ID: 1165767147

View in Genome Browser
Species Human (GRCh38)
Location 19:38358663-38358685
Sequence TGGATTTGTGCATCCTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 281}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165767147_1165767153 16 Left 1165767147 19:38358663-38358685 CCTTCAAAGGATGCACAAATCCA 0: 1
1: 0
2: 3
3: 16
4: 281
Right 1165767153 19:38358702-38358724 TGATGAGGAACACACCGTTAGGG 0: 1
1: 0
2: 0
3: 4
4: 78
1165767147_1165767154 29 Left 1165767147 19:38358663-38358685 CCTTCAAAGGATGCACAAATCCA 0: 1
1: 0
2: 3
3: 16
4: 281
Right 1165767154 19:38358715-38358737 ACCGTTAGGGTAGTCAGTGCTGG 0: 1
1: 0
2: 0
3: 0
4: 46
1165767147_1165767156 30 Left 1165767147 19:38358663-38358685 CCTTCAAAGGATGCACAAATCCA 0: 1
1: 0
2: 3
3: 16
4: 281
Right 1165767156 19:38358716-38358738 CCGTTAGGGTAGTCAGTGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1165767147_1165767152 15 Left 1165767147 19:38358663-38358685 CCTTCAAAGGATGCACAAATCCA 0: 1
1: 0
2: 3
3: 16
4: 281
Right 1165767152 19:38358701-38358723 GTGATGAGGAACACACCGTTAGG 0: 1
1: 0
2: 0
3: 6
4: 81
1165767147_1165767150 1 Left 1165767147 19:38358663-38358685 CCTTCAAAGGATGCACAAATCCA 0: 1
1: 0
2: 3
3: 16
4: 281
Right 1165767150 19:38358687-38358709 AAGTTACCAGGACTGTGATGAGG 0: 1
1: 0
2: 1
3: 7
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165767147 Original CRISPR TGGATTTGTGCATCCTTTGA AGG (reversed) Intronic
905675902 1:39824910-39824932 TGGATTTGGGCATACTTAGGGGG - Intergenic
907995915 1:59632548-59632570 GGGATTTGTACAGCCTTTAATGG - Intronic
908381133 1:63597785-63597807 TGAATGTGTGCATGTTTTGAAGG + Intronic
910069864 1:83199704-83199726 TTTATTTATTCATCCTTTGATGG - Intergenic
910886440 1:91968334-91968356 TGGATGTCTGTCTCCTTTGAGGG - Intronic
912768599 1:112440148-112440170 TGGACTTGTGCATGATTTGCAGG - Intronic
916977049 1:170092130-170092152 TGGATTTGTTAATTTTTTGAAGG + Intergenic
918601128 1:186363778-186363800 TGGATTTGTGCATATTTTAATGG - Intronic
919231653 1:194781514-194781536 TGGATTTGTTGATTTTTTGAAGG - Intergenic
920307577 1:205029071-205029093 TGGATTTGAGCCTGCTTTGAAGG - Intergenic
920653434 1:207855752-207855774 GGGATCTGTGAATCCTCTGACGG + Intergenic
921288188 1:213628377-213628399 TGGATTTATGGATTTTTTGAAGG + Intergenic
922994512 1:229945147-229945169 TGGATTTTAACATCCTTTTAGGG - Intergenic
923237132 1:232045285-232045307 TTGATTTCTGCATTCTGTGAAGG + Intergenic
923447533 1:234086471-234086493 TATATTTATTCATCCTTTGATGG + Intronic
924205494 1:241707515-241707537 TTGATTTCTGGATTCTTTGAAGG - Intronic
1063678118 10:8159967-8159989 TGGGCTTGTGTAACCTTTGAGGG + Intergenic
1064334926 10:14431000-14431022 TTCATCTGTTCATCCTTTGATGG - Intronic
1064851880 10:19717615-19717637 TGAATTTGTAGATCCTTGGAAGG + Intronic
1067326182 10:45268980-45269002 TGGATTTGTTCATTTTTTGAAGG - Intergenic
1067496934 10:46769438-46769460 TGAATTTGTGCATCATTACACGG - Intergenic
1068186293 10:53590655-53590677 TGGATTTGTTGATCTTTTGAAGG + Intergenic
1068204665 10:53834720-53834742 TGTATTTCTGCCTCCATTGATGG + Intronic
1069194978 10:65539967-65539989 TGCATTTCTGCCTCATTTGATGG + Intergenic
1069258810 10:66367820-66367842 TGGTTTTCTGCATCTTTTTAAGG + Intronic
1069389968 10:67924704-67924726 TGGATTTGGGTATCCTTGGCAGG + Intronic
1069398089 10:68011325-68011347 TGGAATGGTGAATTCTTTGAAGG + Intronic
1071376060 10:85005143-85005165 TTGTTTTGTGCATCAATTGATGG - Intergenic
1071577116 10:86736050-86736072 TGTATTTGCACATCCTTTGGGGG - Exonic
1071615617 10:87072949-87072971 TGAACTTGTGCATCCTTACATGG - Intronic
1071724781 10:88187220-88187242 AGGACTTGTGCATCCCATGAAGG + Intergenic
1071912686 10:90253661-90253683 TGGATTTGTTAATTTTTTGAAGG - Intergenic
1072278180 10:93842813-93842835 TGGATTAGTTTATCATTTGAAGG - Intergenic
1075817775 10:125278987-125279009 TGGTTCTGTACATCCTTTGAGGG + Intergenic
1076015532 10:127024528-127024550 TGGATCTGTGCTTCCCTTGCTGG + Intronic
1076486318 10:130820962-130820984 TGGAGCTGTGCATCCTCTTAGGG - Intergenic
1076503861 10:130958841-130958863 TGGATTTGGGTATCCATGGAGGG + Intergenic
1079204595 11:18403323-18403345 TGGATTTGCTCATCTTTTCAGGG - Intronic
1079580070 11:22053085-22053107 TGGATTTGTTGATATTTTGAAGG + Intergenic
1079738218 11:24024498-24024520 TGGATTTGTTGATTTTTTGAAGG - Intergenic
1079831801 11:25278286-25278308 TGGATTTGTTAATTTTTTGAAGG + Intergenic
1080118224 11:28644457-28644479 TGGATTTGTTGATTTTTTGAAGG - Intergenic
1080292838 11:30690334-30690356 TGGATTTGTTGATTTTTTGAAGG - Intergenic
1080490216 11:32754218-32754240 TAAATTTGGGGATCCTTTGAAGG + Intronic
1081667382 11:44924511-44924533 TGGGTTTGTGAACTCTTTGAGGG - Intronic
1082743950 11:56942014-56942036 TGGATTTGTTAATTTTTTGAAGG + Intergenic
1082994225 11:59236753-59236775 TGGATTTGTTAATTTTTTGAAGG - Intergenic
1084782038 11:71416413-71416435 TGGTCTTGTGACTCCTTTGATGG + Intergenic
1086610639 11:88751145-88751167 TGGATTTGTTCATTTCTTGATGG - Intronic
1087625443 11:100590414-100590436 TGGATTTGTTGATCTTTTGAAGG + Intergenic
1088945394 11:114506919-114506941 TGGATTTGTTGATCTTTTGCAGG - Intergenic
1089204170 11:116745497-116745519 TTTATTTATGCATCATTTGATGG - Intergenic
1091754340 12:3041764-3041786 TGGATCTGTGGTTCCTATGAGGG - Intergenic
1091802625 12:3334174-3334196 TGGGTGTGTGCATCCTTTTGGGG - Intergenic
1091811295 12:3400196-3400218 TGGATTTGTTGATTTTTTGAAGG - Intronic
1093412224 12:18880411-18880433 AGGATTTGTGAATGCTATGAGGG + Intergenic
1094419654 12:30257299-30257321 TGGATTTTTGCTTCCTAGGAAGG - Intergenic
1095372178 12:41481618-41481640 TGGATTTGAGCTTGTTTTGAAGG - Intronic
1097520901 12:60669792-60669814 TGGATTTGTTGATTTTTTGAAGG + Intergenic
1099055572 12:77835645-77835667 TGCAATTGCTCATCCTTTGATGG + Intronic
1100192927 12:92212160-92212182 TGTATTTGTGCATCATTTTTGGG + Intergenic
1100234138 12:92641118-92641140 TGGATTTGTACCTCCTTTTTTGG - Intergenic
1101472368 12:105010431-105010453 TGGATTCGTGGATTTTTTGAAGG + Intronic
1102414074 12:112745416-112745438 TTGGTTTTAGCATCCTTTGAGGG + Intronic
1102653488 12:114460658-114460680 TGAATTTGTTCATCCTTGAAAGG - Intergenic
1103116115 12:118334221-118334243 AGTATTTGTTCATCCATTGATGG - Intronic
1103990948 12:124798924-124798946 TGAAATTTTGTATCCTTTGACGG - Intronic
1104136265 12:125941974-125941996 AGGATTTTTACATCCTTTGAAGG + Intergenic
1104539682 12:129652355-129652377 AGGATGTGAGCATCTTTTGACGG - Intronic
1105489928 13:20878293-20878315 TGGACTTGTGCATACCTTGCTGG - Intronic
1106133912 13:26960366-26960388 TTGATTCATTCATCCTTTGATGG - Intergenic
1106193721 13:27475975-27475997 TGTATCTGTTCATCCGTTGATGG + Intergenic
1107386772 13:39918801-39918823 TTGATTTATACATCCTCTGAGGG + Intergenic
1109333464 13:60961196-60961218 TGTATTTGTTCATCTGTTGATGG + Intergenic
1109675652 13:65672746-65672768 TGGATTTATTGATCTTTTGAAGG + Intergenic
1110402603 13:75111342-75111364 TGGATTTGTTGATTTTTTGAAGG - Intergenic
1111085114 13:83365336-83365358 TGGATTTGTTGATTTTTTGAAGG + Intergenic
1111235017 13:85398482-85398504 TGGATTTGTTGCTCTTTTGAAGG + Intergenic
1113383495 13:109826027-109826049 TGGATTTATTCATTTTTTGAAGG + Intergenic
1114386337 14:22259315-22259337 TGGATTCGTTCATTTTTTGAAGG + Intergenic
1114603384 14:23974438-23974460 TGGATTCATTGATCCTTTGAAGG - Intronic
1114608367 14:24016920-24016942 TGGATTCATTGATCCTTTGAAGG - Intergenic
1114958461 14:27852097-27852119 TGGATTTGTTGATTTTTTGAAGG - Intergenic
1116301675 14:43191209-43191231 TGGATTTGTTGATCCTTTGAAGG - Intergenic
1116320604 14:43457252-43457274 TGGATTCGTTGATCTTTTGAAGG - Intergenic
1116472285 14:45299581-45299603 TGGATTTGTACCTAGTTTGAAGG + Intergenic
1116493422 14:45533264-45533286 TGGATTTGTTGATTTTTTGAAGG + Intergenic
1117609700 14:57469582-57469604 TGGATTTGTTTATCCTCTCAAGG + Intronic
1120092271 14:80345962-80345984 TGGATTTATGGATCCTTTATAGG + Intronic
1120283418 14:82467032-82467054 TGGATTTGTTGATCTTTTGAAGG - Intergenic
1125216360 15:37280131-37280153 TGGATTTGTGGATTTTTTGAAGG + Intergenic
1126958243 15:53959175-53959197 TTTATCTGTTCATCCTTTGATGG + Intergenic
1129971684 15:79783522-79783544 TAGATTTGTTGATCTTTTGAAGG - Intergenic
1138329977 16:56205655-56205677 TGGGTTTGTTCATTCTGTGAAGG + Intronic
1138529830 16:57629101-57629123 TGGATGTGTGCATCCGTGCACGG + Intronic
1139058188 16:63213625-63213647 TATATTTGTGTATCCTATGAGGG - Intergenic
1139869908 16:70099103-70099125 TGCAGTTGTGTCTCCTTTGAAGG + Intergenic
1140385534 16:74533444-74533466 TGCAGTTGTGTCTCCTTTGAAGG - Intronic
1141033833 16:80611464-80611486 TGGGTCTGGGCTTCCTTTGACGG - Intronic
1141142706 16:81507359-81507381 GGGATATGTGCAGCCTGTGAGGG + Intronic
1142532510 17:591334-591356 TGGATTTGTTAATTTTTTGAAGG + Intronic
1142909453 17:3075257-3075279 TTGCTTTTTGCATCCTTTAAAGG + Intergenic
1144319895 17:14104943-14104965 TGGATTTTTCCATCCTTTGAAGG - Intronic
1144395321 17:14837532-14837554 TGGATGTCTGAATCCCTTGAGGG + Intergenic
1144419950 17:15087449-15087471 TGGTTTTCTGCCTCCTTTTATGG + Intergenic
1148152402 17:45404492-45404514 TGGATTTATGGATGCTTCGAGGG + Exonic
1148781074 17:50122365-50122387 TGGACTAGTGCATGCTTTGGCGG + Intronic
1151205595 17:72504247-72504269 TGGAGTTGGGTATCCTCTGAGGG + Intergenic
1152487441 17:80603440-80603462 GGGGTTGGTGCATCCTTTGAAGG + Intronic
1153179977 18:2422079-2422101 TGAATGTGTGCATCCCCTGAAGG - Intergenic
1153209450 18:2744734-2744756 TGAAATTTTGTATCCTTTGATGG + Intronic
1153430156 18:5007180-5007202 TGGATTCATGGATCTTTTGAAGG - Intergenic
1155441598 18:25868112-25868134 TGTATTTGTACATGATTTGATGG - Intergenic
1155453065 18:25983118-25983140 TGGATTTGTGTATCATTGGCTGG + Intergenic
1156124391 18:33885925-33885947 TGTATTCATTCATCCTTTGATGG - Intronic
1157019936 18:43768847-43768869 TGGATTTGTTGATATTTTGAAGG - Intergenic
1157039478 18:44021773-44021795 TGGATTTGTTAATTTTTTGAAGG + Intergenic
1157336743 18:46745251-46745273 TGGATTTGTTGATTTTTTGAAGG - Intronic
1157976555 18:52334277-52334299 TGGATGTGGGCATCTTTGGAGGG + Intergenic
1158877761 18:61749374-61749396 TGAATTTGTGCCTGGTTTGAGGG - Intergenic
1160087663 18:75792930-75792952 TGAAATTGTGCATCACTTGAAGG + Intergenic
1160623356 18:80186580-80186602 TGTGTGTGTGCATCCTTTGGGGG - Intronic
1163614885 19:18321066-18321088 TGGAAGTGTGTATCCTGTGATGG + Intronic
1165767147 19:38358663-38358685 TGGATTTGTGCATCCTTTGAAGG - Intronic
1166427922 19:42696514-42696536 TGTATTTGTTCATCCGTTGCTGG + Intronic
925315052 2:2915579-2915601 TGTAACTGTTCATCCTTTGATGG + Intergenic
926390409 2:12385278-12385300 TTGAGTTGTGCATACTTAGATGG - Intergenic
926933002 2:18059235-18059257 TTGATTTTTGTATCCTTTTAAGG + Intronic
928050707 2:27992107-27992129 TTGATTTGTGCTTTTTTTGATGG + Intronic
928423470 2:31158374-31158396 TGGGTTTGTGCCTGCTTTGCTGG - Intergenic
928744568 2:34396404-34396426 TGGCTTTGTTCATCATTAGAAGG + Intergenic
931613859 2:64134606-64134628 TGGATGTTTTGATCCTTTGATGG + Intronic
931900340 2:66781424-66781446 TGAGTTTTTGCATCCTGTGATGG - Intergenic
933684981 2:85134739-85134761 TGGATTTGTGCCCGCTTTGGGGG + Intronic
933903436 2:86865861-86865883 TTGATTTGGGCTCCCTTTGATGG - Intergenic
934478836 2:94615948-94615970 TGGATTTGTTGATTTTTTGAAGG + Intergenic
935777076 2:106483093-106483115 TTGATTTGGGCTCCCTTTGATGG + Intergenic
936862582 2:117035099-117035121 TAGATTTGTCAATCCTTTGGAGG - Intergenic
937266191 2:120615997-120616019 TGCATGTGTGCACCCCTTGAGGG - Intergenic
937540942 2:122952467-122952489 TGGATTTGTTGATCTATTGAGGG + Intergenic
937882802 2:126881135-126881157 TTGATCTGTTCATCCCTTGATGG - Intergenic
938307000 2:130263370-130263392 TGCATCTGTCCATTCTTTGAGGG + Intergenic
940629743 2:156222848-156222870 TGGATTTGTTGATTTTTTGAAGG - Intergenic
940821684 2:158362856-158362878 TGGATTTATGGATTTTTTGAAGG - Intronic
943126085 2:183794598-183794620 TGGATTTGTTGATTTTTTGAAGG - Intergenic
943438778 2:187900482-187900504 TGGATTTGTTGATTTTTTGAAGG + Intergenic
943921009 2:193707861-193707883 TGGATTTGTTAATTTTTTGAAGG + Intergenic
944635099 2:201668519-201668541 TGCCTCTGTGCATCCTTAGAGGG - Intronic
945598231 2:211822946-211822968 TGGATTTCTGCTCCCTTTTATGG + Intronic
946013177 2:216582983-216583005 TGGATTTGGATATCCTTTGGGGG + Intergenic
946471751 2:219967070-219967092 TACACTTGTGCTTCCTTTGAGGG + Intergenic
947619180 2:231577754-231577776 TGGCTTGGAGGATCCTTTGATGG + Intergenic
948430522 2:237915689-237915711 TGGCTTTGTGGAACCTTAGACGG - Intergenic
1169252414 20:4070875-4070897 TGGGTGTCTGCATCCATTGATGG + Intronic
1171046712 20:21815236-21815258 TGTATTTATGCATCCATTCATGG + Intergenic
1171074843 20:22112186-22112208 TGGATTTGTGGATTTTTTAAGGG + Intergenic
1173347264 20:42212462-42212484 TGGATGTGTGCAGCATTTAAAGG + Intronic
1173777024 20:45717511-45717533 TGGACTTGTTCATTTTTTGAAGG - Intergenic
1176665746 21:9685789-9685811 TGTATTTGTGCAGCCTCTGCTGG - Intergenic
1181830913 22:25559493-25559515 TGTATTTGTGGGTACTTTGATGG - Intergenic
1184198713 22:42950296-42950318 TGGATTTTGGTATCCTTTGGAGG + Intronic
1184694811 22:46133364-46133386 TGGCTTTGGGCCACCTTTGAAGG + Intergenic
949229338 3:1732041-1732063 TGGATTTGTCCATGCTGAGAGGG - Intergenic
950150653 3:10684514-10684536 TTAATTTGTGAAACCTTTGAGGG - Intronic
951161808 3:19431952-19431974 GGGATTTGTTGATCTTTTGAAGG + Intronic
954035869 3:47850873-47850895 TGGAGTGGAGGATCCTTTGAGGG + Intronic
954097907 3:48345379-48345401 TGGAATTATGGTTCCTTTGAGGG + Intergenic
954255435 3:49402190-49402212 TGATTCTGTGCATCCATTGAAGG - Intronic
956220363 3:66896183-66896205 TGGATTTATTCATTTTTTGAAGG - Intergenic
957442271 3:80264859-80264881 TAGATTTGTTGATCTTTTGAAGG + Intergenic
957688066 3:83529717-83529739 GGGATTTGATCATTCTTTGATGG + Intergenic
957727790 3:84089780-84089802 TGGATTTATTCATTTTTTGAAGG - Intergenic
960346705 3:116541764-116541786 TGGATTTGTTGATCCTTTGGAGG - Intronic
960880216 3:122336613-122336635 TGAATTTTAGCATCCATTGATGG - Intronic
961636273 3:128335004-128335026 GGGTTTTGTGGATCCTCTGAGGG + Intronic
962834518 3:139176000-139176022 TTCATTTGTTCATCCATTGATGG + Intronic
963860600 3:150306000-150306022 TGAATTTGTGCTCCCTTTCATGG + Intergenic
964925196 3:161947869-161947891 TGTATTTGTTCATCAGTTGATGG - Intergenic
965293922 3:166918381-166918403 TGGTTTCGTGCATTCTTAGAAGG - Intergenic
969302309 4:6304285-6304307 TGGATTTGTGAAGCCATGGAAGG + Intergenic
971137097 4:23881118-23881140 TGCCTTTGTGCATTGTTTGAAGG - Intronic
971660072 4:29402270-29402292 TGGATTTGTGCTTCTTTTCTAGG - Intergenic
973550835 4:52034582-52034604 TGGATTTGGCTATCCTTTGGGGG + Intronic
973706007 4:53581095-53581117 AGTATTTGTGCATCTTTTGGGGG - Intronic
974539535 4:63216489-63216511 TGGATTTGTTTATTTTTTGAAGG + Intergenic
975194506 4:71508271-71508293 TGGATTTGTTGATCTTTTGAAGG - Intronic
976948204 4:90796443-90796465 TGGATTTGTGGATCTTTTGAAGG + Intronic
978118774 4:105052972-105052994 TGGATTTGTTGATCTTTTTAAGG - Intergenic
980547993 4:134294733-134294755 TGAATTTGTTGATCTTTTGAAGG - Intergenic
981173875 4:141658047-141658069 TGGATTTGTGTCTCCATTGTTGG + Intronic
981268404 4:142815086-142815108 TGGATTTATGCATTCTTGGGAGG - Intronic
981789356 4:148518857-148518879 TGGATTTGTTGATTTTTTGAAGG + Intergenic
982679429 4:158411100-158411122 TGGATTAGGGCATCCTGTCAAGG - Intronic
984057414 4:174947203-174947225 TGGATTTGTTGATCTTTTTATGG + Intronic
985209725 4:187579784-187579806 TAGAATTGTGCATTCTTTGATGG - Intergenic
985340323 4:188945530-188945552 TGGATTTGTTGATTTTTTGAAGG - Intergenic
986185495 5:5432413-5432435 TGAATCAGTTCATCCTTTGATGG + Intronic
988029307 5:25741336-25741358 ATTATTCGTGCATCCTTTGATGG - Intergenic
988110764 5:26815894-26815916 TGGAATTGTTCATTTTTTGAAGG - Intergenic
988407781 5:30846228-30846250 TGAATTTCTGCATACTTTGGAGG - Intergenic
988775259 5:34472109-34472131 TGGATTTGTTGATTTTTTGAAGG - Intergenic
989896620 5:47096442-47096464 TGGATATTTGCATCCGTTTAAGG - Intergenic
989896684 5:47097632-47097654 TGGATATTTGCATCCCTTTAAGG - Intergenic
990078053 5:51875115-51875137 AGGATTTTTGCATCATTTTATGG + Intergenic
990402103 5:55448812-55448834 TGGATTTTGGTATCCTTGGAAGG - Intronic
990858796 5:60302621-60302643 TGGATTTGTTGATATTTTGAAGG + Intronic
992179929 5:74185763-74185785 TGGATTTGTCCTTCCTTAAATGG - Intergenic
993043825 5:82845007-82845029 TGGATTTGTTGATTTTTTGAAGG + Intergenic
995052522 5:107722429-107722451 TGGATTTGTTGATTTTTTGAAGG - Intergenic
995471503 5:112506721-112506743 TGGATTTGTTGATTTTTTGAAGG - Intergenic
995628355 5:114104378-114104400 TGGATTCGTTCATTTTTTGAAGG + Intergenic
996054916 5:118972157-118972179 TGGATTTGTTGATTTTTTGAAGG - Intronic
996778257 5:127156505-127156527 TGGATTTGTTGATTTTTTGAAGG + Intergenic
999872430 5:155766208-155766230 TGGATTGGACTATCCTTTGATGG - Intergenic
1000344659 5:160304703-160304725 TGGATTTCTGCATCCCTCAAGGG - Intronic
1000451472 5:161393467-161393489 TGGCTTTTTGTATGCTTTGACGG - Intronic
1000557363 5:162742481-162742503 TGGATTTCTTGATCTTTTGAAGG + Intergenic
1202772298 5_GL000208v1_random:19800-19822 TGGATATTTGCATCCGTTTAAGG - Intergenic
1202772361 5_GL000208v1_random:20992-21014 TGGATATTTGCATCCCTTTAAGG - Intergenic
1003080396 6:3016749-3016771 TGCATTTGTCCATCCCTGGAGGG + Intronic
1003148812 6:3531381-3531403 TGGATTGGTGCATCCCTGCAAGG + Intergenic
1003641493 6:7879025-7879047 TTGATGGGTGCATCTTTTGATGG + Intronic
1006653421 6:35569779-35569801 TGGCTTTGTCCCTCCTCTGAAGG - Intergenic
1008082973 6:47213207-47213229 TGGATTTGTTGATTTTTTGAAGG - Intergenic
1009261237 6:61491815-61491837 TGTTTTTGTGCAAACTTTGAAGG - Intergenic
1010513731 6:76748604-76748626 TGGATTTGTTAATTTTTTGAAGG + Intergenic
1012452771 6:99370951-99370973 TGGTTTTTTTCATCCTTTTATGG - Intronic
1012938756 6:105395777-105395799 TGGATTTCTACAGCCTTTGATGG - Intronic
1012959096 6:105603757-105603779 TGAATTTGAGCATCATTTCAGGG + Intergenic
1014449765 6:121568996-121569018 TGGATTTGTTAATTTTTTGAAGG + Intergenic
1015344585 6:132140779-132140801 TGAATTTTTGCTTCCTTTGTTGG + Intergenic
1015657541 6:135536298-135536320 TGGATTTGAGCAACCCTAGATGG - Intergenic
1016228597 6:141772873-141772895 CTGATTTTTGCTTCCTTTGAAGG + Intergenic
1017024524 6:150169800-150169822 CTGATTTGTGCATCATTTGTTGG + Intronic
1018402764 6:163441979-163442001 TGGTTCTGGGCATCCTTTTAGGG + Intronic
1021169668 7:17383639-17383661 TGGATTTTGGTATCCTTGGAGGG + Intergenic
1024405854 7:48979050-48979072 TGGATTTGTTGATTTTTTGAAGG - Intergenic
1025596224 7:62930192-62930214 TGTTTTTGTCCATCCTATGAAGG - Intergenic
1026361696 7:69607216-69607238 TGAATTGGTGCCTTCTTTGAAGG + Intronic
1027287635 7:76664863-76664885 TTTATTTATTCATCCTTTGATGG - Intergenic
1028813374 7:95115426-95115448 TGGCTTTATGCATTCTTTAAAGG - Intronic
1028957531 7:96710473-96710495 TGGATTTGTGTAACATTTTATGG + Intergenic
1030438481 7:109555130-109555152 TGGATTTGTTGATTTTTTGAAGG - Intergenic
1032826045 7:135568856-135568878 TGCACTTGTGCAGCATTTGAAGG - Intronic
1033044597 7:137950218-137950240 TGGATTTGTGGGTCATATGAGGG + Intronic
1034461995 7:151203173-151203195 TGTCCTGGTGCATCCTTTGATGG - Intronic
1035416855 7:158696350-158696372 TGGGCTTGTGCCTGCTTTGACGG - Intronic
1035791985 8:2315218-2315240 TGGATCTATTCATCCATTGATGG - Intergenic
1035800820 8:2406487-2406509 TGGATCTATTCATCCATTGATGG + Intergenic
1038027509 8:23605416-23605438 GGGTTCTGTGTATCCTTTGAGGG - Intergenic
1038231884 8:25708289-25708311 TTCATTTCTGCTTCCTTTGAGGG - Intergenic
1040656110 8:49510489-49510511 TGCAAATGTGCATCTTTTGATGG + Intergenic
1041129735 8:54685114-54685136 TGGATTTGTTGATTTTTTGAAGG + Intergenic
1041606158 8:59784696-59784718 TGCATTTTGGCATCCTTTTATGG + Intergenic
1042293211 8:67191551-67191573 TGGATTTGTCTTTCTTTTGAAGG + Intronic
1044180534 8:89188218-89188240 TAGATTTGTGCAGGCATTGACGG - Intergenic
1044253067 8:90026678-90026700 TGGATTTGTTGATTTTTTGAAGG + Intronic
1044711240 8:95060053-95060075 TGGATTAGTGGATTCTTTGCTGG + Intronic
1046274776 8:111944435-111944457 ATGTTTTGTACATCCTTTGAGGG + Intergenic
1047550247 8:125863721-125863743 TGGATATTTGGATCTTTTGATGG + Intergenic
1047624106 8:126638050-126638072 AGGATTTGTGCAAACTTTGGAGG + Intergenic
1050598693 9:7229134-7229156 TGGAGTTGTCCAGCCTCTGAAGG + Intergenic
1050933634 9:11364775-11364797 TGGATTCGTGGATCTTTTGTTGG - Intergenic
1051728730 9:20115621-20115643 TCAAATTGTGCTTCCTTTGAAGG + Intergenic
1053679234 9:40470142-40470164 TGGATTTGTTGATTTTTTGAAGG - Intergenic
1053929224 9:43098487-43098509 TGGATTTGTTGATTTTTTGAAGG - Intergenic
1054284486 9:63154801-63154823 TGGATTTGTTGATTTTTTGAAGG + Intergenic
1054292313 9:63305680-63305702 TGGATTTGTTGATTTTTTGAAGG - Intergenic
1054364088 9:64213872-64213894 TGTTTTTGTGCAAACTTTGAAGG - Intergenic
1054390332 9:64610153-64610175 TGGATTTGTTGATTTTTTGAAGG - Intergenic
1054505385 9:65906153-65906175 TGGATTTGTTGATTTTTTGAAGG + Intergenic
1056517607 9:87370386-87370408 CGGATTTGTTCATCTTTTGTTGG + Intergenic
1057816113 9:98296251-98296273 TGGATTGCTGCATCCTCTGGAGG - Intronic
1058007139 9:99929173-99929195 TGGATTTGTAAATACTTTGAAGG + Intronic
1059234370 9:112750036-112750058 TGCATTTGTGCTTCCTTTCCAGG - Intergenic
1059470727 9:114503361-114503383 TGGATTCATGGATCCTTTGCAGG - Intronic
1060120371 9:120983585-120983607 TGGATTTTTGAATCATGTGAGGG - Intronic
1060159882 9:121352113-121352135 TGGATTTTGGTATCCTCTGAGGG - Intronic
1203660355 Un_KI270753v1:35972-35994 TGTATTTGTGCAGCCTCTGCTGG + Intergenic
1186562147 X:10623871-10623893 TGGATTTCTGAAACCTCTGAGGG - Intronic
1188843156 X:35040467-35040489 TGGATTTATTGATCTTTTGATGG - Intergenic
1188851278 X:35135488-35135510 TGGATTTGTTGATTTTTTGAAGG + Intergenic
1188893281 X:35636145-35636167 TGGCTTTGTTCACACTTTGAGGG + Intergenic
1190341081 X:49296473-49296495 TGGATTTGTTGATTTTTTGAAGG + Intronic
1190992823 X:55569709-55569731 TGGATTTGTTGATTTTTTGAAGG - Intergenic
1191078575 X:56484441-56484463 TGGATTTGTTGATTTTTTGAAGG + Intergenic
1191267472 X:58413722-58413744 TGTTTTTGTGCATTCTGTGAAGG - Intergenic
1191745408 X:64481323-64481345 TGGATTTATTGATTCTTTGAAGG + Intergenic
1192655764 X:72992393-72992415 TGGATTTGTTAATCTTTTTATGG - Intergenic
1192909636 X:75589546-75589568 TGGATTTGTTAATTTTTTGAAGG - Intergenic
1193784411 X:85742081-85742103 TGGATTTGTTGATTTTTTGATGG - Intergenic
1194175720 X:90645863-90645885 TGGGTTTGTGTACACTTTGATGG + Intergenic
1194954120 X:100159538-100159560 TGGATTTGTGAATTTTTTGAAGG + Intergenic
1196421612 X:115527946-115527968 TGCATTTGTGAACCCTCTGATGG + Intergenic
1196710364 X:118755966-118755988 TTCCTTTGTGCAGCCTTTGAAGG + Intronic
1196847824 X:119910589-119910611 TGAATTTTTTCATCTTTTGAAGG - Intronic
1198400941 X:136267634-136267656 TGGTTTTGTGCATATTTTAAGGG + Intergenic
1200522361 Y:4226821-4226843 TGGGTTTGTGTACACTTTGATGG + Intergenic
1201015189 Y:9593957-9593979 TGGATTTGTTAATTTTTTGAAGG - Intergenic
1201398233 Y:13572757-13572779 TGGATTTGTTGATTTTTTGAAGG - Intergenic
1201986268 Y:19971245-19971267 TGGATTTGTTGATTTTTTGAAGG - Intergenic