGGCCACAGAAGCCCTGGGG - Intergenic
1121737293 14:96227354-96227376 ATGAAGAAACTGAGGCCCTGAGG + Intronic
1122235117 14:100327047-100327069 CAGAGGAAACTGAGGCCCTGAGG + Intronic
1122265343 14:100544177-100544199 CATGAGAAACTGAGGCTCAGAGG - Intronic
1122654646 14:103249763-103249785 CAAGAGAAACAGCTGCTCTGGGG - Intergenic
1122821650 14:104349488-104349510 AGAGAGAAACAGAGGCACTGGGG - Intergenic
1122913257 14:104843957-104843979 CAGGAGGCACTGAGACCCTGCGG - Intergenic
1123118950 14:105908257-105908279 CAGGAGAAACTGAGGGTCTTTGG + Intergenic
1124203394 15:27697624-27697646 CATGAAAAACACAGGCTCTGCGG + Intergenic
1124797058 15:32792053-32792075 CAGAAGAAACAGAGGAACTAAGG + Intronic
1124853008 15:33359449-33359471 CAGGACATGCAAAGGCCCTGGGG - Intronic
1124872076 15:33553199-33553221 AAGGAGAAAAAGAGGCTCTTGGG + Intronic
1125413658 15:39430439-39430461 CAGGACAAGAAAAGGCCCTGGGG - Intergenic
1125469711 15:39990894-39990916 CAGCATAAGCAGAGGCCCCGGGG + Intronic
1125677038 15:41507623-41507645 CATCAGAACCAGAGGGCCTGGGG + Exonic
1126445665 15:48740952-48740974 CAGGAGAAATAGAGGGCCTAGGG - Intronic
1126851321 15:52798774-52798796 GAGGAGAAACAGAGGGGGTGGGG + Intergenic
1127500629 15:59550730-59550752 CAGCAAGAACAGAGGCACTGGGG - Intergenic
1128338803 15:66805465-66805487 CAGGGGAAACCGAGGACCTAGGG - Intergenic
1128498300 15:68210599-68210621 CAGGAGAAACTGAGGCCAGAGGG - Intronic
1128501161 15:68228721-68228743 CAGGAGAGACAGAGCCCAAGTGG - Intronic
1128577986 15:68789377-68789399 CAAGAGAAGAAAAGGCCCTGAGG - Intronic
1128802211 15:70504103-70504125 CAGAAGCAACTGAGGCCCAGAGG - Intergenic
1128898193 15:71395020-71395042 TAGAAGAAACAGAGCCACTGAGG + Intronic
1129113577 15:73352518-73352540 CAGAAGAAACAGGGGGCCTGGGG + Intronic
1129320809 15:74773650-74773672 AAGCAGGAAAAGAGGCCCTGGGG - Intergenic
1129683054 15:77669137-77669159 CAGCAGAGGCAGAGGCCCAGTGG - Intronic
1129750967 15:78063849-78063871 CTGGAGACCCAGAGGCCCAGGGG - Intronic
1129750976 15:78063881-78063903 CTGGAGACCCAGAGGCCCAGGGG - Intronic
1130866444 15:87937044-87937066 AAGGAGGAGCAAAGGCCCTGGGG - Intronic
1132484440 16:183156-183178 CAGGAGGCTCAGGGGCCCTGAGG + Intergenic
1132801795 16:1758274-1758296 GAGCAGAAGCAGAGGCGCTGCGG - Intronic
1132806332 16:1776797-1776819 TAGGAAAAACCGAGGCCCTGTGG + Exonic
1132882420 16:2168273-2168295 CAGGAGAAGAAGAGCACCTGTGG + Intronic
1133350181 16:5096140-5096162 CAGGATATGCAAAGGCCCTGTGG - Intronic
1133367899 16:5225580-5225602 CAGGAGTCACAAAGGCCCTGGGG + Intergenic
1133702828 16:8325232-8325254 CAGCACAGGCAGAGGCCCTGTGG - Intergenic
1133729367 16:8566733-8566755 CAGCAGACGCAAAGGCCCTGAGG - Intergenic
1134040885 16:11067444-11067466 CAGAAGAAGCAAAGGCCCTGGGG + Intronic
1134244991 16:12533232-12533254 CAGGAGAATCAGCTGCCCTTTGG - Intronic
1135178805 16:20255236-20255258 CTGGAGGAACACAAGCCCTGAGG - Intergenic
1135180252 16:20267230-20267252 CAGGAGAAGCAGAGACCCCATGG - Intergenic
1135315837 16:21443711-21443733 CAGCAGATGCAAAGGCCCTGTGG + Intronic
1135368763 16:21875972-21875994 CAGCAGATGCAAAGGCCCTGTGG + Intronic
1135443054 16:22495170-22495192 CAGCAGATGCAAAGGCCCTGTGG - Intronic
1136061064 16:27726803-27726825 CAGCAGGAGCAAAGGCCCTGCGG + Intronic
1136312517 16:29422461-29422483 CAGCAGATGCAAAGGCCCTGAGG + Intergenic
1136325947 16:29524194-29524216 CAGCAGATGCAAAGGCCCTGTGG + Intergenic
1136440636 16:30264178-30264200 CAGCAGATGCAAAGGCCCTGTGG + Intergenic
1136630028 16:31484681-31484703 CAGAACCAACAGAGGCACTGTGG + Exonic
1136928556 16:34397313-34397335 CAGGGGAGACAGAGGCACCGAGG + Intergenic
1136976018 16:35014491-35014513 CAGGGGAGACAGAGGCACCGAGG - Intergenic
1137401202 16:48155754-48155776 GATGAGAAACAAAGGCCCTTGGG + Intronic
1137514525 16:49131479-49131501 CATGTGAAACTGTGGCCCTGGGG - Intergenic
1138279868 16:55764565-55764587 CAAGAGAAACTGAGGCCTAGAGG + Intergenic
1138288627 16:55829084-55829106 CAAGAGAAACTGAGGCCTAGAGG - Intronic
1139658356 16:68403045-68403067 CTGTAGGAACAAAGGCCCTGGGG - Intronic
1139887150 16:70216511-70216533 CAGCAGATGCAAAGGCCCTGAGG + Intergenic
1139911229 16:70398794-70398816 CAGGAGAGGCAGAGCCTCTGTGG - Exonic
1141295362 16:82763115-82763137 CAGCACATACAAAGGCCCTGCGG - Intronic
1141320952 16:83008401-83008423 CAGCAGATGCAAAGGCCCTGAGG + Intronic
1141346195 16:83248276-83248298 AAGGAGAAACAGAGGCAGGGGGG + Intronic
1141440225 16:84025337-84025359 CAGCAGTAGCAAAGGCCCTGAGG - Intronic
1141620972 16:85236213-85236235 AGGGAGAAACTGAGGCCCGGAGG + Intergenic
1141649937 16:85387422-85387444 CAGCAGATGCAAAGGCCCTGGGG - Intergenic
1141699098 16:85634324-85634346 CAGGAGAGACAGAAGCACAGAGG - Intronic
1141714640 16:85719754-85719776 CAGCACACACAAAGGCCCTGAGG + Intronic
1141714651 16:85719801-85719823 CAGCACACACAAAGGCCCTGAGG + Intronic
1141714662 16:85719848-85719870 CAGCACACACAAAGGCCCTGAGG + Intronic
1142188687 16:88706954-88706976 CAAGAAAAACAAAGGCTCTGGGG - Intronic
1142285456 16:89169793-89169815 AAGGAGAAACTGAGGCACGGGGG + Intergenic
1142408459 16:89904092-89904114 CAGGGGAAGCGGAGGCTCTGTGG - Intronic
1142496035 17:306807-306829 GGGGAGGAAAAGAGGCCCTGAGG - Intronic
1142567960 17:852846-852868 CTGGGGAAACAGTGGTCCTGAGG - Intronic
1142758411 17:2029152-2029174 CAGGAGAAAGACCAGCCCTGAGG + Intergenic
1142856825 17:2735378-2735400 ATGGAGAACCAGAGGCCCAGAGG + Intergenic
1143071299 17:4296249-4296271 AAGGAGAAACAGAGATCATGTGG - Intronic
1143516388 17:7421272-7421294 CAGGATACACATAGGCCCTTAGG - Exonic
1144394378 17:14829298-14829320 CTGGACAAACAGAGGTACTGGGG - Intergenic
1144743586 17:17598216-17598238 CAGGAGGTGCAAAGGCCCTGTGG - Intergenic
1144891738 17:18498203-18498225 CAGCAGATACAAAGGCCCGGGGG - Intergenic
1145007312 17:19344921-19344943 AAGGAGAAACTGAGGCGCAGGGG - Intronic
1145140484 17:20446114-20446136 CAGCAGATACAAAGGCCCGGGGG + Intergenic
1145212386 17:21023812-21023834 CAGGGGAAACTGAGGCTCAGAGG - Intronic
1145273816 17:21418439-21418461 CAGGAGACAGAGAGGGGCTGGGG + Exonic
1145795717 17:27654298-27654320 CAGGAGACAACGCGGCCCTGGGG + Intergenic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1146293525 17:31630448-31630470 GAGGATAAGCAGAGGCACTGGGG - Intergenic
1146533921 17:33633480-33633502 CAGCAGAAACAGGCTCCCTGTGG - Intronic
1146662716 17:34675281-34675303 CATGAGAAATAGAGGCTCTGGGG + Intergenic
1147536604 17:41326157-41326179 CAGGAGGAACAGAGGTGCTCAGG - Intergenic
1147652697 17:42071434-42071456 CAGGAGGGACTGAGGCCCTCTGG - Intergenic
1147853461 17:43460076-43460098 CAGCAGGTACAAAGGCCCTGAGG - Intergenic
1147936332 17:44013334-44013356 AAGTAGAAACTGAGGCCCAGAGG + Intronic
1148050921 17:44769628-44769650 CGGGAGCAACAGTAGCCCTGGGG - Intronic
1148163310 17:45464253-45464275 CAGGACAGACAAAGGCCCTTTGG - Intronic
1148329620 17:46805964-46805986 GATGAGAAACTGAGGCCCTGAGG - Intronic
1148550152 17:48545298-48545320 CTGGAGAAACGGAGGCATTGGGG - Intergenic
1148673604 17:49431925-49431947 CAGGAGCTCCAGAGGGCCTGTGG + Intronic
1148816311 17:50330442-50330464 CAGGACAAGCACAGGTCCTGTGG - Intergenic
1149264007 17:54908011-54908033 AAAGAGAAACAGAGGGCCAGAGG - Intronic
1150485121 17:65537876-65537898 CAGAAGGGCCAGAGGCCCTGGGG + Intronic
1151577060 17:74958226-74958248 CAGGAGGGACAGAGGCACCGTGG + Intronic
1151801820 17:76383580-76383602 TAGGAGAAACCAAGCCCCTGCGG - Intronic
1152099129 17:78290881-78290903 CAGTACATACAAAGGCCCTGTGG - Intergenic
1152261559 17:79269972-79269994 GAGAAGCAGCAGAGGCCCTGAGG - Intronic
1152283287 17:79397869-79397891 AACCACAAACAGAGGCCCTGGGG + Intronic
1153480805 18:5544059-5544081 CAGGAGACACCGAGGCTCCGCGG + Exonic
1156192699 18:34738108-34738130 CAGCAGAAGCAAAGGCCCTGAGG + Intronic
1157248176 18:46071771-46071793 CAGGCGAAGCAGAGACCCTTAGG - Intronic
1157951638 18:52044674-52044696 GAGGAGAAAGAGTGGCACTGAGG + Intergenic
1159654006 18:71010503-71010525 CTGGAGAAAAAGTGGCACTGGGG + Intergenic
1160103761 18:75949113-75949135 GAGGAGCAACAGAAACCCTGTGG + Intergenic
1160304462 18:77718626-77718648 CAGGACCCACAGAGACCCTGAGG - Intergenic
1160747480 19:718909-718931 CAGGGGAGACACAGGCTCTGAGG + Intronic
1160919420 19:1512908-1512930 CGGGGGAAACTGAGGCCCAGAGG - Intronic
1160982028 19:1820595-1820617 CATGGGAAACTGAGGCCATGGGG + Intronic
1161162297 19:2768166-2768188 CAGCAGAGAGAGGGGCCCTGTGG - Intronic
1161348331 19:3778816-3778838 CTGGAGAAACTGAGGCCCAGAGG + Intronic
1161495576 19:4584234-4584256 CCGGGGAAACTGAGGCCCAGCGG - Intergenic
1161562451 19:4981162-4981184 GCGGAGACACAGGGGCCCTGTGG - Intronic
1161777952 19:6274046-6274068 CAGGCGACACTGATGCCCTGGGG + Intronic
1162087107 19:8255563-8255585 CAAGGGTCACAGAGGCCCTGTGG - Intronic
1162151214 19:8646903-8646925 CAGGAAGAACACAGGCCCTGAGG + Intergenic
1162535527 19:11261487-11261509 CAGGTGAAAGAGCTGCCCTGTGG - Intronic
1162536884 19:11267941-11267963 CAGGGGACAGAGAGGCACTGAGG - Intergenic
1162935349 19:13979083-13979105 GAGGACAAACAGAGACACTGGGG + Intronic
1163530202 19:17844284-17844306 AAGGAGAAAGATAGGCGCTGGGG + Exonic
1163648921 19:18505882-18505904 AGGGAGAAACTGAGGCCCAGAGG + Intronic
1163904777 19:20142920-20142942 GAGGAGAAAAACAGGCACTGAGG + Intergenic
1164079658 19:21851584-21851606 CAGGAGGAGCTGCGGCCCTGGGG - Intronic
1164548262 19:29186724-29186746 CAGGAGACACTCAGACCCTGAGG + Intergenic
1164818395 19:31224959-31224981 CAGGGGGAACAGGGGCCCTGGGG - Intergenic
1164826421 19:31287871-31287893 CAGGAGGAAAGGAGGCCCGGAGG - Intronic
1165334804 19:35162245-35162267 GAGGAGGAAGAGAGGCCCTGGGG - Intronic
1165765195 19:38346212-38346234 CAGGAGAAACAGAGGCCCTGAGG + Intronic
1165996434 19:39847089-39847111 CTGCAGATGCAGAGGCCCTGAGG + Intergenic
1166313653 19:41976666-41976688 CAGGAGAGCCAGAGGACCAGGGG + Intronic
1166523102 19:43494672-43494694 ATGGGGAAACAGAGGCCGTGGGG + Intronic
1166936658 19:46337685-46337707 CAGGATATGCAAAGGCCCTGAGG - Intronic
1167112255 19:47469341-47469363 CAGGAGAAACAGGGGCCAGCCGG + Intronic
1167381573 19:49141316-49141338 CCGGAAAGGCAGAGGCCCTGAGG - Intronic
1167505918 19:49871046-49871068 GAGGGGAAACTGAGGCACTGAGG - Intronic
1167553274 19:50175774-50175796 CAGGAGAAATAGTGTCCCTCAGG - Intergenic
1168105967 19:54165858-54165880 TGAGAGAAACAGAGGCCCTGAGG + Intronic
1168310306 19:55456614-55456636 CAGCAGACACAGAGACCTTGAGG - Intronic
1168412059 19:56146438-56146460 CAGGGGAAACCGAGGCACAGAGG + Intronic
1168467861 19:56618683-56618705 CAGTGGATGCAGAGGCCCTGAGG + Intronic
924971162 2:128198-128220 CAGGGGCAGCAGAGGCCCTGGGG + Intergenic
925723347 2:6849457-6849479 TAGGAGAAGCAGAGGCTCCGGGG + Exonic
926148586 2:10411905-10411927 CAGGAGAACAACAGGCCCAGAGG - Intronic
926855998 2:17256771-17256793 CAGGGGAAAGTGAGGACCTGTGG + Intergenic
927099286 2:19775538-19775560 CAGGAAAGACAGAGTCCCTCTGG + Intergenic
927236991 2:20883499-20883521 CAGGAGAGACGCAGGCACTGAGG - Intergenic
927702130 2:25275464-25275486 CAGGATCCACAGAGCCCCTGGGG + Intronic
928021499 2:27708552-27708574 CAGCAGGAACAAAGGCCCCGGGG - Intronic
928421509 2:31140481-31140503 ATGGGGAAACTGAGGCCCTGGGG + Intronic
929572277 2:43030141-43030163 CAGGAGTTGCAAAGGCCCTGAGG - Intergenic
929901328 2:46006076-46006098 TGGGATGAACAGAGGCCCTGGGG - Intronic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931654753 2:64500822-64500844 CAGGCCAAACAGAGGCCCTGTGG + Intergenic
932445145 2:71776149-71776171 CATGAGGAGCAGAGGCCATGAGG - Intergenic
933512209 2:83255276-83255298 CAGAAGAAACAGAGGACATAAGG + Intergenic
933656178 2:84888739-84888761 CAGCAGAGACAAAGGCCTTGAGG + Intronic
933699226 2:85242800-85242822 AAGGGGATATAGAGGCCCTGGGG - Intronic
934516628 2:94992122-94992144 GAGGAGAATCAGAGACCCTGGGG + Intergenic
934815577 2:97323468-97323490 CAGGGGAGGGAGAGGCCCTGGGG + Intergenic
934822118 2:97385015-97385037 CAGGGGAGGGAGAGGCCCTGGGG - Intergenic
935192397 2:100789334-100789356 CAGGAGAAAAGTAAGCCCTGAGG + Intergenic
935512657 2:103995262-103995284 CTGGGGAAACAGAGGCCCAGAGG - Intergenic
935702184 2:105822257-105822279 CAGGAGCAGCAGAGGCCCTCGGG - Intronic
936083481 2:109451076-109451098 CAGGAGGTGCTGAGGCCCTGCGG - Intronic
937134540 2:119541628-119541650 AAGGAGACAGAGAGACCCTGGGG - Intergenic
937140626 2:119596805-119596827 GAGGTGAAAGAGAAGCCCTGAGG - Intronic
937322456 2:120969009-120969031 GAGGAGAAAGACAGGACCTGTGG + Intronic
937549989 2:123076025-123076047 GAGAAGAGACAGAGGCCATGAGG - Intergenic
937829375 2:126403075-126403097 CTGGTGGGACAGAGGCCCTGGGG - Intergenic
937856927 2:126678887-126678909 CAGGAGCAGCAGAGCCCGTGTGG - Intronic
938017640 2:127880716-127880738 AAGATGAAACAGATGCCCTGCGG - Intronic
938655314 2:133425498-133425520 CACTGGAAACAGATGCCCTGTGG + Intronic
939102998 2:137916823-137916845 CTGCTGAAACAGAGGCTCTGGGG + Intergenic
939331341 2:140765623-140765645 CAGAAGAAAAAAAGACCCTGTGG - Intronic
939464509 2:142540165-142540187 CAGTTGCAACAGAGACCCTGTGG + Intergenic
940023322 2:149179201-149179223 CAGGAGAAATTGAGGCTCTCAGG - Intronic
940083349 2:149829595-149829617 CAGTAAGAACAGAGGCCCTTAGG - Intergenic
940984809 2:160042330-160042352 CAGGAGACAGTGAGGACCTGAGG - Intronic
941038880 2:160598385-160598407 AAGGAGAAATAGAGGCCAAGTGG - Intergenic
941429735 2:165399534-165399556 TATCAGAAACAGAGGCTCTGTGG + Intergenic
941613115 2:167685552-167685574 AAGCAGATGCAGAGGCCCTGAGG + Intergenic
941676332 2:168346861-168346883 CAGGAGAAACAAAGGCGCGTCGG + Intergenic
941813304 2:169775535-169775557 CAGTAGGTACAAAGGCCCTGAGG + Intronic
942302305 2:174573649-174573671 CAGCAGGTGCAGAGGCCCTGAGG + Intronic
942315300 2:174692125-174692147 ATGAAGAAACTGAGGCCCTGAGG + Intergenic
942752082 2:179299608-179299630 CAGGAAGAACAAAGGCTCTGAGG - Intergenic
943520953 2:188948997-188949019 CAGGAGAAACAGTTTCCTTGGGG + Intergenic
944318260 2:198306776-198306798 CAAGAAAAACAGAGGCCATCAGG - Intronic
944427064 2:199594638-199594660 TAGGAGTTACACAGGCCCTGAGG - Intergenic
944710166 2:202328378-202328400 CAAGAGATACAGAGGCCATGAGG - Intergenic
945312785 2:208334336-208334358 CAGGTGAAACAGACACCCTTTGG - Intronic
945862333 2:215138352-215138374 CAGCAGAAACAGAAGAACTGTGG - Exonic
946146585 2:217735585-217735607 CAGCAGGAGCAAAGGCCCTGAGG - Intronic
947733682 2:232444167-232444189 CAGGGGACACAGAGGTGCTGGGG + Intergenic
947742133 2:232489530-232489552 GAGGAGAGACTGAGGGCCTGGGG - Intergenic
948157952 2:235799897-235799919 CAGAAGAAGAAGAGGGCCTGTGG - Intronic
948486309 2:238283501-238283523 CAGCACACACAAAGGCCCTGCGG + Intronic
948742008 2:240054337-240054359 CAGGAGCAAGAGAGGCAGTGAGG - Intergenic
949035028 2:241812310-241812332 AAGGGGAAACCGAGGCCCAGGGG - Intronic
1168874900 20:1164664-1164686 CTGGGGAAAGAGAGGCACTGAGG - Intronic
1169366562 20:4997369-4997391 CAGCAGATACAAAGGCCCTGAGG - Intronic
1170135789 20:13072350-13072372 CAAATCAAACAGAGGCCCTGGGG - Exonic
1170365170 20:15590320-15590342 CTGAAGAAACAAAGGCCCAGAGG + Intronic
1171100537 20:22379625-22379647 CTGGAGGATGAGAGGCCCTGGGG - Intergenic
1171167476 20:22984669-22984691 CCGTAGAAACTGAGGCTCTGCGG - Intergenic
1171481359 20:25458108-25458130 GGGGAGCAGCAGAGGCCCTGGGG - Intronic
1172201447 20:33129489-33129511 CAGTACATGCAGAGGCCCTGGGG - Intergenic
1172286701 20:33745779-33745801 CAGCAGATGCAGAGGCCTTGAGG + Intronic
1172434706 20:34920822-34920844 CTGGAGAAAGAGAAGTCCTGAGG + Intronic
1172577693 20:36021923-36021945 GAGGAGAAACAGAGGCCTGCAGG + Intronic
1172590709 20:36115960-36115982 CAGGGGAAACTGAGGCTCAGAGG + Intronic
1172600666 20:36180406-36180428 AAGGAGAAGCAGGGGCCCAGAGG - Intronic
1172649115 20:36490654-36490676 CAAGAGGAACAGGTGCCCTGGGG - Intronic
1172857240 20:38014821-38014843 AAGGATAAACAGAGGGCTTGAGG + Intronic
1172876341 20:38166531-38166553 CCGGAGAGACAGAGGCCCACGGG + Intronic
1172914748 20:38435131-38435153 CGGGGGAAACTGAGGCCCCGGGG - Intergenic
1172916373 20:38446878-38446900 AAGGGGAAACTGAGGCCCCGAGG + Intergenic
1173026192 20:39309715-39309737 CATGTGAAACAGATCCCCTGGGG + Intergenic
1173598467 20:44275548-44275570 CAGCAGAGACAAAGGCCCGGAGG + Intronic
1173819283 20:46010236-46010258 AAGGAGAAACAGAGGCTCAGAGG - Intronic
1173855525 20:46248122-46248144 GAGGGGAAACTGAGGCCCAGAGG - Intronic
1173964358 20:47100559-47100581 AAGGAGAAACTGAGGCTCAGAGG + Intronic
1174088236 20:48025468-48025490 CAGGAGAAACACAGACCCCTGGG - Intergenic
1174202859 20:48819327-48819349 CAGCAGATGCAAAGGCCCTGAGG - Intronic
1174252580 20:49230723-49230745 CTGCAGTCACAGAGGCCCTGTGG - Intronic
1174404223 20:50293278-50293300 CTGGAGAAACTGAGGCACAGAGG + Intergenic
1174454576 20:50640193-50640215 CTGGAGTGGCAGAGGCCCTGTGG - Intronic
1174472221 20:50769528-50769550 CTGGAGTGGCAGAGGCCCTGTGG + Intergenic
1174487440 20:50870339-50870361 CAGGGCAAACGGAGGCCCTGAGG + Intronic
1174545035 20:51318766-51318788 CCGCACAAACAAAGGCCCTGGGG + Intergenic
1174945838 20:54984269-54984291 CAGCAGAAGCAAAGGTCCTGGGG - Intergenic
1175163018 20:57022653-57022675 CAGCAAACACAGAGGCCTTGTGG - Intergenic
1175404322 20:58716909-58716931 CAGAAGAGGCAGAGGTCCTGAGG + Intronic
1175488725 20:59364405-59364427 CAGGATAGGCAAAGGCCCTGGGG - Intergenic
1175540278 20:59743801-59743823 CAGGAAGAAGAGAGGCCCAGAGG - Intronic
1175564793 20:59964868-59964890 AAGGGGAAACTGAGGCCCAGAGG + Intronic
1175858105 20:62133570-62133592 CAGGAAGAAGAGAGGCCCAGAGG + Intronic
1176022323 20:62968125-62968147 TAGGAGACACAGAGACTCTGAGG - Exonic
1177747939 21:25243754-25243776 CAGAAGAAATAGAGTCCCAGAGG - Intergenic
1177760574 21:25398577-25398599 CAGCAGACACAGAGGGCCTGAGG + Intergenic
1178000137 21:28152676-28152698 CAGGAGAGACAGAGAGACTGAGG - Intergenic
1178581124 21:33839477-33839499 CAGGACAAGCAAAGGCCCAGGGG + Intronic
1178891811 21:36526194-36526216 CAGGTGCAACAGAGACACTGTGG - Intronic
1179036002 21:37759233-37759255 AGGGAAAGACAGAGGCCCTGTGG - Intronic
1179195726 21:39160792-39160814 CAGAAGGAACAGAAACCCTGGGG - Intergenic
1179455367 21:41495837-41495859 CAGCAGATGCAGAAGCCCTGGGG - Intronic
1179939046 21:44626615-44626637 CAGGAGGCACAGAGGCCATGGGG + Intronic
1180244724 21:46539386-46539408 CAAGAGAATGAGAGGCTCTGGGG - Intronic
1180937725 22:19637122-19637144 CATGAGAAACAGATTTCCTGAGG - Intergenic
1181037698 22:20177930-20177952 CAGGAGCCACAGTGGCCTTGGGG - Intergenic
1181530318 22:23513618-23513640 CAGCAGAAGCAAAGGCCCAGTGG + Intergenic
1181935517 22:26435631-26435653 CAGGAGAAGCAGAGCTGCTGAGG - Intronic
1181971722 22:26695666-26695688 CAGCAGGAGCAAAGGCCCTGAGG + Intergenic
1182063666 22:27415728-27415750 CAGGAGGACCTGGGGCCCTGGGG + Intergenic
1182370488 22:29806934-29806956 TAGGAGACAAAAAGGCCCTGAGG + Intronic
1182372474 22:29821129-29821151 AAAGAGAAACAGAAGCACTGTGG - Intronic
1182391288 22:29999088-29999110 CAGAAAAAACAGAGGCCTAGAGG - Intronic
1182541757 22:31046873-31046895 CAGGAGAAAGGCAGCCCCTGAGG + Intergenic
1182805476 22:33066383-33066405 GAGGAGGAACAGAGACCCAGAGG - Intergenic
1183030410 22:35099724-35099746 CAGGAGACAGACTGGCCCTGTGG + Intergenic
1183317537 22:37145192-37145214 CAGGGGAAACTGAGGCACAGAGG + Intronic
1183440279 22:37819001-37819023 CTGCAGAATCAGAGGCTCTGAGG + Intergenic
1183587126 22:38759321-38759343 CAGGAGTAGGAGAGGCCTTGGGG - Intronic
1183587474 22:38761190-38761212 CCAGGGAAACAGAGGCACTGGGG - Intronic
1183982613 22:41550672-41550694 CAGGAGAAAGAGAGTCACTCAGG + Intergenic
1184136002 22:42550220-42550242 CTGGAGTAACAGAGGCATTGAGG - Intergenic
1184387024 22:44182170-44182192 GTGAAGAAACTGAGGCCCTGGGG + Intronic
1184849193 22:47110126-47110148 CAGGAAACACAGAGACCCTGTGG - Intronic
949757250 3:7426446-7426468 CAGCATATACAAAGGCCCTGTGG - Intronic
949946472 3:9193646-9193668 CATGAGAAACAAAGGCTCTGGGG + Intronic
950434846 3:12973284-12973306 CAGGATAAGCAAAGGCACTGGGG - Intronic
950454872 3:13086674-13086696 CAGCAGATGCAAAGGCCCTGAGG - Intergenic
950582564 3:13872008-13872030 CAGTAGATGCAAAGGCCCTGAGG - Intronic
950660442 3:14463784-14463806 CTGGAGAAACTGAGGCCTGGAGG + Intronic
952831004 3:37565007-37565029 CAGGAGAGCCACAGGCCCTCAGG - Intronic
952894848 3:38071580-38071602 AAGGAGAAAAACTGGCCCTGAGG + Intronic
953034710 3:39201714-39201736 CAGGAGTCCCAGAGGCCATGTGG + Intergenic
953999178 3:47542653-47542675 ATGGAGAAACAGAAACCCTGGGG - Intergenic
954145433 3:48632067-48632089 CAGGAGAGGCAGGGGTCCTGGGG + Intronic
954371949 3:50173703-50173725 AAGGGGAGACTGAGGCCCTGAGG - Intronic
954379372 3:50211437-50211459 CAGCATAGGCAGAGGCCCTGAGG - Intronic
954432664 3:50479548-50479570 GGGGTGACACAGAGGCCCTGAGG + Intronic
954741220 3:52752293-52752315 CAGGAGAAACCCAGGGCCTCTGG - Exonic
954810557 3:53244684-53244706 CAGGAAAAACTCTGGCCCTGAGG - Intronic
955978291 3:64498779-64498801 CAGGAGATGCAAAGGCCCTGTGG - Intergenic
956041641 3:65151317-65151339 CAGGAGACACAGAGGTCTAGTGG + Intergenic
956750853 3:72342717-72342739 CAGCACACACAAAGGCCCTGAGG - Intergenic
957025526 3:75177454-75177476 CAGGAAGTGCAGAGGCCCTGAGG - Intergenic
957054472 3:75433503-75433525 CAGGATATGCAAAGGCCCTGTGG - Intergenic
957577589 3:82029594-82029616 CACGAGAAGCAGAGACCCAGGGG + Intergenic
958526637 3:95269357-95269379 CAAGAGAGAGAGAGGACCTGTGG - Intergenic
959814411 3:110658474-110658496 CAGCAGAAGCAGAGAACCTGAGG + Intergenic
959845374 3:111026534-111026556 CAGGTGAAACACAGGGCATGAGG - Intergenic
960221920 3:115122594-115122616 CAGGACAAATAAAGGCACTGAGG - Intronic
960386143 3:117023964-117023986 CAGGAGAAAAAAAGGCCCATGGG - Intronic
961300374 3:125918202-125918224 CAGGATATGCAAAGGCCCTGTGG + Intergenic
961333462 3:126156483-126156505 CAGGAGGGAAGGAGGCCCTGGGG - Intronic
961666944 3:128498441-128498463 CAGTAGACTCAAAGGCCCTGGGG - Intergenic
961888135 3:130109865-130109887 CAGGATATGCAAAGGCCCTGTGG - Intronic
962271229 3:133979399-133979421 CAGGAGAAGCAGAGGAACAGGGG - Intronic
962418714 3:135208103-135208125 CAGCATATACAAAGGCCCTGTGG + Intronic
962499387 3:135974609-135974631 TAGGAGAAACAAAGGTCCTGTGG - Intronic
962528717 3:136258770-136258792 AAGGTGAAGGAGAGGCCCTGTGG + Intronic
962855662 3:139342630-139342652 CAGGAAAAACATAGCCACTGAGG + Intronic
963119469 3:141763916-141763938 CAGAAGAAACAGTGTCCTTGGGG - Intergenic
963504934 3:146172347-146172369 CAGGAGAGACAGAGGATCTGAGG + Intergenic
964212786 3:154246633-154246655 CAGGAACAACAGGGGCCCTGGGG + Intronic
964539551 3:157764368-157764390 CATGAGATAAAGTGGCCCTGAGG + Intergenic
965643461 3:170855777-170855799 AAGGGGAAACTGAGGCCCAGAGG + Intronic
967456212 3:189689435-189689457 GTGGAGAAACTGAGACCCTGAGG + Intronic
967855550 3:194114866-194114888 ATGGAGAAACTGAGGCCCAGAGG + Intergenic
968273786 3:197424574-197424596 CTAGAGACACAGAGGCCCGGGGG - Intergenic
968625338 4:1624359-1624381 GTGGAGAAACTGAGGCTCTGAGG + Intronic
968809915 4:2795173-2795195 CAGGACATACAGCGGCCCTGAGG - Intronic
968968281 4:3780575-3780597 CTGGAGAAGGAGAGGCCCTGTGG + Intergenic
968997285 4:3953813-3953835 CAGGATATGCAAAGGCCCTGTGG - Intergenic
969014405 4:4094093-4094115 CAGGATATGCAAAGGCCCTGTGG + Intergenic
969189047 4:5502250-5502272 CAGCTGCAACAGAGACCCTGTGG + Intergenic
969303381 4:6310463-6310485 GAGGAAGAACAGAGGCACTGGGG + Intergenic
969337369 4:6519536-6519558 CAGCAGATGCAAAGGCCCTGTGG - Intronic
969428636 4:7140164-7140186 CAGCAGAAACAGAGAGGCTGAGG + Intergenic
969688574 4:8690661-8690683 CAGAAGCAGCAAAGGCCCTGGGG + Intergenic
969756729 4:9154869-9154891 CAGGATATGCAAAGGCCCTGTGG + Intergenic
969833134 4:9814982-9815004 CTGGAGACAGAGAGGTCCTGTGG + Intronic
969935887 4:10680743-10680765 AAGGATAAACAGAGGTTCTGAGG + Intronic
970054393 4:11953860-11953882 CAGGAGAAACAGTGTTCATGGGG + Intergenic
970225013 4:13848897-13848919 CAGGAGAAAGAGAGGCAGGGAGG - Intergenic
971317122 4:25576862-25576884 CAGCAAAAGCAGAGCCCCTGAGG - Intergenic
972067151 4:34962456-34962478 CAGGAGAGTCAGAGGTCCTGTGG - Intergenic
972273908 4:37539294-37539316 CAGGAGAACCACAGGACCAGTGG - Intronic
972615490 4:40694238-40694260 CAGGGGAGACAGAGGCCCACTGG + Intergenic
973015130 4:45128586-45128608 CAGGAGAAACAACGGCCTTTAGG + Intergenic
973878870 4:55248755-55248777 CAACAGATATAGAGGCCCTGAGG + Intergenic
975496446 4:75040828-75040850 CAGCAAGTACAGAGGCCCTGAGG - Intronic
975695892 4:77012760-77012782 CAGTTGAGACAGAGGCCTTGGGG - Intronic
976831256 4:89317349-89317371 CAGAAGACTCAAAGGCCCTGGGG + Intergenic
977525415 4:98140171-98140193 CAGCAGATACAGAGGCACAGAGG + Intronic
977666226 4:99649907-99649929 GGGGAGAAGCAGAGGACCTGAGG + Exonic
978200479 4:106019188-106019210 CTGGTGGATCAGAGGCCCTGGGG - Intergenic
979611233 4:122691057-122691079 CAGGAGAGACAAAGGACCTTTGG - Intergenic
980686439 4:136236406-136236428 CAGGAGAAAGAGAGAGCATGAGG - Intergenic
981882406 4:149630440-149630462 CAAGAAAGACAGAGGTCCTGGGG + Intergenic
982495913 4:156091979-156092001 CAGCAGATACAAAGGTCCTGTGG + Intergenic
982542975 4:156697752-156697774 AAAGAGAAACGGGGGCCCTGTGG + Intergenic
984198117 4:176684569-176684591 CAGGTGAAACAGAGGCATTCTGG + Intronic
985255026 4:188061358-188061380 CTGCAGAAACAGAGGCCCGCTGG - Intergenic
985574899 5:669483-669505 CAGGACAGACAGAGGCCCCAAGG - Intronic
985748610 5:1661789-1661811 TGGGAGAAACAGGGGCTCTGAGG - Intergenic
985761707 5:1752303-1752325 CAGTGGAAACCGAGTCCCTGGGG - Intergenic
986264647 5:6181385-6181407 CAGCAGAACCATATGCCCTGTGG - Intergenic
986694670 5:10340964-10340986 CAGTAGAAACACAGCACCTGTGG + Intergenic
986824395 5:11504948-11504970 CAGGACAAAAGGAGGCCATGTGG - Intronic
987236747 5:15950398-15950420 CAGCAAAAACAAAGGCCTTGAGG + Intergenic
987754969 5:22088600-22088622 CAGGGGAAACAGAGGCCAAAAGG + Intronic
989724732 5:44574773-44574795 CAGGATACACAGGGGCCCTGTGG - Intergenic
991052201 5:62285272-62285294 CAGGACATACAAAGGCCTTGAGG - Intergenic
991478281 5:67047405-67047427 CAGCAAGAGCAGAGGCCCTGAGG - Intronic
991540853 5:67726585-67726607 AAGGAGAAAGAGAGGTCATGAGG + Intergenic
991664375 5:68983521-68983543 CAGGAGCAACATTGCCCCTGTGG + Intergenic
991960668 5:72040759-72040781 AAGGACAAAGGGAGGCCCTGGGG + Intergenic
992621864 5:78601825-78601847 CAGGATGAACACAGGCTCTGAGG - Intronic
993733619 5:91450306-91450328 CAGAAGAAAGAGAATCCCTGGGG + Intergenic
993868385 5:93221381-93221403 GAGCAGAACCAAAGGCCCTGTGG + Intergenic
994043916 5:95286486-95286508 CAGCAGATACAGAGGTCCTGAGG + Intergenic
996017171 5:118552598-118552620 CAGGATAATCAGAGCCACTGGGG + Intergenic
996128130 5:119749939-119749961 CAGGCAACACAAAGGCCCTGAGG - Intergenic
996686075 5:126282318-126282340 CAGGTAACACTGAGGCCCTGAGG - Intergenic
997156490 5:131565788-131565810 CAGAAGAAACAAAGGCAGTGGGG + Intronic
997468333 5:134102834-134102856 CAGGGGAAACTGAGGCCCAGAGG - Intergenic
998370313 5:141656490-141656512 GAGAAGAAAGTGAGGCCCTGGGG - Exonic
998885221 5:146686957-146686979 ATGGAGAAACAAAGGCCTTGAGG - Intronic
998946122 5:147341183-147341205 CAGGTGAAAAAGAGGCCCAGAGG - Intronic
999133404 5:149301256-149301278 CCAGAGGGACAGAGGCCCTGAGG - Intronic
999241705 5:150131794-150131816 CTGGGGAAACTGAGGCCCAGAGG + Intronic
999247692 5:150163924-150163946 CAGTATGAACAGAGGCCCTGAGG - Intergenic
999266178 5:150268352-150268374 CAGCAGGTACAGAGGCCCTGAGG - Intronic
999286040 5:150394946-150394968 CAGCAGAAACGTAGGCTCTGGGG + Intronic
1000459549 5:161497775-161497797 AAGGAGACAGAGAGGCCTTGGGG + Intronic
1001100956 5:168813959-168813981 CAGGAGGAAAAGAGGCATTGGGG - Intronic
1001604091 5:172947700-172947722 GAGGGGAAACTGAGGCCCTGGGG - Intronic
1002122995 5:177020226-177020248 CAGCAGGTACAAAGGCCCTGAGG - Intronic
1003524971 6:6889970-6889992 GAGGGGAAACTGAGGCTCTGAGG - Intergenic
1003909205 6:10728027-10728049 CAGTATATGCAGAGGCCCTGTGG - Intronic
1003912423 6:10754426-10754448 CAGTATATGCAGAGGCCCTGTGG - Intronic
1004297188 6:14423526-14423548 GTGGAGAAACAGGGTCCCTGGGG - Intergenic
1004360428 6:14966029-14966051 ACGGAGAAACAGAGGCCAGGCGG + Intergenic
1006451387 6:34107664-34107686 CAGCAGGTACAAAGGCCCTGTGG + Intronic
1006607079 6:35265687-35265709 CAGCAAACACAAAGGCCCTGAGG + Intronic
1006818516 6:36871076-36871098 GAGCAAACACAGAGGCCCTGAGG - Intronic
1006934843 6:37710162-37710184 CAGAAGGTACAAAGGCCCTGAGG + Intergenic
1007207226 6:40162786-40162808 CAGGAGAACCAGGGGCCTGGAGG - Intergenic
1007240042 6:40418199-40418221 CAGCACATACAGAGGCCCTGGGG - Intronic
1007468062 6:42069046-42069068 CAGCAGATGCAAAGGCCCTGAGG + Intronic
1007698899 6:43753381-43753403 CAGGAGAAACAGAGAAACTAAGG - Intergenic
1007932826 6:45707861-45707883 CAGAAGGCACACAGGCCCTGTGG + Intergenic
1008303249 6:49869312-49869334 AAGGATAATCAGAAGCCCTGTGG - Intronic
1008570966 6:52816228-52816250 CAGGAGATTCAGAGACCGTGTGG + Intergenic
1008778394 6:55069737-55069759 GAGCAGGAACAAAGGCCCTGAGG + Intergenic
1010139521 6:72598061-72598083 CATGAAAAACATAGGACCTGGGG - Intergenic
1010457548 6:76075683-76075705 CAGGAGAGAGAGAGGAACTGGGG + Intergenic
1010958459 6:82118210-82118232 CATGGAAAACAGAGCCCCTGGGG - Intergenic
1012959597 6:105608728-105608750 AATGAGCAACACAGGCCCTGAGG - Intergenic
1013081987 6:106821263-106821285 GTGGAGAAACTGAGGCCCAGAGG + Intergenic
1014087014 6:117358342-117358364 CAGGAGAAAAAGAGGTTTTGGGG - Intronic
1014135383 6:117883231-117883253 CAGTAGAAACAGAGGTTCTGAGG + Intergenic
1016488269 6:144567161-144567183 CAGGAGAAATAATGGCCCTATGG + Intronic
1017727650 6:157286720-157286742 CAGGAAAAGCAGCTGCCCTGGGG + Intergenic
1018163395 6:161069851-161069873 GAGGAGAAGCAGGGGCCTTGGGG + Intronic
1018173925 6:161163051-161163073 CAGGAGAACCAGAGCCTCTGGGG + Intronic
1018180409 6:161218099-161218121 CAAGAGAACCACATGCCCTGGGG + Intronic
1018595829 6:165479406-165479428 CAGGAACTGCAGAGGCCCTGAGG - Intronic
1019045467 6:169142172-169142194 CTGGGGAAACAGTGGCGCTGGGG - Intergenic
1019310151 7:356599-356621 CAGGAGGAACAAAGGCATTGAGG - Intergenic
1019394578 7:810626-810648 CAGGAGCAAGAGAGGCCGTGAGG + Intergenic
1019442646 7:1055242-1055264 CAAGGGAGGCAGAGGCCCTGCGG + Intronic
1019488881 7:1301871-1301893 AAGGAGAAACCGAGGCCCACGGG - Intergenic
1019668249 7:2263524-2263546 CGGGAGAAAGGGTGGCCCTGGGG + Intronic
1020416096 7:7947456-7947478 CAGGAAAAACAGATACCCTTAGG - Intronic
1020579280 7:9974019-9974041 CCGGAGCAACAGAGGACCTGTGG + Intergenic
1021106896 7:16647345-16647367 GAGAAGAAACAGTGGTCCTGGGG - Intronic
1021224934 7:18015380-18015402 AAGGAGAAACAGAGGGCATATGG + Intergenic
1022014806 7:26340379-26340401 TAGGAGATGCAGAGACCCTGTGG + Intronic
1022178062 7:27891340-27891362 TAGCTGAAACAGAGACCCTGTGG + Intronic
1022437440 7:30403038-30403060 CAGGAGCAACAGAGGGCGAGGGG - Intronic
1022642404 7:32200640-32200662 GTGAGGAAACAGAGGCCCTGTGG - Intronic
1022685706 7:32594250-32594272 CAAGAGAAACAGACTCCCAGGGG - Intergenic
1023374612 7:39543593-39543615 CAGCACAAGCAAAGGCCCTGGGG + Intergenic
1023595613 7:41826705-41826727 AAGGGGAAAGAGAGTCCCTGAGG + Intergenic
1023639042 7:42239204-42239226 CACGAGACTCAGAAGCCCTGTGG + Intergenic
1024109304 7:46129172-46129194 CATGAGAATCAGAGGACATGTGG - Intergenic
1024280384 7:47713868-47713890 CAGCTGGAACAGAGGCCATGTGG + Intronic
1024909252 7:54426607-54426629 GAAAAGAAAGAGAGGCCCTGCGG + Intergenic
1024946392 7:54811948-54811970 CACGAGCAGCAGCGGCCCTGTGG - Intergenic
1026479291 7:70764463-70764485 CAGGAGCGAGAGAGGCCCTGAGG + Intronic
1026877924 7:73890364-73890386 TGGGAGAGACAGAGTCCCTGTGG - Intergenic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1029448664 7:100628385-100628407 ACAGAGAAACAGAGACCCTGGGG - Intronic
1029579576 7:101426631-101426653 CTGGAGAAACTGAGGCTCAGAGG - Intronic
1032369110 7:131328242-131328264 CAGGAGAACCGGAAGCCCAGCGG + Intronic
1032695479 7:134332406-134332428 CAGCACAAACAGAGGCACAGAGG - Intergenic
1032703552 7:134403234-134403256 CAGCAGATGCAAAGGCCCTGTGG + Intergenic
1033038243 7:137894941-137894963 AAGGAGAAACTGAGGCCTGGTGG - Intronic
1033417837 7:141179881-141179903 CAGGAGAGACAGAGGAGTTGTGG - Intronic
1033451204 7:141463718-141463740 CAGTGCAAACAAAGGCCCTGAGG + Intronic
1033495025 7:141885678-141885700 TAGAAGAAATATAGGCCCTGAGG + Intergenic
1033681691 7:143601423-143601445 CAGGAGAATCCAGGGCCCTGGGG + Intergenic
1033703200 7:143860390-143860412 CAGGAGAATCCAGGGCCCTGGGG - Exonic
1034405052 7:150897406-150897428 CACCAGAGACAGAGACCCTGGGG + Intergenic
1035302992 7:157909600-157909622 CAGCAGGTACAAAGGCCCTGAGG - Intronic
1035384674 7:158462676-158462698 CGTGAGAAACACAGGGCCTGAGG - Intronic
1036379964 8:8230189-8230211 CAGGATATGCAAAGGCCCTGTGG + Intergenic
1036701964 8:11018909-11018931 CAGGAGAGACAGAGCACCTTTGG - Intronic
1037765589 8:21770505-21770527 AAGGGGAAACTGAGGCCCAGAGG - Intronic
1038695763 8:29804980-29805002 GAGCAGAAACAGAGTCCTTGAGG - Intergenic
1039007701 8:33059100-33059122 AAAGAGATACAAAGGCCCTGAGG + Intergenic
1039167992 8:34708007-34708029 CAGGAGCAAGAGAGAACCTGAGG + Intergenic
1039376686 8:37041649-37041671 CAGATGAGACAGAGGCCCTAAGG + Intergenic
1041222195 8:55663165-55663187 CAGAACAAGCAGAGGCACTGTGG - Intergenic
1041522198 8:58769157-58769179 CAGGAGCAACAGAGGCGGAGTGG + Intergenic
1041810416 8:61902468-61902490 CAGGGGGAGCAGAGCCCCTGTGG + Intergenic
1042533334 8:69835476-69835498 CAGGAAGAACAGAGGCACGGGGG + Intergenic
1043442750 8:80290714-80290736 CAGGAAGAACTGAGGACCTGGGG + Intergenic
1043545953 8:81315962-81315984 CTGGAGAAAGAGAGACCATGTGG - Intergenic
1045400586 8:101812770-101812792 TAGGAACTACAGAGGCCCTGAGG - Intronic
1046075181 8:109304825-109304847 GAGGAGAAAAACTGGCCCTGAGG - Intronic
1046162314 8:110383127-110383149 CAGCAAATACAGAGACCCTGAGG + Intergenic
1047127105 8:121974780-121974802 CAGAAGAGCCAGATGCCCTGAGG - Intergenic
1047141978 8:122151857-122151879 TAGGAGAAACACATGCCTTGTGG - Intergenic
1047190394 8:122674121-122674143 CAGGAGGAACAAAGACACTGAGG - Intergenic
1047200577 8:122761751-122761773 CAGAAGTAACAGAGGCCAAGTGG + Intergenic
1047592052 8:126336815-126336837 CTGGCTAACCAGAGGCCCTGAGG + Intergenic
1048396557 8:134019615-134019637 CAGGAGAGACAGATGCCATAGGG - Intergenic
1048715690 8:137266095-137266117 CAGTAAAAAGAGAGGCCCGGAGG - Intergenic
1049007010 8:139862196-139862218 CAGGAAGAGCTGAGGCCCTGGGG - Intronic
1049182128 8:141228315-141228337 GAGGAGAAACAGTGGCCCCCTGG - Exonic
1049936197 9:504118-504140 GAGGAGGTACAGAGGCGCTGGGG + Intronic
1050109715 9:2201779-2201801 CAGGAGAAAGAGAGCCAGTGGGG + Intergenic
1052206134 9:25843071-25843093 ATGGAGAAAGAAAGGCCCTGGGG - Intergenic
1053053920 9:34982481-34982503 CAGAAGAAGCTGATGCCCTGAGG + Exonic
1053159087 9:35801044-35801066 AAGGGGAAATAGAGACCCTGAGG - Intronic
1053435415 9:38070380-38070402 ATGGAGAAACTGAGGCCCAGAGG + Intergenic
1053449301 9:38179914-38179936 CAGGAGGAACGGAGGCTCTGGGG + Intergenic
1053451422 9:38197287-38197309 CAGGGGAAGCAAAGACCCTGGGG + Intergenic
1053543577 9:38999381-38999403 CAGGAGAGACAGGGTCTCTGTGG - Intergenic
1053808009 9:41822886-41822908 CAGGAGAGACAGGGTCTCTGTGG - Intergenic
1054622583 9:67364542-67364564 CAGGAGAGACAGGGTCTCTGTGG + Intergenic
1056516318 9:87353856-87353878 CAATAGTAACAGATGCCCTGGGG - Intergenic
1056821336 9:89844179-89844201 TTGGAGAAACAGAGGCTCGGGGG + Intergenic
1057131855 9:92659730-92659752 AAGGAGCAACAAAGGCCCTATGG + Intronic
1057725490 9:97565183-97565205 GAGGAGAAACTGAGGCCCAGAGG - Intronic
1057730392 9:97603217-97603239 CAGGAGAGACACAGGCCTCGGGG - Intronic
1057904827 9:98975384-98975406 AAGGGGAAACCGAGGCCCAGCGG + Intronic
1058528864 9:105886365-105886387 CAGGAGACACAGAGGCAGTTGGG - Intergenic
1058554901 9:106156745-106156767 CAGGAGAAACTGAAGCCCAAGGG + Intergenic
1059661091 9:116400958-116400980 CAGGAGATTTTGAGGCCCTGAGG + Exonic
1060530938 9:124346699-124346721 CAGGGGCCACAGTGGCCCTGAGG - Intronic
1061140908 9:128765942-128765964 CTGGAGACAGAGAGGCCTTGAGG + Intronic
1061475418 9:130862527-130862549 CAGCAGGTACAGAGGCCCTGAGG + Intronic
1061669163 9:132179021-132179043 AAGGAGAAACTGAGGCCCAGAGG + Intronic
1061713458 9:132503478-132503500 ATGGGGAAACAGAAGCCCTGGGG - Intronic
1061881703 9:133572195-133572217 CAGGGCAGGCAGAGGCCCTGGGG - Intronic
1062190370 9:135244942-135244964 CAGAACACACAGAGGCTCTGGGG + Intergenic
1062204238 9:135326970-135326992 CAGGAGCCACAGCAGCCCTGTGG - Intergenic
1062226843 9:135457210-135457232 ATGGAGAAACAGAGGCACAGGGG - Intergenic
1062436732 9:136549660-136549682 CAGCAGAACCTGAGGCCCGGCGG - Intergenic
1062449508 9:136609567-136609589 CTGGAGGAACAGTGGCTCTGAGG + Intergenic
1062635791 9:137490471-137490493 GAGAAGCAACAGAGGCCATGAGG + Intronic
1185595760 X:1305743-1305765 CAGGAGAAACTGAGGCAGGGTGG + Intronic
1186611553 X:11142816-11142838 CAGAAGGGAAAGAGGCCCTGTGG + Intronic
1187437841 X:19288971-19288993 CATGGGAAACTGAGGTCCTGTGG - Intergenic
1191740460 X:64432267-64432289 CAGGAGTCACAGAAGTCCTGGGG - Intergenic
1193249356 X:79270204-79270226 CATGAGAAACTGAGGCCCTGAGG - Intergenic
1193887353 X:86998802-86998824 CAGAAGAAAGAGAGACCATGGGG + Intergenic
1193944408 X:87715789-87715811 AACCAGAAACAGAAGCCCTGTGG + Intergenic
1194972375 X:100358340-100358362 AATGAGAAACACAGGCCATGTGG + Intronic
1197970444 X:132109882-132109904 AAGGAGAAAATGAGACCCTGGGG + Intronic
1198999324 X:142615558-142615580 CAAGGGAAACACAGGTCCTGAGG - Intergenic
1199142616 X:144331362-144331384 CAGGAGAATCAGAGGACAAGTGG + Intergenic
1200914246 Y:8557370-8557392 CAGGATAAAAAGAGGCAGTGAGG + Intergenic
1200933999 Y:8722410-8722432 CAGGAGGAAGAGAGGCAGTGAGG - Intergenic
1201617803 Y:15921013-15921035 TGGAAGAATCAGAGGCCCTGAGG - Intergenic