ID: 1165767942

View in Genome Browser
Species Human (GRCh38)
Location 19:38362339-38362361
Sequence GCGCGGGGCAGAGTCAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165767942_1165767953 21 Left 1165767942 19:38362339-38362361 CCGGCGCTGACTCTGCCCCGCGC 0: 1
1: 0
2: 1
3: 13
4: 228
Right 1165767953 19:38362383-38362405 ACTTCTTCTTGGCGAGCAATTGG 0: 1
1: 0
2: 0
3: 3
4: 78
1165767942_1165767945 -8 Left 1165767942 19:38362339-38362361 CCGGCGCTGACTCTGCCCCGCGC 0: 1
1: 0
2: 1
3: 13
4: 228
Right 1165767945 19:38362354-38362376 CCCCGCGCATCCGGTACCCCAGG 0: 1
1: 0
2: 1
3: 13
4: 70
1165767942_1165767952 10 Left 1165767942 19:38362339-38362361 CCGGCGCTGACTCTGCCCCGCGC 0: 1
1: 0
2: 1
3: 13
4: 228
Right 1165767952 19:38362372-38362394 CCAGGATTACTACTTCTTCTTGG 0: 1
1: 0
2: 1
3: 18
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165767942 Original CRISPR GCGCGGGGCAGAGTCAGCGC CGG (reversed) Intronic
901060264 1:6468594-6468616 GCCAGGAGCAGAGTCAGCCCAGG + Intronic
901940577 1:12658678-12658700 GGGCAGGGCAGCATCAGCGCCGG - Intronic
901940600 1:12658759-12658781 GGGCAGGGCAGCATCAGCGCTGG - Intronic
902226245 1:14998148-14998170 GCGGGGGGGAGGGGCAGCGCGGG + Intronic
902531617 1:17094297-17094319 GGGTGGGGCAGAGTGAGCGAGGG - Intronic
903460328 1:23516381-23516403 GGGCTGGGCAGAGTCAGGGCTGG + Exonic
903640603 1:24857360-24857382 GCGAGGGGTAGAGTGAGTGCTGG + Intergenic
903647294 1:24903000-24903022 GCTGAGGGCAGAGTCAGCTCAGG + Intronic
905580680 1:39081299-39081321 GCGGGGGGCGGCGTCGGCGCTGG + Intronic
908132057 1:61083362-61083384 GCGGGGGGCTGCGGCAGCGCAGG - Intronic
910206558 1:84754241-84754263 GCTCTGGGCAGAATCAGCGCTGG + Intergenic
910392463 1:86758965-86758987 GCCCGGAGGAGAGTCAGGGCAGG - Intergenic
911188586 1:94926905-94926927 GCGGCGGGAAGAGACAGCGCTGG + Exonic
912927898 1:113929700-113929722 GCGCGGGGCTGAGGCGGCGGCGG + Exonic
913957580 1:143319117-143319139 GGGCTGAGCAGAGTCAGGGCAGG + Intergenic
914051891 1:144144481-144144503 GGGCTGAGCAGAGTCAGGGCAGG + Intergenic
914127306 1:144822060-144822082 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
915213921 1:154327995-154328017 GGGAGGGGCAGGGTCAGAGCTGG + Intronic
916548441 1:165828065-165828087 GCGCGGGGCGCACTCGGCGCTGG - Intronic
917801417 1:178573881-178573903 GCGCGGGACAAAGGCAGAGCTGG - Intergenic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
919060693 1:192628811-192628833 GAGGGAGGCAGAGTCAGGGCTGG - Intergenic
920184642 1:204152211-204152233 GGGCGGGGCGGAGCCAGCGGAGG - Intergenic
923166559 1:231369454-231369476 GCAGGGGGCAGAGACAGCACTGG + Intronic
1064060039 10:12129638-12129660 GCGAAGGGCGGAGTCTGCGCGGG + Intronic
1065500203 10:26373554-26373576 GCTCGGGTCAGAGACAGCTCAGG + Intergenic
1066760087 10:38741466-38741488 GAGCTGAGCAGAGTCAGGGCGGG - Intergenic
1066961528 10:42231302-42231324 GGGCTGAGCAGAGTCAGGGCGGG + Intergenic
1067079304 10:43204353-43204375 GCGGTGGGCAGTGTCAGCCCAGG - Intronic
1071515315 10:86293097-86293119 GGGTTGGGCAGAGGCAGCGCCGG - Intronic
1073460672 10:103664031-103664053 CAGCTGGGCAGAGGCAGCGCCGG + Intronic
1076547194 10:131253312-131253334 GTGAGGGGCAGAGTGAGGGCGGG - Intronic
1076847528 10:133076547-133076569 GCGTGAGGCAGAGGCAGAGCCGG - Intronic
1076885914 10:133262163-133262185 GGGCGGGGCAGGGGTAGCGCGGG + Intergenic
1077095201 11:796175-796197 GCCTGGGGCAGAGTGAGAGCAGG - Exonic
1077352680 11:2100126-2100148 GGGCGGGGCAGAGTGGGGGCTGG + Intergenic
1082003726 11:47408581-47408603 GGGCGGGGCAGAGCCTGGGCGGG + Intronic
1083626256 11:64073606-64073628 GTGCAGGCCAGAGCCAGCGCTGG + Intronic
1083887725 11:65581015-65581037 GAGAAGGGCAGAGTCAGCCCAGG - Intronic
1084941483 11:72615565-72615587 AAGCGGGGCAGAGCCAGCTCAGG + Intronic
1085201170 11:74703254-74703276 GCGCTGGCCAGAGTGAGCCCTGG - Intronic
1085340353 11:75727369-75727391 GTGAGTGGCAGAGTCAGGGCTGG + Intronic
1090729597 11:129558246-129558268 GAGCTTGGCAGAGTCAGAGCTGG - Intergenic
1092999371 12:13980949-13980971 GCGCGGGGGTGAGTGTGCGCGGG - Intergenic
1096100939 12:48970137-48970159 GCGCGGAGCAGTTCCAGCGCTGG + Exonic
1098029016 12:66235315-66235337 GCGCGGGGCAGCCTGGGCGCGGG + Intronic
1101970720 12:109310084-109310106 GGGCGGGGCAGCGGCGGCGCGGG - Intergenic
1103659240 12:122500562-122500584 GCGTGGGGCCGGGGCAGCGCCGG - Exonic
1104069393 12:125331147-125331169 GAGCGGGGCGGGGACAGCGCCGG + Intronic
1104917310 12:132272288-132272310 GGGCGGGACAGGGTCAGGGCAGG + Intronic
1106408668 13:29496138-29496160 GAGTGGGGCAGGGTCAGTGCAGG + Intronic
1107309523 13:39062141-39062163 GTGCTTGGCAGAGTCAGAGCAGG + Intergenic
1113376828 13:109772095-109772117 GCGCTGGGCCCAGGCAGCGCAGG + Intronic
1118514163 14:66508342-66508364 GCGTGGGGGAGAGGCCGCGCCGG - Exonic
1120809976 14:88793006-88793028 GGGAGGGGCGGAGTGAGCGCGGG - Intergenic
1120852110 14:89180665-89180687 GCGCTGGGCAGAGCCAGCCTGGG - Intronic
1121343120 14:93116431-93116453 GTGCGGGTCAGCGTCGGCGCCGG + Intergenic
1122129489 14:99596859-99596881 GCGGGGAGCAGCATCAGCGCTGG + Intronic
1122779127 14:104136289-104136311 GCGCGGCGCGGAGCGAGCGCAGG + Intergenic
1202930801 14_KI270725v1_random:30973-30995 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
1123421557 15:20140439-20140461 GGGCTGAGCAGAGTCAGGGCAGG + Intergenic
1123443498 15:20306076-20306098 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
1123530783 15:21146979-21147001 GGGCTGAGCAGAGTCAGGGCAGG + Intergenic
1124244676 15:28058847-28058869 GTGCAGGGGAGAGTCTGCGCTGG + Intronic
1125524696 15:40367630-40367652 GCGTGAGGAAGAGTGAGCGCAGG - Exonic
1128119077 15:65132983-65133005 GCGGGAGGCAGAGGCCGCGCGGG - Exonic
1128317648 15:66671201-66671223 GGGCGGGGCAGAGGAAGGGCGGG - Intronic
1129274086 15:74434005-74434027 GGGCGGGGTGGGGTCAGCGCTGG - Exonic
1129871624 15:78945111-78945133 GCGCGGGGCGGAGCGAGCGCGGG + Intronic
1133267544 16:4594039-4594061 GAGGGTGGCAGAGTCAGCACAGG - Intronic
1134633980 16:15778380-15778402 GCGAGGTGCAGAGTAAGGGCTGG - Intronic
1136628946 16:31478011-31478033 GCCGGGGACAGAGCCAGCGCGGG - Intergenic
1136722717 16:32337810-32337832 GGGCTGAGCAGAGTCAGGGCAGG + Intergenic
1136841039 16:33543809-33543831 GGGCTGAGCAGAGTCAGGGCAGG + Intergenic
1138387950 16:56648922-56648944 GTGCTGGGCAGAGTCAGAGGAGG + Intronic
1138514570 16:57528999-57529021 GCGGGGGGCAGGGGCAGTGCGGG + Exonic
1138549594 16:57740267-57740289 GGTCGGGGCAGAGCCAGCACAGG - Intronic
1139482485 16:67238140-67238162 GGGATGGGCAGAGTCAGCGAGGG + Intronic
1139593999 16:67947799-67947821 GGGGAGGGCAGAGTCAGGGCAGG + Intronic
1142136947 16:88455858-88455880 GCGCGGGGCCGGGGCAGCTCGGG + Intronic
1142173413 16:88634388-88634410 GGGCGGGTCAGAGGCAGCGCGGG - Intergenic
1142229105 16:88891307-88891329 GCTAGGTGCAGAGCCAGCGCAGG - Intronic
1142367574 16:89658020-89658042 GGGCGGGGCGGTGTGAGCGCAGG + Intronic
1203003714 16_KI270728v1_random:179954-179976 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
1203135322 16_KI270728v1_random:1716361-1716383 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
1203151204 16_KI270728v1_random:1844106-1844128 GGGCTGAGCAGAGTCAGGGCAGG + Intergenic
1142627790 17:1203399-1203421 GCGGGGGGCGGAGTCTGCGGGGG + Intronic
1142713415 17:1735665-1735687 GCGCAGGGTAGAGTCAGAGCTGG - Exonic
1143443925 17:6996241-6996263 GCGCGGGGCGAGGTCAGCGCGGG + Exonic
1143723185 17:8828066-8828088 TGGCGGGGCAGAGACAGGGCAGG - Intronic
1146716304 17:35089346-35089368 GGGCGGGGCCGAGTCAGGGGCGG - Intronic
1148800337 17:50221103-50221125 GAGCAGGGCAGGGTCTGCGCTGG - Intergenic
1149569260 17:57660848-57660870 GAGCTGGGCAGAATCAGAGCAGG + Intronic
1151489877 17:74426626-74426648 GGGCGAGGCAGACTCAGAGCAGG + Intronic
1151728232 17:75896656-75896678 GCGCGCGGCAGGGTCGGGGCCGG + Exonic
1151969718 17:77451378-77451400 GCGCGGGGCAGAGGTAGGGAGGG - Intronic
1152339884 17:79718322-79718344 GAGCGGGGCACAGGCAGGGCCGG - Intergenic
1152537527 17:80959405-80959427 GCGAGGGGCAGAGCCGGCTCTGG - Intronic
1152559663 17:81071707-81071729 GCTCCCGGCAGACTCAGCGCGGG + Intronic
1154325924 18:13390354-13390376 GCGCGGGGCACACTCAGTGCAGG + Intronic
1156026790 18:32663968-32663990 GCGCCAGGCAGAGCCAGAGCAGG + Intergenic
1156288417 18:35722202-35722224 GTGCTTGGCAGAGTCAGAGCAGG - Intergenic
1157359866 18:46966805-46966827 GCGAGGGCCAGAGACAACGCCGG - Intronic
1157360465 18:47020405-47020427 GCGAGGGCCAGAGACAACGCCGG - Intronic
1157361454 18:47026320-47026342 GCGAGGGCCAGAGACAACGCCGG - Intronic
1160577322 18:79864068-79864090 GCGCGGGGCCGACGGAGCGCGGG + Exonic
1160684414 19:426848-426870 GCGAGGGGCAGAGTCCGGGGAGG + Intronic
1160724261 19:610653-610675 GGGCGGGGCAGAAGCAGGGCAGG + Intronic
1161094418 19:2381305-2381327 CCGCGGGGCAGGGTCAGCAGAGG + Intergenic
1161766755 19:6212750-6212772 GCTCTGGGCAGAGACAGGGCCGG - Intergenic
1163585474 19:18161314-18161336 GCGCGGTGCAGCGGCAGCGTCGG - Exonic
1163715509 19:18870222-18870244 GCGCGGGTCAGGGGCAGCGAGGG + Exonic
1164648101 19:29873618-29873640 GCGCGGGGCCGGGTCGGAGCGGG - Intergenic
1165392354 19:35545832-35545854 GCGCGGGGCGGAGAGGGCGCGGG + Intronic
1165714896 19:38037982-38038004 GCCCTGGGCAGTGTCAGGGCAGG + Intronic
1165767942 19:38362339-38362361 GCGCGGGGCAGAGTCAGCGCCGG - Intronic
1165903008 19:39177574-39177596 GCCAGAGGCAGAGACAGCGCTGG + Intronic
1166551607 19:43669240-43669262 GAGCGGCGCAGAGCCAGTGCTGG - Intronic
1167445552 19:49535076-49535098 GGGAGGGGCAGAGTCAGTGCTGG - Intronic
1167611053 19:50507885-50507907 GGACAGGGCAGAGTCAGGGCAGG - Intronic
1167611084 19:50507999-50508021 GGACAGGGCAGAGTCAGGGCAGG - Intronic
1167611093 19:50508037-50508059 GGACAGGGCAGAGTCAGGGCAGG - Intronic
1167636749 19:50659906-50659928 GAGAGGGGCAGAGGCCGCGCTGG - Intronic
1167660296 19:50792213-50792235 GCGCGGGGCTGGGTGAGCCCAGG - Intronic
1167679286 19:50909524-50909546 CCTCGGGGCGGAGTCAGGGCTGG + Intronic
1202691289 1_KI270712v1_random:96905-96927 GGGCTGAGCAGAGTCAGGGCAGG + Intergenic
925537091 2:4929395-4929417 GGGCCAGGCAGAGTCAGCGGTGG + Intergenic
925976063 2:9142921-9142943 TCGCGGGGCAGAGGCGGCGCCGG - Intergenic
926217114 2:10912390-10912412 GCGCGGGGCGGAGGCTGCGAGGG + Exonic
927472643 2:23386718-23386740 GCGCTGGGCAGCGTCGGCCCCGG + Intronic
927575713 2:24200493-24200515 GTGTGGGGCAGAGTCAGCGGGGG + Intronic
932496338 2:72147561-72147583 GCGCGGGGCAGACGGAGCGGCGG - Intronic
932741203 2:74292365-74292387 GGGAGGGGCAGAGACAGCGTAGG - Intronic
933955101 2:87357045-87357067 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
934239290 2:90253259-90253281 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
934273894 2:91563439-91563461 GGGCTGAGCAGAGTCAGGGCAGG + Intergenic
934461733 2:94216613-94216635 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
936038034 2:109128484-109128506 GCGCCGGGAGGAGTCGGCGCGGG + Intergenic
936954851 2:118013668-118013690 GCGTGGGGCTGCGTCAGAGCAGG + Intronic
938083247 2:128381318-128381340 GGGCTGGGCAGTGTCAGCACAGG + Intergenic
939990722 2:148875367-148875389 GGGCGGGGCAGGGCCAGGGCAGG + Exonic
944668329 2:201974790-201974812 GCTGGCGGCAGAGGCAGCGCTGG + Intergenic
947491059 2:230594518-230594540 GTGCTTGGCAGAGTCAGGGCAGG - Intergenic
1168730980 20:80425-80447 GTGCTTGGCAGAGTCAGCGTGGG - Intergenic
1168952438 20:1811572-1811594 GAGTGTGGCAGAGTCAGGGCTGG - Intergenic
1169164037 20:3407450-3407472 ACGCGGGGCAGAGGCAGCCGAGG - Intronic
1172468079 20:35171919-35171941 GGGCGGGGCAGAGGGAGGGCAGG + Intergenic
1173279902 20:41618605-41618627 GGGCGGGGCGGTCTCAGCGCCGG - Intergenic
1175748818 20:61480632-61480654 GGGCGGGGCTGAGCCAGGGCAGG + Intronic
1176027413 20:62993198-62993220 CCGCAGGGCAGGGTCAGCCCTGG + Intergenic
1176592821 21:8659596-8659618 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
1178915670 21:36704552-36704574 GCGCGCTGCAGATTCAGCGCGGG + Intronic
1179586147 21:42375340-42375362 GCGGGGGGCTGAGACAGTGCGGG - Intronic
1180162716 21:46005529-46005551 GCGGAGGGCAGAGGCAGCGAGGG + Intergenic
1180275674 22:10636738-10636760 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
1180550156 22:16531678-16531700 GGGCTGAGCAGAGTCAGGGCGGG - Intergenic
1180891467 22:19291832-19291854 GGGCGGGGCAGAGGCGGGGCAGG - Intergenic
1181354519 22:22290143-22290165 GGGCTGAGCAGAGTCAGGGCAGG + Intergenic
1181670545 22:24423838-24423860 GGGCGGGGCGGGGGCAGCGCGGG + Intronic
1183438306 22:37808018-37808040 CCGCCGCGCACAGTCAGCGCTGG + Exonic
1183489334 22:38108369-38108391 GGGTGGGGCAGAGGCAGGGCTGG - Intronic
1184030792 22:41893179-41893201 GGGGGTGGCAGAGCCAGCGCAGG - Exonic
1185329950 22:50248005-50248027 GTGCGGGGCAGAGGCACGGCTGG + Exonic
954214337 3:49116075-49116097 GTAAGAGGCAGAGTCAGCGCTGG - Exonic
954362315 3:50128546-50128568 GTGCAGGGCAGAGCCAGCGTGGG + Intergenic
954409690 3:50365026-50365048 GCGCGGGGCAGAGGGGGAGCGGG + Intronic
957451217 3:80385059-80385081 AAGCTGGGCAGAGTCAGAGCAGG + Intergenic
958798707 3:98732798-98732820 GCGCGGGCCAGGGGCGGCGCGGG - Exonic
961182467 3:124887330-124887352 GCGCGGGGGAGTCTCGGCGCTGG - Intronic
961681648 3:128603785-128603807 GCGGTGGGCAGAGTCTGGGCAGG - Intergenic
962984258 3:140520426-140520448 TCACAGGGCAGAGTCAGTGCAGG + Intronic
963335618 3:143971466-143971488 GCGCGAGGCGGAGGCAGAGCTGG - Intergenic
968452584 4:682230-682252 GGGCGGCGCAGACTCAGGGCCGG - Exonic
968646702 4:1744677-1744699 GGGCGGGGCAGAGGCTGAGCTGG - Intronic
968831952 4:2936955-2936977 GCGCAAGACAGAGACAGCGCTGG - Intergenic
969513141 4:7631213-7631235 GGCCGGGGAAGAGTCACCGCTGG + Intronic
972396614 4:38663975-38663997 GGGCGGGGCGGAGGCGGCGCGGG + Intergenic
978777060 4:112515292-112515314 GCGCGGGGCTGAGGCCGGGCAGG - Exonic
981185354 4:141795582-141795604 GCTCAGGGCAGAGTCAGAACTGG - Intergenic
982503773 4:156193311-156193333 GCCCAGGGCAGAGCCAGGGCAGG + Intergenic
985434711 4:189917383-189917405 GCCCCCGGCAGGGTCAGCGCAGG - Intergenic
985719654 5:1482472-1482494 GGGCGGGGCAGAGCCAGGGCAGG + Intronic
985719681 5:1482528-1482550 GGGTGGGGCAGAGCCAGGGCAGG + Intronic
985719697 5:1482564-1482586 GGGTGGGGCAGAGCCAGGGCAGG + Intronic
985719713 5:1482600-1482622 GGGTGGGGCAGAGCCAGGGCAGG + Intronic
988796444 5:34656788-34656810 GCGCGGGGCAGGGGCCGCGGCGG + Intronic
988856224 5:35230209-35230231 GCGCGCGGCAGGGGCTGCGCGGG - Intronic
993384802 5:87251655-87251677 GCCCTGGGCTCAGTCAGCGCAGG - Intergenic
994043651 5:95284794-95284816 GCGGGAGGAAGAGGCAGCGCCGG - Intergenic
996694413 5:126377750-126377772 GCATGGGGCAGAGTCAGAGATGG + Intronic
997719356 5:136065566-136065588 GGGTGGGGCAAAGTCAGGGCAGG - Intergenic
999416917 5:151406247-151406269 GAGCTTGGCAGAGTCAGAGCAGG + Intergenic
999640009 5:153663004-153663026 GCTCTGGGCAGTGTCAGCTCTGG - Intronic
999759842 5:154691580-154691602 GGGCGGGGCTGAGTCTCCGCAGG - Intergenic
1002029263 5:176416162-176416184 GAGTGGGGGTGAGTCAGCGCGGG - Exonic
1006297246 6:33175221-33175243 GTGCTGGGGAGAGTCAGCTCTGG + Intronic
1006304509 6:33211271-33211293 GCCTGGGGCAGAGTCAGGGGCGG - Exonic
1006339848 6:33440834-33440856 TCGCTGGGCAGAGGAAGCGCAGG - Exonic
1007656593 6:43454815-43454837 CCGCTGGGCATGGTCAGCGCCGG + Exonic
1007739565 6:44002475-44002497 GGGCGGGGAGGAGTCGGCGCGGG - Intronic
1016010887 6:139135948-139135970 CGGCGGGGCAGTGCCAGCGCGGG - Intronic
1018876434 6:167826555-167826577 GCGCGGTGCAGAGTCCGGACGGG - Intergenic
1019505658 7:1389172-1389194 GAGAGGGGCAGGGGCAGCGCCGG + Intergenic
1022087305 7:27080981-27081003 GCCCTGGGGAGAGTCAGAGCAGG + Intergenic
1024920256 7:54546661-54546683 CCGCGCGGCAGGGACAGCGCCGG + Intronic
1030659698 7:112206263-112206285 GCGCTGGGCAGGATCTGCGCTGG + Exonic
1030659703 7:112206298-112206320 GGGCGGCGCAGTGTCAACGCTGG - Exonic
1031017590 7:116592707-116592729 GGGAGGGGCAGAGTCACGGCTGG - Intergenic
1032065017 7:128761490-128761512 GCCCGGGACAGAATCAGAGCAGG + Intronic
1033641066 7:143263630-143263652 GCGGAGGGAAGAGTGAGCGCAGG + Intronic
1033662061 7:143408891-143408913 GCGGGGGGCGGGGCCAGCGCCGG + Exonic
1034254003 7:149714724-149714746 GCGGGGGGCGGAGACAGGGCGGG - Intergenic
1035155093 7:156905941-156905963 GCTAGGGACAGAGTCAGAGCTGG + Intergenic
1035400768 7:158564056-158564078 GCGGGGGGCACAGCCAGCTCTGG + Intronic
1035495159 7:159318702-159318724 GCGTGGGGCAGAGTCAGCTCTGG - Intergenic
1036890237 8:12591935-12591957 GTGGGGGGCAGAGTCAGGGGTGG + Intergenic
1038205317 8:25459253-25459275 GCGCAGGCCAGGATCAGCGCAGG + Exonic
1039460066 8:37736519-37736541 GCGGGGCGCAGAGCGAGCGCGGG + Exonic
1045389511 8:101701461-101701483 GGCTGGGGCAGAGTCAGGGCTGG - Intronic
1048037636 8:130692712-130692734 GAGCTTGGCAGAGTCAGAGCAGG + Intergenic
1049502678 8:142975717-142975739 GCGCAGGGGAGAGAGAGCGCAGG + Intergenic
1049843194 8:144787210-144787232 GCGCAGGGGAGGGTCTGCGCCGG + Intronic
1052970153 9:34372439-34372461 GCGCTGGGAGGAGGCAGCGCCGG - Exonic
1053692207 9:40592265-40592287 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
1054272593 9:63045220-63045242 GGGCTGAGCAGAGTCAGGGCAGG + Intergenic
1054303465 9:63393231-63393253 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
1054402244 9:64719741-64719763 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
1054435847 9:65204056-65204078 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
1054494545 9:65817631-65817653 GGGCTGAGCAGAGTCAGGGCAGG + Intergenic
1057228892 9:93306919-93306941 GCGCGGGGCAGGCACAGGGCAGG - Intronic
1059102651 9:111484456-111484478 GTCCGGGACTGAGTCAGCGCCGG - Exonic
1059449533 9:114361802-114361824 GCCCGGGTCAGACTCAGCTCTGG - Exonic
1060713062 9:125889874-125889896 GCGCCGGGCAGCGCGAGCGCGGG - Intronic
1061348298 9:130043581-130043603 GCGCCGAGCAGAGTCAGCCCGGG + Intergenic
1062044701 9:134419612-134419634 GCGCGGGGCAGGGCCTGGGCGGG + Intronic
1062230606 9:135479813-135479835 GCGCGGGGCGGCGGCAGCGGCGG + Exonic
1203622867 Un_KI270749v1:138402-138424 GGGCTGAGCAGAGTCAGGGCAGG - Intergenic
1188244671 X:27825274-27825296 GACCAGGGCAGAGTCAGCTCCGG - Intergenic
1188247948 X:27856835-27856857 GACCAGGGCAGAGTCAGCTCTGG - Intergenic
1188493091 X:30756322-30756344 GCGGGTGGCAGTGTCAGTGCAGG - Intergenic
1197600119 X:128518373-128518395 GAGCTTGGCAGAGTCAGAGCAGG - Intergenic
1200250742 X:154552563-154552585 GGACAGGGCAGAGTCGGCGCTGG + Intronic
1200304339 X:155008796-155008818 GGACAGGGCAGAGTCGGCGCTGG - Intronic