ID: 1165766564

View in Genome Browser
Species Human (GRCh38)
Location 19:38355033-38355055
Sequence CATGATGTACTTGGTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165766564 Original CRISPR CATGATGTACTTGGTTTTAA AGG Intronic
900831938 1:4971730-4971752 CATGATGTACTTGATTTTGTAGG + Intergenic
900833419 1:4981191-4981213 CAGGATGCAATTGATTTTAAAGG - Intergenic
902977018 1:20096182-20096204 CATGCTGAACTTTGTTTTGATGG - Intergenic
904561836 1:31403783-31403805 CAGGATGTCCTTCTTTTTAAAGG + Intergenic
905963444 1:42065946-42065968 CATGATATAGTTCCTTTTAAAGG - Intergenic
908077762 1:60539810-60539832 CATGCTTTACTTGGCTTTTATGG - Intergenic
908273731 1:62447248-62447270 CATGATATACTTTATTTAAATGG + Intronic
913257505 1:116967067-116967089 GATGATGTACTTCGTTTCATTGG - Exonic
915104006 1:153521207-153521229 CTTAAGATACTTGGTTTTAATGG - Intergenic
916839292 1:168583590-168583612 GAGCATGTACTTCGTTTTAAAGG + Intergenic
921112052 1:212048153-212048175 TATCATGTATTTGGTTTAAATGG + Intronic
923392339 1:233525550-233525572 CATGATTTAATTCTTTTTAATGG - Intergenic
924887463 1:248234646-248234668 CATGATGTCCTTCCTTTTTATGG + Intergenic
1062793993 10:328894-328916 CAAAATGTCCTTGGTTTAAATGG + Intronic
1065754371 10:28917609-28917631 CATGATGTACTCATTTTTGAAGG + Intergenic
1071995044 10:91139454-91139476 CATGATCTTGGTGGTTTTAATGG - Intergenic
1072775262 10:98185038-98185060 CATCTTTTACTTTGTTTTAATGG + Intronic
1074550138 10:114435238-114435260 CATGCTGTTGTTGGTTTTTAAGG - Intronic
1075758576 10:124837298-124837320 CATGTTGTAATTGGTTTTTCTGG + Intergenic
1076563814 10:131385045-131385067 CATGAAGTAATTTGTTTTACTGG - Intergenic
1078498033 11:11840624-11840646 ATTTTTGTACTTGGTTTTAATGG - Intergenic
1079869178 11:25774976-25774998 CATAATGTAAGTGGATTTAAGGG + Intergenic
1084204221 11:67582384-67582406 CATGATCTAGTTCTTTTTAATGG + Intergenic
1085946658 11:81280616-81280638 CATGATCTACTTCCTTTTCATGG + Intergenic
1086190956 11:84078792-84078814 CTTAATTCACTTGGTTTTAAAGG + Intronic
1086331337 11:85757159-85757181 AATGTTGGAATTGGTTTTAATGG - Intronic
1087288516 11:96294151-96294173 TATGATGTACTTATTTTTTAGGG - Intronic
1087503022 11:98983620-98983642 CATGATTTAATTAGTTTTTATGG + Intergenic
1088082660 11:105937905-105937927 CATGATGTGCTTGGTTTCAATGG - Intronic
1088112451 11:106277891-106277913 CAGCTGGTACTTGGTTTTAAGGG - Intergenic
1088675830 11:112192256-112192278 CAGGATTTCCTTTGTTTTAAAGG + Intronic
1090401940 11:126454542-126454564 CATGTTGTACCTGGTGTTTAGGG + Intronic
1091533064 12:1378595-1378617 CATCATGTATGTGGCTTTAAAGG - Intronic
1095156379 12:38860662-38860684 CATGATTTCCTTCCTTTTAAAGG - Intronic
1095660831 12:44733373-44733395 CATGATTTCCTTCATTTTAAAGG - Intronic
1096521093 12:52185143-52185165 CAAGATTGACTTTGTTTTAAGGG + Intronic
1097683885 12:62674485-62674507 AATGATCTACTTGGTTTATAGGG - Intronic
1100929843 12:99594537-99594559 CAGGATTTACTTCTTTTTAAAGG - Intronic
1101269245 12:103125756-103125778 TATCATGTATGTGGTTTTAATGG - Intergenic
1102693122 12:114777215-114777237 CATGATGTAGTTATTTTTTAAGG - Intergenic
1103265007 12:119622166-119622188 CATGATGTGCTTAGTCATAATGG + Intronic
1105677900 13:22694506-22694528 CAAGATTTCCTTTGTTTTAAAGG + Intergenic
1107371105 13:39749297-39749319 CAAAATATACTGGGTTTTAAGGG + Intronic
1107676186 13:42799708-42799730 CATGATTTAATTATTTTTAATGG - Intergenic
1109863241 13:68227229-68227251 CATGATTTAATTCGTTTTTATGG - Intergenic
1110030122 13:70600406-70600428 CATGTTGTTCTTGGTCTTAGTGG + Intergenic
1110334651 13:74313427-74313449 CATGATCTAATTCTTTTTAATGG + Intergenic
1111850699 13:93570286-93570308 GCTGATGTTCTTGGTTGTAATGG + Intronic
1112080817 13:95968221-95968243 CATTATGTCCCTGGTTTTAGTGG - Intronic
1113361950 13:109639960-109639982 CATGTTGTATTTGGTGTTCAAGG - Intergenic
1113468396 13:110527778-110527800 CCTGCTGTATTGGGTTTTAAAGG - Intronic
1114222995 14:20713757-20713779 CATGATATACTTGGAATTAGTGG - Intergenic
1117033214 14:51697331-51697353 CATGATTTCCTTCTTTTTAAAGG - Intronic
1117361193 14:54975860-54975882 CAAAATGTACTTTCTTTTAAAGG + Intronic
1118149501 14:63174317-63174339 TAGGATGTATTTGTTTTTAATGG + Intergenic
1118320622 14:64750227-64750249 CATGGTGTAATTTTTTTTAATGG - Exonic
1118897419 14:69956662-69956684 CATGACTGACTTGGCTTTAATGG + Intronic
1119228679 14:72963201-72963223 CCTCAGGTACTTGGTCTTAATGG - Intergenic
1120021562 14:79536782-79536804 CATGATCTTATTGCTTTTAATGG + Intronic
1120444092 14:84571800-84571822 CATGATGCAATTGATGTTAAAGG - Intergenic
1120623082 14:86790403-86790425 CAGGATTTCCTTGTTTTTAAAGG + Intergenic
1121231437 14:92361787-92361809 GATGATGCACTTGGCTTGAATGG + Intronic
1121370866 14:93357200-93357222 CATGATCTCCTTTGTTTTCATGG + Intronic
1124682737 15:31749629-31749651 CATGTTGTTCTAGTTTTTAAGGG - Intronic
1127694276 15:61429164-61429186 CATTATGTCTTTCGTTTTAACGG + Intergenic
1128033815 15:64505606-64505628 GGTGATGTACATGGTTTTATGGG - Intronic
1130751080 15:86713820-86713842 CATGATTTATTTGATTTTAGTGG - Intronic
1131604399 15:93885831-93885853 CATGATGTCATTGGTTTGTAGGG + Intergenic
1134818431 16:17226019-17226041 CATGAGGTAGTGGGTTTGAAGGG + Intronic
1135275704 16:21110640-21110662 CAAGATGTTTTTGGTTATAATGG - Intronic
1137226256 16:46513515-46513537 CAGGATGTAATTGTTTTTCATGG - Intergenic
1137550504 16:49434389-49434411 AATGATGCACTTTTTTTTAATGG + Intergenic
1138942909 16:61811715-61811737 CAGGATCTCCTTGTTTTTAAAGG - Intronic
1139175134 16:64678210-64678232 CATCATGAAATTGGTTCTAATGG + Intergenic
1139331133 16:66191218-66191240 CAGGATTTACTTCTTTTTAATGG - Intergenic
1140428451 16:74881061-74881083 TATGATGCGCTTGGTCTTAATGG - Intronic
1143522700 17:7454393-7454415 CATGAGGTACTTGATAATAATGG - Exonic
1143823489 17:9584943-9584965 CATGATTTCCTTCTTTTTAAAGG - Intronic
1144137318 17:12309256-12309278 CAAGATCTATTTGGTTTTTATGG + Intergenic
1144138811 17:12325539-12325561 CATGATGTTCATGGATTAAAAGG - Intergenic
1149175068 17:53859568-53859590 CATGATGTCATTCTTTTTAATGG - Intergenic
1149956949 17:61062199-61062221 CATGATATACACGGTTTAAAAGG + Intronic
1150182236 17:63135233-63135255 CAAGATGTACTTGTTTTTGTGGG - Intronic
1150999490 17:70358314-70358336 GCTGGTGTACTTGGTCTTAATGG - Intergenic
1151091313 17:71443180-71443202 TATCATGTACTTGGCCTTAATGG - Intergenic
1151142146 17:72003855-72003877 CATGATGTACATGAATTTACTGG - Intergenic
1153106247 18:1530856-1530878 CATGATTTAATTCTTTTTAATGG - Intergenic
1153366255 18:4260018-4260040 CATAATATACTTGATTTTCATGG - Intronic
1153745561 18:8175596-8175618 TATGATTTTCTTGTTTTTAAAGG + Intronic
1155901142 18:31392423-31392445 TATGAAGTACTTTTTTTTAAAGG - Intronic
1156204638 18:34872535-34872557 CATAATGAATTTGGTCTTAATGG - Intronic
1157389586 18:47289919-47289941 AAGGATGTGTTTGGTTTTAAGGG - Intergenic
1157726392 18:49967624-49967646 CATGATGGCCCTGCTTTTAAAGG - Intronic
1159721188 18:71893266-71893288 CATGATTTCCTTGTTTTAAATGG + Intergenic
1163892256 19:20027423-20027445 CCTGCTGTGCTTGGTTTTCATGG - Intronic
1165089934 19:33380045-33380067 CAGAAGGTTCTTGGTTTTAATGG + Exonic
1165766564 19:38355033-38355055 CATGATGTACTTGGTTTTAAAGG + Intronic
925519801 2:4730818-4730840 CATGATACACTTGATTTTATTGG - Intergenic
926758847 2:16259107-16259129 CATGATTTACTTGGTTTACTTGG + Intergenic
928063754 2:28141810-28141832 CATCATTTACTTAGTTTTCAGGG + Intronic
928083629 2:28331982-28332004 CATGATCTCCTTGCTTTTTATGG - Intronic
928638952 2:33277455-33277477 GATGATGTACTACGTTTCAAAGG - Intronic
931023454 2:58078326-58078348 CATGATTTCCTTCTTTTTAAAGG + Intronic
931075681 2:58709080-58709102 CATGGTGAACTTTTTTTTAAAGG - Intergenic
931097195 2:58954550-58954572 CATGATGCACTTGTTTTTCAGGG + Intergenic
931153170 2:59597759-59597781 CTTGCTGTACCTGGTTATAAAGG - Intergenic
931936009 2:67197220-67197242 CATGATAAGTTTGGTTTTAAAGG - Intergenic
931969568 2:67570898-67570920 CAAGAAGTACATAGTTTTAATGG - Intergenic
932709962 2:74055393-74055415 CATGCTGTACATGGTTTCACAGG + Intronic
933017791 2:77151923-77151945 CATAATGTCCTTGCTTTTAAAGG + Intronic
933141710 2:78799538-78799560 CATGATTTAATTGTTTTTATTGG + Intergenic
937803690 2:126112018-126112040 CATGATCTTCTTGACTTTAAGGG - Intergenic
939730514 2:145778736-145778758 CATAATGTGCTTTGTTTTAGAGG - Intergenic
940189138 2:151020186-151020208 CATGATCTCATTGGTTTTTATGG + Intronic
940266117 2:151840800-151840822 CATGATGAGTTTTGTTTTAATGG - Intronic
942372324 2:175298632-175298654 CATGATCTAATTCCTTTTAATGG - Intergenic
944158223 2:196631821-196631843 CAAGATTTACTTAGTTTTTAAGG - Intergenic
1169090535 20:2858929-2858951 GATGATGAACTTAGTTTTAGAGG - Intronic
1170078108 20:12442715-12442737 CATGATGTATGTGGTTTTTAAGG - Intergenic
1170179106 20:13509170-13509192 CAGGATTTTCTTGGTTTTAAAGG - Intronic
1170857163 20:20067976-20067998 CATGAATTACTTTGTTTCAATGG - Intronic
1171063239 20:21987094-21987116 CATGATGTGCATGGTTTCAGTGG + Intergenic
1173234237 20:41229236-41229258 CAGGATTTACTTCCTTTTAAAGG + Intronic
1177047804 21:16192258-16192280 CATAATGTATTTTTTTTTAATGG - Intergenic
1177140043 21:17348178-17348200 CATGATTTCCTTATTTTTAATGG + Intergenic
1177693871 21:24546303-24546325 TATGAAGTACTAGGGTTTAAAGG + Intergenic
1181325221 22:22039742-22039764 CATGATGGACTTGGTTCCCAGGG - Intergenic
1184995568 22:48205085-48205107 CATGATGTACCTGGAATTAGTGG - Intergenic
951822729 3:26830821-26830843 CATGATAGACTTGATTTTAGTGG - Intergenic
951856176 3:27199776-27199798 CATGATGTTGTTGCTTTTTATGG - Intronic
951875067 3:27415018-27415040 CATGATGTCCTTGCTTTCCAAGG + Intronic
952535706 3:34306721-34306743 CATGAGGTATTTGGTTTTCTGGG + Intergenic
952679963 3:36080158-36080180 CATGATCTCATTTGTTTTAATGG + Intergenic
955793380 3:62610659-62610681 CATGATGGACTTGCTTGTAGAGG + Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
956645320 3:71449479-71449501 CATGAAATTCTGGGTTTTAAAGG - Intronic
957166340 3:76678367-76678389 TATAATGAACTTGGTGTTAATGG + Intronic
958436317 3:94100294-94100316 CAGAATGTCCTTGCTTTTAAAGG - Intronic
959519662 3:107310813-107310835 CATGATCTCGTTGCTTTTAATGG + Intergenic
960025691 3:113006705-113006727 CATGATTTACTTTATTATAATGG - Intronic
960551424 3:118980339-118980361 CATGATTTCCTTTGTTTTTATGG - Intronic
962988331 3:140556452-140556474 AGTGATGTACATGGTTTTATGGG - Intronic
964408736 3:156377077-156377099 AAGGATGTATCTGGTTTTAAGGG + Intronic
965256393 3:166418795-166418817 CATGATCTTCTTCGTTTTTATGG + Intergenic
966685253 3:182686486-182686508 CAGGATCTACTTGTTTTTGAGGG - Intergenic
967115848 3:186337543-186337565 TATCATGTCCTTGATTTTAATGG - Intronic
970253653 4:14144140-14144162 CAGGAAGCACTTGTTTTTAAAGG + Intergenic
970873785 4:20846140-20846162 AATGATATATTTGATTTTAATGG + Intronic
971551370 4:27961257-27961279 CATGATTTACTTATTTTTTAAGG - Intergenic
971563327 4:28110387-28110409 CATGATATAGTTAGTTTTCAAGG - Intergenic
973244285 4:47993970-47993992 CATGATTTGCATGGTTTTGAAGG + Intronic
973554541 4:52069320-52069342 CATGAAGTACTTGATTGTCAAGG + Intronic
973984910 4:56341328-56341350 CATGATTTCCTTGGTTTTTATGG - Intronic
977144870 4:93425980-93426002 AATGATGTACTAGCTTTTATTGG - Intronic
978572184 4:110149949-110149971 CATGATGTACTTGTTTTAAGGGG - Intronic
979419283 4:120483941-120483963 CAGGAAGTACTTGGTTTAATTGG + Intergenic
980239433 4:130154228-130154250 TATGATGCACTTTGTTATAATGG + Intergenic
980707321 4:136516536-136516558 CGTGATGATATTGGTTTTAATGG + Intergenic
980801188 4:137752345-137752367 GAAGATATACTTGGTTATAAGGG + Intergenic
982806985 4:159778532-159778554 CTTGGTGTACTTGGCTTTATAGG + Intergenic
983985548 4:174055520-174055542 CATGATGTAATTATTTTTTATGG + Intergenic
984457677 4:179991632-179991654 CATGATGTTGTTCTTTTTAATGG - Intergenic
984668488 4:182454429-182454451 CATTCTGTATTTGCTTTTAAGGG + Intronic
984766119 4:183401765-183401787 TATGATGTGCTGGGTTTTATAGG + Intergenic
985199287 4:187467568-187467590 GATGATGAGCTTGTTTTTAATGG - Intergenic
985987119 5:3525143-3525165 CAGGATGTCCTTCTTTTTAAAGG - Intergenic
986957578 5:13172711-13172733 CAGGATTTCCTTGGTTTTTAAGG + Intergenic
987693209 5:21295484-21295506 CCTGATTTACTTGGATTTAGGGG - Intergenic
987902896 5:24036645-24036667 CATGCTGTAATTGATTTTGAAGG - Intronic
988106315 5:26753616-26753638 CATTTTGTTCTTGTTTTTAAAGG - Intergenic
988693519 5:33596176-33596198 CAAAAGTTACTTGGTTTTAAAGG + Intronic
989326539 5:40202810-40202832 AATGATGGTCTTGGTTATAAAGG + Intergenic
990457115 5:55998624-55998646 AATGATGGTCTTGATTTTAAGGG - Intergenic
992813311 5:80410876-80410898 CGTGCTGTACTTTTTTTTAAAGG + Intronic
993139701 5:84016135-84016157 CATGTGGTACTTGGTTTTCTAGG + Intronic
993378127 5:87174183-87174205 GAGAATGTACTTGGTTATAAAGG - Intergenic
994250809 5:97534635-97534657 CATAATTTACTTTCTTTTAAAGG + Intergenic
995420723 5:111963453-111963475 CATTCTGAACTTGGTTTAAATGG - Intronic
995959573 5:117823333-117823355 CATGATGAACTAGGTATTGAAGG - Intergenic
996181799 5:120428572-120428594 CATGATAAACTAGGTATTAAAGG - Intergenic
996998325 5:129726213-129726235 CATGAGGTGCTTTGTTTCAAAGG + Intronic
997054520 5:130425368-130425390 CATGAAGTACTTTGAGTTAAGGG + Intergenic
998547248 5:143040260-143040282 AATGATGTACATGATTTTACAGG + Intronic
1001834098 5:174816115-174816137 CATAATGTATTTTTTTTTAATGG + Intergenic
1002623482 5:180507632-180507654 CATGATGTACTTGTATTTCTAGG + Intronic
1004712552 6:18186091-18186113 CTTGCTGTACTTGTTTTTCAAGG + Intronic
1004945548 6:20608831-20608853 CATGATATGCTTTGTTTTTAAGG + Intronic
1010067637 6:71703675-71703697 CAAGATGTACTTGGTGTTACTGG + Intergenic
1014253846 6:119141785-119141807 CAAGATGTACTTTTTTTTTAAGG - Intronic
1015936606 6:138411131-138411153 CATGATGAATTTGATTTTGAGGG - Intronic
1016819262 6:148332559-148332581 TTTGAGATACTTGGTTTTAAAGG - Intronic
1017203821 6:151783945-151783967 CATGATTAACTTGGTATTACAGG + Intronic
1017601757 6:156091215-156091237 CATGATCTTCTTCCTTTTAATGG - Intergenic
1018002327 6:159590586-159590608 CATGATGTACTTGACGATAAAGG - Intergenic
1019205160 6:170355384-170355406 CATGATGTAGTTCCTTTTTATGG - Intronic
1021050262 7:15974481-15974503 AGGGATGTTCTTGGTTTTAAGGG + Intergenic
1022767358 7:33428566-33428588 CATGATTGACTTGGCTTTATAGG + Intronic
1023236549 7:38095925-38095947 CAGGATTTACTTCTTTTTAAAGG - Intergenic
1027481574 7:78704717-78704739 CATGATCTTCTTGTTTTTCATGG - Intronic
1028346295 7:89788091-89788113 CATGATGTCCTTCTTTTTTATGG + Intergenic
1028443624 7:90893156-90893178 CATGAAGTCGGTGGTTTTAAAGG - Intronic
1029252295 7:99245503-99245525 AATGATGTAATTGGTTTTTCTGG + Intergenic
1032466354 7:132148067-132148089 CATGATGAACTTGGCACTAAGGG + Intronic
1033234682 7:139628898-139628920 CTTGCTGCCCTTGGTTTTAAAGG + Intronic
1034874796 7:154715712-154715734 CAAGAAGTACTTTGTTTTGAGGG + Intronic
1037176950 8:15958505-15958527 TATTAAGTACATGGTTTTAAGGG - Intergenic
1037846267 8:22285396-22285418 CAGGATGTACTTCTTTTTAAAGG + Intronic
1041117785 8:54557043-54557065 CATGATTTCCTTCTTTTTAAAGG - Intergenic
1041532942 8:58892260-58892282 CAGGATGTACAAAGTTTTAAAGG + Intronic
1042765672 8:72318924-72318946 CATGATATACTTATTTTGAAAGG - Intergenic
1043032099 8:75149147-75149169 CATCATGTACTGGGTTTCTAAGG + Intergenic
1044424419 8:92034855-92034877 CATGATTTGATTGTTTTTAATGG - Intronic
1045611846 8:103852730-103852752 CATGATTTACTTCTTTTTTATGG + Intronic
1048222643 8:132556102-132556124 CATGAAATACATGTTTTTAAAGG - Intergenic
1050433563 9:5586189-5586211 TATGAAGTACTTGGTCCTAAAGG + Intergenic
1050800154 9:9600897-9600919 CATGATATGTTTGGTTTTTAAGG + Intronic
1051784959 9:20732183-20732205 CATGATGCTTTTGGTTTCAATGG + Intronic
1052034633 9:23666423-23666445 CATGTTTTACTTGGTGTTGAAGG - Intergenic
1052406729 9:28070659-28070681 TATTATGTACTTGGTGTTATAGG + Intronic
1055825040 9:80313565-80313587 CATGATCTAGTTCTTTTTAATGG + Intergenic
1056971496 9:91208623-91208645 CATCATCTAGTTGGTTTTCATGG - Intergenic
1057363313 9:94395409-94395431 CATGATGTATTTGATAATAAGGG + Intronic
1057660024 9:96992690-96992712 CATGATGTATTTGATAATAAGGG - Intronic
1057690766 9:97282324-97282346 CAGGATTTCCTTGTTTTTAAAGG + Intergenic
1058092259 9:100818049-100818071 CATCATGCACCTGGCTTTAATGG + Intergenic
1060034881 9:120246472-120246494 CATGATGTCATTCTTTTTAATGG + Intergenic
1060444200 9:123672602-123672624 CATGATGTACTCACTCTTAAAGG - Intronic
1061155107 9:128855187-128855209 CATAATATAATTGGTTTTGAGGG - Intronic
1061381199 9:130258996-130259018 GATGCTGTACTTGGGTTCAAGGG + Intergenic
1187233866 X:17448260-17448282 CAAGATGTCCTTGGCTCTAAAGG - Intronic
1189142801 X:38624371-38624393 CATCATGAACCTGGTTTTCAGGG - Intronic
1189572386 X:42312132-42312154 CATGATCTAATTCGTTTTTATGG - Intergenic
1190720372 X:53142950-53142972 CATGATGAACTTGATCTTCATGG + Intergenic
1191859351 X:65653243-65653265 CATGATGTGGCTGGTTTGAAGGG + Intronic
1191934043 X:66407219-66407241 CATGATTTAATTAGTTTTTAAGG + Intergenic
1192605234 X:72509548-72509570 CATGATTTCCTTCTTTTTAAAGG - Intronic
1192916678 X:75658904-75658926 CATGCAGTATTTGGTTTTCAAGG - Intergenic
1193546144 X:82832129-82832151 TGTGAAGTACTTGGTTTTGATGG - Intergenic
1193611512 X:83636923-83636945 CACAATGTACGTGGTTTTAATGG - Intergenic
1193789773 X:85803266-85803288 CATGATCTCATTGTTTTTAATGG + Intergenic
1194284596 X:91994474-91994496 CAGGATCTCCTTGTTTTTAAGGG + Intronic
1194652646 X:96533848-96533870 CAGGATTTCCTTGTTTTTAAAGG - Intergenic
1194817864 X:98466962-98466984 CATTATTTTCTTGGTATTAAAGG + Intergenic
1195515783 X:105774072-105774094 CATTTTGTTCTTTGTTTTAAAGG + Intergenic
1196206998 X:112951860-112951882 CACGATCTATTTGGTTTTCAGGG + Intergenic
1196266012 X:113647272-113647294 CAAGATGTACTTTTTTTCAAGGG + Intergenic
1196397553 X:115281271-115281293 CATGATGTACTAGGTTAAATTGG - Intergenic
1196513348 X:116540844-116540866 CATGATCTCCTTCCTTTTAATGG + Intergenic
1196766271 X:119247394-119247416 CATAATATTCTTTGTTTTAATGG + Intergenic
1198642262 X:138769519-138769541 CATGATGGTCATGGTTATAATGG - Intronic
1198874446 X:141207918-141207940 CATTATGTACTTGTTTTTTTAGG - Intergenic
1199366595 X:146992875-146992897 CATGCAGTATTTGGTTTTCAAGG - Intergenic
1199414704 X:147567925-147567947 CATGATGTCATTCTTTTTAAAGG + Intergenic
1199540294 X:148951291-148951313 CTTAATGTATTTGGTTTTGAAGG + Intronic
1200602162 Y:5219038-5219060 CAGGATCTCCTTGTTTTTAAGGG + Intronic
1201143505 Y:11047898-11047920 GATGATGAAGTTGGTTGTAATGG + Intergenic