ID: 1165767642

View in Genome Browser
Species Human (GRCh38)
Location 19:38361134-38361156
Sequence TCCCATCAGGGCCTCTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 2, 2: 1, 3: 42, 4: 357}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165767642_1165767655 18 Left 1165767642 19:38361134-38361156 CCTGTGCAGAGGCCCTGATGGGA 0: 1
1: 2
2: 1
3: 42
4: 357
Right 1165767655 19:38361175-38361197 GGTGGTCATGGGGAGAAACTTGG 0: 1
1: 0
2: 1
3: 25
4: 262
1165767642_1165767651 6 Left 1165767642 19:38361134-38361156 CCTGTGCAGAGGCCCTGATGGGA 0: 1
1: 2
2: 1
3: 42
4: 357
Right 1165767651 19:38361163-38361185 CAAAGTGAGCCTGGTGGTCATGG 0: 1
1: 0
2: 1
3: 28
4: 254
1165767642_1165767650 0 Left 1165767642 19:38361134-38361156 CCTGTGCAGAGGCCCTGATGGGA 0: 1
1: 2
2: 1
3: 42
4: 357
Right 1165767650 19:38361157-38361179 GGGGGACAAAGTGAGCCTGGTGG 0: 1
1: 0
2: 1
3: 23
4: 305
1165767642_1165767652 7 Left 1165767642 19:38361134-38361156 CCTGTGCAGAGGCCCTGATGGGA 0: 1
1: 2
2: 1
3: 42
4: 357
Right 1165767652 19:38361164-38361186 AAAGTGAGCCTGGTGGTCATGGG 0: 1
1: 0
2: 0
3: 13
4: 163
1165767642_1165767653 8 Left 1165767642 19:38361134-38361156 CCTGTGCAGAGGCCCTGATGGGA 0: 1
1: 2
2: 1
3: 42
4: 357
Right 1165767653 19:38361165-38361187 AAGTGAGCCTGGTGGTCATGGGG 0: 1
1: 0
2: 0
3: 26
4: 218
1165767642_1165767656 19 Left 1165767642 19:38361134-38361156 CCTGTGCAGAGGCCCTGATGGGA 0: 1
1: 2
2: 1
3: 42
4: 357
Right 1165767656 19:38361176-38361198 GTGGTCATGGGGAGAAACTTGGG 0: 1
1: 0
2: 1
3: 16
4: 210
1165767642_1165767649 -3 Left 1165767642 19:38361134-38361156 CCTGTGCAGAGGCCCTGATGGGA 0: 1
1: 2
2: 1
3: 42
4: 357
Right 1165767649 19:38361154-38361176 GGAGGGGGACAAAGTGAGCCTGG 0: 1
1: 0
2: 1
3: 31
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165767642 Original CRISPR TCCCATCAGGGCCTCTGCAC AGG (reversed) Intronic
900169301 1:1258545-1258567 TCCCATCAGGAGCCCTGCAATGG + Intronic
900462561 1:2808659-2808681 TCCCATCAGTACCACTGCTCGGG + Intergenic
900718689 1:4161309-4161331 TCCCAGGAGGGCAACTGCACGGG + Intergenic
900719488 1:4166208-4166230 TCACATCTGGAGCTCTGCACTGG + Intergenic
900832223 1:4973459-4973481 TACCAGAAGGGACTCTGCACAGG + Intergenic
902273954 1:15325951-15325973 TGCCATCAGGGGCTCCCCACAGG - Intronic
902687883 1:18090777-18090799 TGCCACCTGGGCCTCTGCATAGG + Intergenic
902791969 1:18775522-18775544 CCGCCTCAGGGCCTTTGCACTGG - Intergenic
903161813 1:21494465-21494487 TCCCCACAGAGCCCCTGCACTGG + Intergenic
903291286 1:22315840-22315862 TGCCCTCAGGGCCTCCGCACTGG - Intergenic
903323228 1:22554808-22554830 TCCCATCACGCCCTCTGCCTCGG + Intergenic
903344439 1:22675429-22675451 TCCCTCCACGGCCTCTGAACCGG + Intergenic
903814871 1:26057566-26057588 TCCCACCAGGACCTCTGTCCAGG - Intronic
904314880 1:29653609-29653631 ACCCATCAGTTCCCCTGCACTGG + Intergenic
905268280 1:36770035-36770057 TTACATCAGGGCCTTTGCATTGG + Intergenic
905301401 1:36988457-36988479 TGCCAGCAGGGCCTCTGGGCGGG - Intronic
905391730 1:37640082-37640104 TCATCTCAGGGCCTTTGCACAGG + Intergenic
906223828 1:44104601-44104623 TCCCACCATAGCCTCTGCCCAGG + Intergenic
906706186 1:47896491-47896513 TCCCACCAGGGTCTCTGCTTGGG - Intronic
907426836 1:54385117-54385139 TGCCATCAGGGGCTGTGCTCAGG - Intronic
907470566 1:54670944-54670966 TCCCAGCAGGGCCTCAGGGCTGG + Intronic
908199741 1:61781973-61781995 GCCCATCAGAGACTCTGCACAGG + Intronic
910506493 1:87955275-87955297 CCCCATCAAGGCATTTGCACCGG - Intergenic
912481271 1:109984016-109984038 TGCCAGCAGGGCCTCAGCACAGG + Intergenic
913111307 1:115659721-115659743 TCCCAACAGGGGCTCTCCAGTGG - Exonic
915485160 1:156215228-156215250 TCACCTCAGGGACTTTGCACAGG - Intronic
915599493 1:156913500-156913522 CCCCTCCAGGGCCTCTGGACAGG + Exonic
915832074 1:159140528-159140550 TCCCATGCGGGACTCTGGACGGG - Intronic
916173355 1:162018618-162018640 TCCTGCCAGGGCCTCTGTACTGG - Intronic
916477833 1:165186578-165186600 TCCCAGCAGAGGCTCTGCTCAGG - Intergenic
917484681 1:175444891-175444913 CCCACTCAGGGCCTTTGCACAGG - Intronic
917795533 1:178530239-178530261 TCCCATCACTGCCACAGCACTGG + Intronic
918099870 1:181364073-181364095 TCCCATTAGGGCCTTTGTAATGG + Intergenic
919396377 1:197053870-197053892 TCACTTCAGGGCCTTTGCACTGG - Intronic
922323313 1:224506465-224506487 TGCCAGCAGATCCTCTGCACTGG - Intronic
922507477 1:226134900-226134922 CTACCTCAGGGCCTCTGCACTGG + Intergenic
923056295 1:230427569-230427591 CCACATCAGGGGCTCTGCACAGG + Intergenic
923219604 1:231881206-231881228 TGGCAACAGGGCCTCTGCATTGG + Intronic
923247645 1:232148212-232148234 TCCCATGATGGGCTCTGCTCTGG + Intergenic
924167665 1:241302147-241302169 TCACCTCAGGGCCTCTACGCTGG - Intronic
924405339 1:243739098-243739120 TCCTATGAGAGCCTCTGAACTGG + Intronic
1063035015 10:2278184-2278206 TGCCATGAGGGCCCCTGCCCTGG - Intergenic
1064005828 10:11698221-11698243 TCACCTCAGGGCCTTTGCATGGG + Intergenic
1064061852 10:12144710-12144732 TCACCTCAGGGCCTTTGCACTGG - Intronic
1064261922 10:13792865-13792887 TTGCCTCAGGGCCTCTGCAGAGG + Intronic
1064366885 10:14716398-14716420 TGCCATGTGGGCCTCTCCACAGG + Intronic
1067052347 10:43029147-43029169 ACCCAGCAGGGCCTCCGCCCGGG + Intergenic
1067166182 10:43868142-43868164 ACCCATCAGGGCCTCATCTCTGG + Intergenic
1067738117 10:48874820-48874842 TCCCATCTGGGCCTCTTCTTTGG + Intronic
1069454678 10:68544795-68544817 TCCCATTAGTGCCTTTGCATTGG - Intergenic
1069568893 10:69482306-69482328 TCACCCCAGGGCCTTTGCACAGG - Intronic
1069854784 10:71434112-71434134 TTGCCTCAGGGCCTTTGCACAGG + Intronic
1070595499 10:77830147-77830169 TCTCTTCGGGTCCTCTGCACTGG + Intronic
1071470682 10:85982037-85982059 TCACCTCAGGGCCTTTGCACTGG - Intronic
1071803540 10:89091845-89091867 TACCAGCAGAGCCTCTGCAGGGG + Intergenic
1073102441 10:101013609-101013631 TCCCTGCAGGGCTGCTGCACAGG + Intronic
1073822869 10:107285240-107285262 TCCCATGAGGACTTCAGCACAGG - Intergenic
1074569323 10:114610287-114610309 TCCAATCCTGGCCTCTGCTCAGG - Intronic
1075001534 10:118802337-118802359 TCGCATGAGGCCCTGTGCACTGG + Intergenic
1076887824 10:133270658-133270680 CCCCAGAAGGGCCTCTGCAAAGG - Intronic
1077283396 11:1755454-1755476 TGGCCGCAGGGCCTCTGCACTGG + Intronic
1077419555 11:2444185-2444207 TCCCACCAGGGCCCTTGGACCGG - Intergenic
1077639026 11:3864492-3864514 TGCCATATGGGCCTCTACACTGG + Intronic
1078007098 11:7540293-7540315 TCCCATCAGAGTGGCTGCACTGG - Intronic
1079256361 11:18834643-18834665 CCACAGCAGGACCTCTGCACAGG + Intergenic
1080195459 11:29603429-29603451 TCACATGAGGGCCTCTGCTATGG + Intergenic
1080416402 11:32073368-32073390 TCCCCTCAGGGCCTCTGCTGGGG + Intronic
1080526641 11:33128851-33128873 TTCCTTTAAGGCCTCTGCACTGG + Intronic
1082013466 11:47467018-47467040 TCCCAGCAGGGTTTCTGCTCTGG - Intronic
1083325606 11:61871517-61871539 TGCATTCAGGGTCTCTGCACAGG - Intergenic
1084001154 11:66296014-66296036 TCCCAGCATGGCCTCAGCCCCGG - Exonic
1084332602 11:68438661-68438683 TCCCAGCATGGCCCCTTCACAGG + Exonic
1084417362 11:69040740-69040762 TGCCATATGGGCCTCTCCACAGG - Intergenic
1084764850 11:71301599-71301621 TCCCAGCTGGGCCCCTGCAGGGG - Intergenic
1085259006 11:75193638-75193660 TGCCATCCTGGCCTCTGCCCAGG - Intronic
1086299194 11:85407025-85407047 TTGCCTCAGGGCCTTTGCACTGG - Intronic
1091382998 12:74948-74970 GCCCATCAGGGCTGCTTCACAGG + Intronic
1091912947 12:4246369-4246391 TGACAGCAGGGCCTCTGCAAGGG + Intergenic
1093828425 12:23724790-23724812 TACCATCAGGGCATTTGCACTGG - Intronic
1094322860 12:29204539-29204561 TCACCCCAGGGCCTTTGCACAGG - Intronic
1094339538 12:29395577-29395599 TGCCATGTGGGCCTCTCCACTGG - Intergenic
1101046359 12:100810303-100810325 CCTTCTCAGGGCCTCTGCACTGG - Intronic
1101451295 12:104781405-104781427 TCATCTCAGGGCCTCTGCACTGG - Intergenic
1102162731 12:110782587-110782609 TGCCCTTGGGGCCTCTGCACTGG - Intergenic
1102184688 12:110938494-110938516 TCACCTCGGGGCCTCTGCCCTGG - Intergenic
1102199551 12:111047977-111047999 CCACCTCAGGGCCTTTGCACAGG - Intronic
1102204364 12:111080115-111080137 TCACCTCAGGGCCTTTGCACTGG + Intronic
1102499273 12:113340265-113340287 TCGCCTCAGGGCTTCTGCATGGG + Intronic
1102553922 12:113713332-113713354 CCACCTCAGGGCCTTTGCACTGG - Intergenic
1102985304 12:117272894-117272916 TACCCTCAGGGCCTTTGCACAGG + Intronic
1104088033 12:125493647-125493669 TCCCATCAATGCCAGTGCACTGG - Intronic
1104211133 12:126689775-126689797 TCCCATCAGAGTCTCTGACCAGG - Intergenic
1104341309 12:127951941-127951963 TCCCATCTGTGTGTCTGCACGGG + Intergenic
1104345620 12:127994011-127994033 TCCATTCTGAGCCTCTGCACAGG + Intergenic
1104904566 12:132206242-132206264 ACCCCTCAGGGCCTTGGCACAGG + Intronic
1107343260 13:39432428-39432450 TCCCCTCAATGCCTCTGCATGGG + Intronic
1108531306 13:51329916-51329938 ACCCATAAGGGACTCTGCCCTGG + Intergenic
1111413006 13:87901382-87901404 TTCCAGCTGGGCCTCTGCAACGG + Intergenic
1113160559 13:107376107-107376129 TCCCATCTGGGCCTCTCCAAGGG - Intronic
1116281522 14:42914682-42914704 TCCCAGTAGGGACTCTGCATGGG + Intergenic
1116959142 14:50952243-50952265 TGCCACCAGGGCCTTAGCACAGG + Intergenic
1117145689 14:52835188-52835210 TCCCATCAATGCCTCTTCCCTGG + Intergenic
1117345059 14:54823364-54823386 CCCCATCAGAGCCCCTGGACTGG - Intergenic
1118656314 14:67953607-67953629 TCTCACCTGGGCCTCTGCAATGG - Intronic
1118978019 14:70694018-70694040 CCACCTCAGGGCCTTTGCACTGG + Intergenic
1121039019 14:90729798-90729820 TCCCATCAGGCCCACCCCACTGG + Intronic
1121630985 14:95421820-95421842 TCGCCACAGGGCCTTTGCACAGG + Intronic
1122004303 14:98689225-98689247 TCCCATCAAGGCCCCACCACCGG - Intergenic
1122509948 14:102258335-102258357 TGGCCTCAGGGCCTTTGCACTGG + Intronic
1122874910 14:104659540-104659562 CCCCAACAAGCCCTCTGCACTGG + Intergenic
1122900247 14:104779449-104779471 GCCCATCAGGGCCTCTCCTTGGG - Intronic
1124720091 15:32104276-32104298 CCCCCTCAGGGCCTTTGCACTGG + Intronic
1126208961 15:46078120-46078142 TCCCATCCAGACCACTGCACTGG - Intergenic
1126605313 15:50470451-50470473 TTCCCTAAGGGCCTCTGCTCTGG - Intronic
1126885736 15:53147817-53147839 CCACCTCAGGGCCTCTGCACTGG - Intergenic
1127415867 15:58756706-58756728 TCCCTTCTGGGCCTGGGCACGGG + Intergenic
1127427040 15:58867068-58867090 GCGCCTCAGGGCCTTTGCACTGG - Intronic
1127726370 15:61753847-61753869 TTCCATCAGCACCACTGCACTGG + Intergenic
1128113741 15:65092890-65092912 TCCCATCTGCCCCTCTGCAGAGG + Exonic
1128267448 15:66279187-66279209 CCCCATCAGGGCCTCTAAGCAGG + Intergenic
1128686460 15:69689907-69689929 TCTCATGTGGGCCTCTCCACAGG - Intergenic
1128769567 15:70271747-70271769 ACCCATAAGGGCCTCAGGACAGG + Intergenic
1129410235 15:75346997-75347019 TCGCCTCAGGGCCTTTGTACTGG + Exonic
1129756054 15:78099830-78099852 CCACCTCAGGGCCTCTGCACTGG + Intronic
1129764956 15:78158720-78158742 GCCCACCTTGGCCTCTGCACCGG + Intronic
1132882106 16:2167063-2167085 TCCCCTCAGGGGCTCTCCAGGGG + Intronic
1133770059 16:8862680-8862702 GGCCCTCAGGGCCTTTGCACAGG - Intronic
1138343378 16:56305506-56305528 TCCACTAGGGGCCTCTGCACTGG - Intronic
1138631194 16:58295435-58295457 TCCCATCTGGGCCTCTGGTTTGG - Intronic
1139343601 16:66288107-66288129 TGCCATGTGGGCCTCTCCACAGG + Intergenic
1139572994 16:67825024-67825046 CCCCATCAGGGACTGTGAACAGG - Intronic
1139577956 16:67854363-67854385 ACCCATCAGGGCATCTTCCCAGG + Intronic
1139703113 16:68721663-68721685 TCCCTTCTGGGCCTTTGCCCAGG + Intronic
1140140537 16:72252463-72252485 CCACCTCAGGGCCTTTGCACTGG - Intergenic
1140515199 16:75536073-75536095 TCCCAGCTGGGACACTGCACCGG - Intronic
1141570819 16:84932672-84932694 TGACCTCAGGGCCCCTGCACTGG - Intergenic
1141687517 16:85578746-85578768 CCACCTCAGGGCCTTTGCACAGG + Intergenic
1142128956 16:88423742-88423764 TCACCTCATGGCCTCTCCACGGG + Intergenic
1142271526 16:89092214-89092236 TCCCATCTGTGCCTCGGCTCTGG - Intronic
1143094002 17:4467053-4467075 CTCCCTCAGGGCCTCCGCACAGG - Intronic
1143188440 17:5024161-5024183 CCCCACCAGGCCCTCTGCCCAGG - Exonic
1143330390 17:6130680-6130702 TGCCACCTGGGCCTCTCCACAGG + Intergenic
1143721172 17:8810948-8810970 CCCCAGCAGGGACTCTGCATGGG + Intronic
1145254722 17:21316338-21316360 TCACCCCAGGGCCTTTGCACTGG + Intergenic
1145321876 17:21771627-21771649 TCACCCCAGGGCCTTTGCACTGG - Intergenic
1146367181 17:32238221-32238243 TTCCTTCAGAGCCTTTGCACTGG + Intronic
1147955080 17:44128593-44128615 GCTCTTCAGGGCCTTTGCACAGG + Intergenic
1148127203 17:45242969-45242991 TCCCATCAGGGCCTGTGGTCAGG + Intronic
1150487599 17:65554728-65554750 TCCCATTGGGCCCTCTGCTCTGG - Intronic
1154111361 18:11571289-11571311 TCTCATCAGGGACTCTACCCGGG - Intergenic
1155937424 18:31768106-31768128 TCCCCACAGGGCCTCTTCAAGGG + Intergenic
1156374493 18:36501290-36501312 TCACATGAGGGCCTCTGGGCAGG - Intronic
1156510262 18:37630491-37630513 GTCCCTCAGGGCCTTTGCACTGG + Intergenic
1158427725 18:57353772-57353794 TCCCAGCAGGGCCTCCTGACGGG + Intronic
1161397639 19:4052848-4052870 TGGCCTCAGGGCCTCTGCACTGG + Intronic
1162156368 19:8680859-8680881 CCACCTCAGGGCCTTTGCACAGG - Intergenic
1162446231 19:10724569-10724591 CCACATCAGGACCTTTGCACTGG - Intronic
1162705440 19:12551514-12551536 TCCAATCAGGAACTCTGCAAGGG - Exonic
1162829985 19:13278356-13278378 CCACCTCAGGGCCTTTGCACAGG + Intronic
1164023477 19:21329420-21329442 TCCAATCAGGGACTCTGAGCTGG - Intronic
1164177039 19:22784211-22784233 TCCAATCAGGGACTCTGGGCTGG - Intergenic
1164199265 19:23003238-23003260 TCCAATCAGGGACGCTGGACTGG - Intergenic
1164413161 19:28022258-28022280 CCTCATCAGGGCCTCTGCTGAGG + Intergenic
1164413180 19:28022316-28022338 CCTCATCAGGGCCTCTGCTGAGG + Intergenic
1165323890 19:35102869-35102891 CCACCTCAGGGCCTTTGCACAGG + Intergenic
1165335325 19:35165882-35165904 TCACCTCAGGGCCTTTGCACTGG - Intronic
1165380237 19:35474317-35474339 TCCCTTCAGGGCCTGCACACAGG + Intergenic
1165388228 19:35524242-35524264 TTCCATAGGAGCCTCTGCACTGG + Intronic
1165494910 19:36146784-36146806 TCCCTTCTAGGCCTTTGCACAGG - Intronic
1165699298 19:37925400-37925422 TCACCTCAGGGCCTTTGCACTGG - Intronic
1165723053 19:38093291-38093313 CCGCCTCAGGACCTCTGCACTGG - Intronic
1165767642 19:38361134-38361156 TCCCATCAGGGCCTCTGCACAGG - Intronic
1166220294 19:41359955-41359977 CCACCTCAGGGCCTTTGCACTGG + Intronic
1166983017 19:46642782-46642804 TTGCCTCAGGGCCTTTGCACTGG + Intergenic
1166997369 19:46726108-46726130 CTGCCTCAGGGCCTCTGCACGGG - Intronic
1167090339 19:47339716-47339738 CCACCTCAGGGCCTTTGCACTGG + Intronic
1167094650 19:47368166-47368188 CCCCCACAGGGCCTCTGTACTGG - Intronic
1167182042 19:47912090-47912112 CCCCCACAGGGCCTCTGTACTGG + Intergenic
1167184008 19:47927858-47927880 CCCCCACAGGGCCTCTGTACTGG + Intergenic
1167185331 19:47938571-47938593 CCCCCACAGGGCCTCTGTACTGG + Intergenic
1167186649 19:47949328-47949350 CCCCCACAGGGCCTCTGTACTGG + Intergenic
1167187300 19:47954716-47954738 CCCCCACAGGGCCTCTGTACTGG + Intergenic
1167209180 19:48122453-48122475 CTCCCTCAGGGTCTCTGCACCGG + Intronic
1167281950 19:48574441-48574463 TTCCTTCAGGGCCTCTCCAAGGG + Intronic
1167541889 19:50093548-50093570 CCCCCACAGGGCCTCTGTACTGG - Intergenic
1167543869 19:50108083-50108105 CCCCCACAGGGCCTCTGTACTGG - Intergenic
1167544543 19:50113437-50113459 CCCCCACAGGGCCTCTGTACTGG - Intergenic
1167545218 19:50118787-50118809 CCCCCACAGGGCCTCTGTACTGG - Intergenic
1167545895 19:50124139-50124161 CCCCCACAGGGCCTCTGTACTGG - Intergenic
1167546572 19:50129474-50129496 CCCCCACAGGGCCTCTGTACTGG - Intergenic
1167547232 19:50134808-50134830 CCCCCACAGGGCCTCTGTACTGG - Intergenic
1167631179 19:50627186-50627208 TCCCCTCAGGGCATCTGCCCAGG + Intronic
1168275711 19:55277231-55277253 TGGCCTCAGGGCCTTTGCACTGG + Intronic
1168282832 19:55314701-55314723 CACCATCAGGGCCCCTGCAAAGG + Intronic
926313854 2:11695440-11695462 CCACCTTAGGGCCTCTGCACTGG - Intronic
927111926 2:19869571-19869593 AACCTTCAGGGCCTCTGTACTGG + Intergenic
929404481 2:41625931-41625953 TGCCATGTGGGCCTCTCCACAGG + Intergenic
929573663 2:43039217-43039239 TCTCATCAGGGCCTCTTCCCAGG + Intergenic
929994699 2:46817942-46817964 TCCCATCTGTGCCTTTGCAGGGG - Intronic
931456726 2:62415365-62415387 TCCCAGGAGGGCCTCTCCCCAGG - Intergenic
931656825 2:64517104-64517126 TCCCAGCACAGCCTCTGCACAGG + Intergenic
932423256 2:71613550-71613572 TCCCATCTGGGTCTCTCTACTGG - Intronic
932845826 2:75135161-75135183 TCCCATGCGGGCCCCAGCACAGG + Intronic
933727277 2:85434072-85434094 TGCCCTCAGGCCCTCTGCCCAGG + Intronic
934689465 2:96347202-96347224 TCCCCTGCGGGCCTCTGCAGTGG - Intronic
934857170 2:97736732-97736754 CCACCTCAGGGCCTCTGCACAGG - Intronic
934921559 2:98348214-98348236 TCCCCTCCGGGCATCTACACAGG - Intronic
935955220 2:108369570-108369592 TCCCATCACATCCTTTGCACAGG - Intergenic
937096759 2:119240664-119240686 TCCCCTCTGGGTCTCTGCCCAGG - Intronic
937142971 2:119617895-119617917 CGGCATCAGGACCTCTGCACTGG + Intronic
937359423 2:121218655-121218677 TCCCATCAGCTGCCCTGCACAGG + Exonic
937823219 2:126335088-126335110 CTCCATCACAGCCTCTGCACAGG - Intergenic
938635480 2:133220933-133220955 TTCCATCAGGGCATCCTCACAGG - Intronic
938956704 2:136305653-136305675 TGCCATGTGGGCCTCTGCACAGG + Intergenic
939508374 2:143076245-143076267 CCCCATTAGGGACTCTGCATGGG - Intergenic
939753666 2:146082172-146082194 CCACCTTAGGGCCTCTGCACTGG + Intergenic
940864672 2:158806060-158806082 TCCTAGCAGGGCATGTGCACAGG + Intronic
942318812 2:174718183-174718205 CACCATCAGGGCCTCTCCACAGG + Intergenic
942483955 2:176419588-176419610 GGCAATCAGGGCCTCTGCCCTGG - Intergenic
943369910 2:187003122-187003144 TCCCATCAGAGCCATTGCAATGG + Intergenic
943595396 2:189849159-189849181 TCTCAACAGGGCCACTGCTCTGG + Intronic
944137497 2:196414985-196415007 TCACTTCAGGGCCTCAGCAGGGG - Intronic
946146823 2:217737518-217737540 TCCTGTCTGGGCCTCTGCCCAGG + Intronic
946385580 2:219382382-219382404 TCACATCTGGGGCTCAGCACAGG + Intronic
947024114 2:225717085-225717107 TCCCTTCAGGGCCTCTTGAAAGG - Intergenic
947329280 2:229011895-229011917 TCCCATCAGAGCCCCTTCCCAGG - Intronic
947516459 2:230809123-230809145 TCCCGAAAGGGCCTCTGTACAGG - Intronic
948742184 2:240055360-240055382 TGACCTCAGGGTCTCTGCACGGG - Intergenic
1170008752 20:11697610-11697632 GCCCATCAGAACTTCTGCACAGG + Intergenic
1170119987 20:12901135-12901157 TCTCCTCAGGTCCCCTGCACAGG - Intergenic
1170436609 20:16337169-16337191 CCACCTCAGGGCCTTTGCACGGG + Intronic
1171250010 20:23639676-23639698 CCGCCTCAGGGCCTTTGCACTGG - Intergenic
1171256110 20:23690191-23690213 CCACCTCAGGGCCTTTGCACTGG - Intergenic
1171263460 20:23752101-23752123 CCACCTCAGGGCCTTTGCACTGG - Intergenic
1171266753 20:23777400-23777422 CCGCCTCAGGGCCTTTGCACTGG - Intergenic
1171272513 20:23827873-23827895 CCACCTCAGGGCCTTTGCACTGG - Intergenic
1171276299 20:23859044-23859066 CCGCCTCAGGGCCTTTGCACTGG - Intergenic
1171284056 20:23923421-23923443 CCACCTCAGGGCCTTTGCACTGG - Intergenic
1172888290 20:38246322-38246344 TCACCTCGGGGCCTTTGCACTGG + Intronic
1173353369 20:42264833-42264855 GCCCATCAGGGCCTCAGGCCTGG - Intronic
1174143947 20:48437647-48437669 TCCCATCAGTGACTCAGCCCAGG + Intergenic
1174397685 20:50258055-50258077 CCGCCTCAGGGCCTTTGCACTGG - Intergenic
1175068219 20:56308722-56308744 TGCCCTCAGGACCTTTGCACTGG - Intergenic
1175276012 20:57771289-57771311 CCCCAACAGGGCCTGTGCACAGG - Intergenic
1175464007 20:59177421-59177443 CCACCTCAGGGCCTTTGCACTGG + Intergenic
1175615076 20:60390948-60390970 TAACCTCAGGGCCTTTGCACTGG - Intergenic
1175635775 20:60581787-60581809 CCCCATATGGGCCTCTGCACAGG + Intergenic
1176200444 20:63857995-63858017 TCCCTGCAGGGCCTGTGCTCTGG - Intergenic
1176246148 20:64098123-64098145 TGCCATCATGGGCTCGGCACAGG + Exonic
1178772635 21:35519905-35519927 CCCACCCAGGGCCTCTGCACGGG - Intronic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1180954759 22:19736722-19736744 TCCCATCAGGGCCACAGCTGGGG + Intergenic
1181114122 22:20620681-20620703 TCCCAGGAGACCCTCTGCACAGG - Intergenic
1181584321 22:23844838-23844860 TTACCTCAGGGCCTTTGCACAGG - Intergenic
1182306258 22:29370928-29370950 TCCCATTGGGCCCTCTGCAGAGG - Intronic
1184572920 22:45337924-45337946 TCCCATCAGACCCTCTTCATAGG - Intronic
1185332191 22:50256806-50256828 TCCCACCAGGGGCTGTGCATAGG + Intronic
949508664 3:4749859-4749881 GCCCATCAGGGCTTATGAACAGG - Intronic
950563435 3:13749247-13749269 TCACCTCAGGGCCTTTGCACGGG + Intergenic
950659841 3:14460510-14460532 ACACCTCAGGGCCTTTGCACAGG - Intronic
951467204 3:23014372-23014394 TGGCTTCAGGGCCTCTGCTCTGG - Intergenic
951561965 3:23976571-23976593 TGCCATGTGGGCCTCTCCACAGG + Intronic
953046673 3:39298856-39298878 CCCCACCAGGGCCTCAGGACTGG + Intergenic
953153860 3:40350970-40350992 TCACATCAGGAACCCTGCACAGG - Intergenic
953407279 3:42665686-42665708 TCCCTCCTGGGCCTGTGCACCGG + Exonic
954008644 3:47614993-47615015 CTGCCTCAGGGCCTCTGCACTGG + Intronic
954200310 3:49020119-49020141 TCCCAGCAGGGCCTCAGCCCTGG - Intronic
954382858 3:50228740-50228762 TCACATTAGGGCCTTTGCACTGG + Intronic
954587766 3:51751575-51751597 TCCCTGCAGGGCCACTGCATGGG + Intergenic
954659500 3:52219421-52219443 TCCACTCAGGGCCTCTGGAGGGG - Intergenic
955621236 3:60866436-60866458 CCCCATGTGGGCCTCTCCACTGG - Intronic
955747048 3:62150236-62150258 TGCCCCCAGGGCCTTTGCACTGG - Intronic
956501654 3:69893211-69893233 TCCCCTGAGGACTTCTGCACTGG + Intronic
956844157 3:73167030-73167052 TCCCACATGGGCCTCTCCACAGG + Intergenic
957309164 3:78497314-78497336 TCCCACCAGGCCCTCATCACTGG - Intergenic
957966059 3:87323414-87323436 CCCCATCACAGCCTCTGCCCAGG - Intergenic
960622581 3:119651188-119651210 CCACCTCAGGGCCTTTGCACTGG + Intronic
961107531 3:124254899-124254921 ACTCCTCAGGGCCTTTGCACAGG + Intronic
961376157 3:126467415-126467437 TGCCTACAGAGCCTCTGCACGGG + Intronic
961385657 3:126521980-126522002 TCACCTCAGGGCCTTTGCAATGG + Intergenic
961490494 3:127253917-127253939 TTTCCTCAGGGTCTCTGCACAGG + Intergenic
961648912 3:128407827-128407849 TCCCTCCAGGGCCTGAGCACGGG + Intronic
962306354 3:134290013-134290035 TTCCATCAGGTCCTCTTCAGAGG - Intergenic
962723928 3:138203506-138203528 TGCCATGTGGGCCTCTCCACGGG + Intronic
966986063 3:185181368-185181390 TCCCATCACAACTTCTGCACGGG - Intergenic
968028842 3:195465709-195465731 TCCACTCAGGGTCTTTGCACCGG - Intergenic
968509210 4:987984-988006 TCCCATCTGTGCCTCTGTAAGGG - Exonic
968913775 4:3488314-3488336 CCCCATCAGGACCTCAGAACAGG - Intronic
969461889 4:7333399-7333421 TCCCATCTGGGCTGCCGCACCGG - Intronic
969839470 4:9870123-9870145 TCCCCTCAGAGCCTCTGCAGGGG + Intronic
970976474 4:22048119-22048141 TCCCAGTAGGGACTCTGCATGGG + Intergenic
972272453 4:37524424-37524446 CCCCACCAGGGCCTCACCACAGG + Intronic
972578698 4:40375809-40375831 TTGCCTCAGGGCCTTTGCACTGG + Intergenic
975696966 4:77023065-77023087 GCCCAGCAGGGCTTCTGCAAGGG + Intronic
977552403 4:98456391-98456413 ACCCATCAGGGGCCCTGCAAGGG - Intergenic
978399366 4:108314508-108314530 TCACCTCAGGGCCTTTGTACAGG + Intergenic
980298822 4:130960879-130960901 TCCCATCTTGGCCTCAGCATTGG - Intergenic
981538635 4:145825475-145825497 TCCCATCTGGACTGCTGCACTGG - Intronic
982361424 4:154523608-154523630 TCCCATGGGGGCTTCTGCTCCGG + Intergenic
983817274 4:172146731-172146753 TGCCAGCAGTGACTCTGCACTGG - Intronic
984786800 4:183574604-183574626 TACCATATGGGCCTCTCCACAGG - Intergenic
984938056 4:184907020-184907042 TCCCAACAGGGCCACTTCAAGGG - Intergenic
985358719 4:189148872-189148894 TCGCATCAGGACCTCATCACAGG - Intergenic
986016561 5:3762623-3762645 TCCCATCAGTGACTCTTCCCAGG + Intergenic
986195977 5:5536704-5536726 GCCCATCAGGGCCTCAGCCAAGG + Intergenic
987249961 5:16089909-16089931 TCCAATCTGGGCCTCTGCCAGGG - Intronic
987294746 5:16539666-16539688 TCACATCAGGGCCCCGGTACCGG - Intronic
991517755 5:67457674-67457696 TCCCATGTGGGCCTCTCCAAAGG - Intergenic
991614250 5:68479647-68479669 TTCCATCAGGGCTTGTGGACAGG + Intergenic
991915014 5:71597179-71597201 CCACCTCAGGGCCTTTGCACTGG - Intronic
993918660 5:93772780-93772802 TGCCATGTGGGCCTCTCCACAGG + Intronic
994633285 5:102312731-102312753 TGCCATGTGGGCCTCTCCACAGG - Intergenic
996658197 5:125966974-125966996 TCCCTTCAGGATCTCTGCAGAGG + Intergenic
998471818 5:142389608-142389630 ACCCCTCAGGGCCTTTGTACAGG - Intergenic
999051727 5:148530638-148530660 CCCCAGTAGGGACTCTGCACAGG - Intronic
999275767 5:150329063-150329085 CCCCAACAGGGCCTTTGCACTGG + Intronic
999323914 5:150631431-150631453 TCCCCTCAGGGCCTCTGCACTGG - Intronic
1000006376 5:157188476-157188498 TCTCAGCAGGGCCTTTGTACAGG + Intronic
1000348156 5:160331721-160331743 TCCCATCACGGTCAGTGCACAGG - Intronic
1001288659 5:170441171-170441193 GCCCAGCAGGGCCTCTGCCCTGG + Intronic
1001380206 5:171301170-171301192 TCCCAAATGGGCCTCTTCACAGG + Intergenic
1001698834 5:173692065-173692087 GCACCTCAGGGCCTTTGCACAGG - Intergenic
1002795726 6:469784-469806 TCACAACATGGCCTCTGCAGAGG + Intergenic
1002807581 6:591850-591872 TTCCCTCAGGGCCTCCACACAGG + Intronic
1002929558 6:1624095-1624117 TCCCCGCAGCGCGTCTGCACCGG + Exonic
1003735762 6:8876177-8876199 TCCCACCAGGGCCTCTGAACTGG - Intergenic
1004483171 6:16040336-16040358 TCCCACCATGGCCCCCGCACGGG - Intergenic
1005823017 6:29613371-29613393 TGCCATCTGGGCCTTGGCACTGG - Exonic
1005838771 6:29726235-29726257 TCACATCAGGGCCCCTGCCCTGG - Intronic
1006427795 6:33976965-33976987 CTGCCTCAGGGCCTCTGCACTGG + Intergenic
1006447131 6:34085956-34085978 TCGCCTCAGGGCCTTTGCACGGG - Intronic
1006450353 6:34102426-34102448 CCGCCTCAGGGCCTTTGCACTGG + Intronic
1006451188 6:34106616-34106638 CCACCTCAGGGCCTTTGCACTGG + Intronic
1007366790 6:41399725-41399747 TCCCATGTGGGCCTTTCCACAGG - Intergenic
1007374688 6:41448444-41448466 TTGCCTCAGGGCCTTTGCACAGG + Intergenic
1007471098 6:42090968-42090990 TTGCCTCAGGGCCTTTGCACTGG - Intergenic
1007946298 6:45830066-45830088 TGGCCTCAGGGCCTTTGCACTGG + Intergenic
1008385339 6:50882963-50882985 TCCAAACAGTCCCTCTGCACAGG - Intergenic
1010517652 6:76792299-76792321 TTCAATCAGGGTCTCTGCATGGG + Intergenic
1013035481 6:106378394-106378416 TCCCATCACTGCCACTGCTCAGG + Intergenic
1015489086 6:133805145-133805167 TCCCACCATAGCCTCTTCACTGG - Intergenic
1017182182 6:151564370-151564392 TCCCATCGGGGCCTGAGGACTGG - Intronic
1017697275 6:157029678-157029700 TCACCTGAGGGCCTTTGCACTGG - Intronic
1018837827 6:167498419-167498441 TCCTAACAGGGCCAGTGCACGGG - Intergenic
1019266623 7:120804-120826 ACCCCTCAGGGCCTCTGGACAGG + Intergenic
1019702641 7:2481407-2481429 TCACTCCAGGGCCTTTGCACGGG - Intergenic
1019949909 7:4362961-4362983 CCACCTCAGGGCCTTTGCACAGG + Intergenic
1021533457 7:21675323-21675345 TCCATTCAGGGCCTTTACACAGG + Intronic
1022289963 7:28991236-28991258 TCCCATCAGGCACCCTGCTCCGG - Intergenic
1022542611 7:31152786-31152808 CCACATCAGGGCCTTTGCAATGG + Intergenic
1022636623 7:32142349-32142371 ACCCTTGAGGGCCTGTGCACAGG - Intronic
1023167316 7:37355666-37355688 TTCCATCAGGGCATCTGCTCAGG - Intronic
1024237000 7:47406453-47406475 CCTCATGAGGGCCTCTGCACTGG - Intronic
1025777812 7:64574611-64574633 TCCAATCAGGGACTCTGGGCTGG + Intergenic
1026450464 7:70524862-70524884 TCTCATCGAGGCGTCTGCACTGG - Intronic
1026466845 7:70661784-70661806 CACGAGCAGGGCCTCTGCACAGG + Intronic
1029712768 7:102308587-102308609 TCCCTTCTGGGCCTCCCCACTGG - Intronic
1030120028 7:106100994-106101016 TTCCTTCAGGACCTTTGCACTGG + Intronic
1032840912 7:135712929-135712951 CCCCATCATAGCCTCTGCCCAGG + Intronic
1033302227 7:140196723-140196745 TGCCATGTGGGCCTCTCCACAGG - Intergenic
1033639449 7:143247112-143247134 TCCCATCACTTCCTCTCCACAGG + Intronic
1039827719 8:41189122-41189144 TCTCATCAGGGCATTTCCACGGG + Intergenic
1040661300 8:49579145-49579167 TCCCATTAAGCCCTCTGCAGAGG - Intergenic
1041285109 8:56252688-56252710 TTCCTTCGGGGCCTCTGCTCAGG - Intergenic
1042570390 8:70157133-70157155 GCCCATCAGGCCCTGTGCAGTGG - Exonic
1043505177 8:80895459-80895481 TGCCAGCAGGGCCACTCCACAGG - Intergenic
1045920437 8:107522618-107522640 TCTCATCAGTGCCTGGGCACAGG - Intergenic
1047864151 8:129003359-129003381 TGCCATCAGGGCCTCTAGAATGG + Intergenic
1048158765 8:131991712-131991734 TCCCAACATGGCCTCTCCTCAGG - Intronic
1048934696 8:139345120-139345142 TCTCTGCAGGGCCTCTGCGCTGG + Intergenic
1049150470 8:141032089-141032111 CCTCCTCAGGGCCTTTGCACGGG - Intergenic
1049252833 8:141598331-141598353 TCCCGTGTGGGCCTCTACACAGG + Intergenic
1049666036 8:143843120-143843142 TCCCCTCAGGGTCTCTGCCCTGG + Intergenic
1050027047 9:1346289-1346311 GCACCTCAGGGCCTTTGCACTGG + Intergenic
1052694281 9:31855743-31855765 TCCCATAAGGGCCTCTGGTAAGG - Intergenic
1052772723 9:32704502-32704524 TCCCAGCAGGGCAGCTGCCCTGG + Intergenic
1052878263 9:33583676-33583698 GCCCATGAGGGCAGCTGCACAGG + Intergenic
1053497720 9:38560531-38560553 GCCCATGAGGGCAGCTGCACAGG - Intronic
1056326175 9:85480592-85480614 TCACATCAGGGCCTCTGCACTGG + Intergenic
1056883986 9:90421911-90421933 TCCCATCAAGAGCTCTGCATGGG + Intergenic
1057219034 9:93245899-93245921 TGCCAGGAGGGCCTCTGCATAGG + Intronic
1057305821 9:93911383-93911405 TCCCATCACGGGGTCTGCCCAGG - Intergenic
1058469896 9:105266989-105267011 CCCCATCAGTGTCTCTGTACTGG + Intronic
1058824811 9:108765761-108765783 TTCCTTCAGGGCCTTTGCACTGG - Intergenic
1058935643 9:109767296-109767318 TTCCATCAGGGCCGCCCCACCGG + Intronic
1060722540 9:125988604-125988626 TGGCCTCAGGGCCTTTGCACGGG + Intergenic
1061010101 9:127949724-127949746 TCCTAACAGCGCCTCTGCAAGGG - Intronic
1061858816 9:133457407-133457429 GCCCAGCAGCGCCTGTGCACTGG - Intronic
1186304463 X:8240774-8240796 TCTCACCTGTGCCTCTGCACGGG - Intergenic
1186607843 X:11110458-11110480 TCCTATGAGGGTCTCTGCAAGGG - Intergenic
1189305781 X:39985682-39985704 CTCCCTCAGGGCCTTTGCACTGG - Intergenic
1189485789 X:41430661-41430683 TCCCACCAGGGACCCTTCACTGG + Intergenic
1190119228 X:47646916-47646938 CCACCTCAGGGCCTCTGAACTGG + Intronic
1190246181 X:48691929-48691951 TCACCTCAGGGCCTTTGCACTGG - Intergenic
1190257549 X:48774862-48774884 ATGCATCAGGGCCTTTGCACTGG - Intergenic
1191718606 X:64210314-64210336 CCACCTCAGGGCCTTTGCACTGG + Intergenic
1191722597 X:64246927-64246949 TCCCTTCAGGGCCTCTGGTAAGG + Intergenic
1193692215 X:84659577-84659599 TCCCTGCAGGTCCTGTGCACTGG - Intergenic
1194977832 X:100410977-100410999 TCCCAGCAGGGCCCCTGGATCGG + Intergenic
1195842227 X:109186676-109186698 TCCCTTCAGGGCCTCCGGATGGG + Intergenic
1196733473 X:118963875-118963897 TCCCATGGGGGTCACTGCACAGG + Intergenic
1197819265 X:130529323-130529345 GCCCAGCAGGGCCACTGCCCAGG - Intergenic
1199737179 X:150695120-150695142 TCACCTCAGGGGCTTTGCACAGG - Intronic