ID: 1165767942

View in Genome Browser
Species Human (GRCh38)
Location 19:38362339-38362361
Sequence GCGCGGGGCAGAGTCAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165767942_1165767952 10 Left 1165767942 19:38362339-38362361 CCGGCGCTGACTCTGCCCCGCGC 0: 1
1: 0
2: 1
3: 13
4: 228
Right 1165767952 19:38362372-38362394 CCAGGATTACTACTTCTTCTTGG 0: 1
1: 0
2: 1
3: 18
4: 298
1165767942_1165767953 21 Left 1165767942 19:38362339-38362361 CCGGCGCTGACTCTGCCCCGCGC 0: 1
1: 0
2: 1
3: 13
4: 228
Right 1165767953 19:38362383-38362405 ACTTCTTCTTGGCGAGCAATTGG 0: 1
1: 0
2: 0
3: 3
4: 78
1165767942_1165767945 -8 Left 1165767942 19:38362339-38362361 CCGGCGCTGACTCTGCCCCGCGC 0: 1
1: 0
2: 1
3: 13
4: 228
Right 1165767945 19:38362354-38362376 CCCCGCGCATCCGGTACCCCAGG 0: 1
1: 0
2: 1
3: 13
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165767942 Original CRISPR GCGCGGGGCAGAGTCAGCGC CGG (reversed) Intronic