ID: 1165772002

View in Genome Browser
Species Human (GRCh38)
Location 19:38385573-38385595
Sequence TGCCTGACAGCAGTGGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 1, 2: 1, 3: 75, 4: 415}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165772002_1165772007 2 Left 1165772002 19:38385573-38385595 CCCTCCACCACTGCTGTCAGGCA 0: 1
1: 1
2: 1
3: 75
4: 415
Right 1165772007 19:38385598-38385620 GTAGCTGTAGCTCGTTCGCGAGG 0: 1
1: 0
2: 0
3: 1
4: 11
1165772002_1165772009 30 Left 1165772002 19:38385573-38385595 CCCTCCACCACTGCTGTCAGGCA 0: 1
1: 1
2: 1
3: 75
4: 415
Right 1165772009 19:38385626-38385648 CTCCATGCAAGCCATCCTTACGG 0: 1
1: 0
2: 3
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165772002 Original CRISPR TGCCTGACAGCAGTGGTGGA GGG (reversed) Exonic
900986859 1:6078200-6078222 TGACTGACAGAAGAGGAGGACGG - Intronic
901152618 1:7113997-7114019 TGGGTTACAGCAGTGGTGGGAGG - Intronic
902782466 1:18713272-18713294 TCCCTGACAACAGTGGTGTGTGG - Intronic
905239042 1:36570813-36570835 TCTCTGAGGGCAGTGGTGGAAGG + Intergenic
905443413 1:38008930-38008952 TGCCTCACAGCATTGTTGTAAGG + Intergenic
905884468 1:41484405-41484427 AGCCTGGCGGCAGTGGTGGCAGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908021710 1:59904962-59904984 TGGATGACAGCATTGGTGTAGGG + Exonic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909171135 1:72297601-72297623 AGCCTCACAATAGTGGTGGAAGG + Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910341817 1:86197124-86197146 TGCAAGGCATCAGTGGTGGAAGG - Intergenic
910365469 1:86460434-86460456 TGCCTGACATTCCTGGTGGAGGG + Intergenic
912234984 1:107841036-107841058 TGACTGACAGCAGTGTGGTAGGG + Intronic
912464119 1:109857926-109857948 TGCCTGAGAGCACAGGGGGAGGG - Intergenic
912802316 1:112727844-112727866 TGCTGGGCAGCAGGGGTGGAAGG + Intergenic
915518998 1:156430536-156430558 AGACTGAAAGCAGTGGGGGAGGG - Intronic
916702594 1:167313448-167313470 AGCCTGAGAGTATTGGTGGAGGG + Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918897285 1:190364161-190364183 TGACTGACAGCAGGGTGGGAAGG - Intronic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919259684 1:195175877-195175899 TGTCTGACTGGAGAGGTGGATGG + Intergenic
919918759 1:202155504-202155526 GGCCTGGCTGCAGTGGTGGGCGG - Intronic
920305199 1:205014191-205014213 TGCCTGACAGCTTTGGTGTCTGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920906574 1:210175382-210175404 TGCCTGCCAGCAGTACTGGAAGG + Intergenic
922302710 1:224316695-224316717 TGCCTAGAAGCAGGGGTGGAGGG + Intronic
922683960 1:227625060-227625082 TGCCTGAGAGCACAGGGGGAGGG - Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923574352 1:235144326-235144348 TGCCTGAGGACAGAGGTGGAGGG + Intronic
923586837 1:235280664-235280686 TGCCTAACAGCAGGGGCGCAGGG + Intronic
924270154 1:242324162-242324184 TGCCTGAAAGTAGTGGTGAAGGG - Intronic
924295114 1:242578722-242578744 TGCATGAAAACAGTGGTGGTAGG + Intergenic
1063042637 10:2358820-2358842 TGCCAGACAGCTGTGATGGGAGG + Intergenic
1064010329 10:11730282-11730304 TGCATGACAGCCATGGTGCATGG - Intergenic
1065222820 10:23513560-23513582 TGCCTGAGAGCACAGGGGGAGGG - Intergenic
1065340348 10:24698625-24698647 TGCCTGAGAGCTCTGGTTGATGG - Intronic
1065868311 10:29933554-29933576 GGCCTCACAGTTGTGGTGGAAGG + Intergenic
1065964416 10:30759417-30759439 TGCCTGACAGCATCTGTGGGAGG - Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066289387 10:33999870-33999892 TGCCTGACATCCCTGGTGGTGGG + Intergenic
1066714753 10:38274594-38274616 TGCCTGAAAGTAGTGGTGAAGGG + Intergenic
1066783319 10:38976111-38976133 TGCCTGAAAGTAGTGGTGAAGGG - Intergenic
1067218504 10:44323702-44323724 TGGATGACAGTGGTGGTGGAAGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069893835 10:71668200-71668222 TGCCTGCCAGCAAAGGTGGCAGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072537489 10:96374703-96374725 TGACTGATAGCAGTGGGGGTTGG - Intronic
1072692099 10:97578522-97578544 TTCCTGAAAGCTGCGGTGGAGGG + Exonic
1073482075 10:103792231-103792253 TTCCTAACAGCATTGTTGGAAGG + Intronic
1074761221 10:116668851-116668873 TGGCTGTCAGAAGTGGGGGATGG + Intronic
1075659014 10:124180527-124180549 TTCCTGGCAGCACTGGTGGCTGG - Intergenic
1075950474 10:126473284-126473306 TGCCTGACAACAGAGGTGGTGGG - Intronic
1076016782 10:127034229-127034251 TGCCTCACAATTGTGGTGGAAGG + Intronic
1076291066 10:129346065-129346087 TGACTGACAGCAGTGGTACCAGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076875766 10:133214812-133214834 TGCCTGACAGCAGGTGGGGCAGG - Intronic
1077023174 11:428641-428663 TGCGGGACAGCTGTGGTGGGCGG + Intronic
1077032582 11:476172-476194 TGGCTGACAGCTGTGTGGGAAGG + Intronic
1077236699 11:1485322-1485344 TGCCTGACATCAGTGGTGTGAGG - Intronic
1077481225 11:2815609-2815631 TGCCTGACAGTAGAGTTGCAGGG + Intronic
1079621974 11:22566655-22566677 TACCCTACAGTAGTGGTGGAGGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1081531030 11:43959530-43959552 TCCCTGTCAGCAGTGGGGGATGG + Intergenic
1083830226 11:65226837-65226859 TGCCTGACAGAAATGGGAGATGG - Intergenic
1084225761 11:67713864-67713886 AGCCTGCCACCAGTGGTAGATGG + Intergenic
1084263582 11:67993721-67993743 AGCCTGCCACCAGTGGTAGATGG + Exonic
1084480144 11:69415315-69415337 TGGCTGGCAGCAGAGGTGGGGGG + Intergenic
1084809825 11:71605400-71605422 AGCCTGCCACCAGTGGTAGATGG - Intergenic
1084862152 11:72026217-72026239 TGACTGGCAGGAGTTGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085042687 11:73335771-73335793 TTCCTGGCAGCAGAGGTGGTGGG - Intronic
1085265594 11:75236241-75236263 TGTCTCACAGCAGTGGGGGAGGG + Intergenic
1085293731 11:75418461-75418483 TGGGTGGCAGCAGTGGTGGTAGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086511232 11:87560106-87560128 TGCCTGAGAGCACAGGAGGAAGG - Intergenic
1087901332 11:103645076-103645098 TGCCTGAGAGCACAGGAGGAGGG - Intergenic
1089285993 11:117408555-117408577 TGCCTCACAGCAGGGTGGGAGGG - Intronic
1089642534 11:119857163-119857185 TGCCAGGCAGCAGAGGTGGAAGG + Intergenic
1089859064 11:121572688-121572710 TGCCAGGGAGCAGTGGAGGAGGG + Intronic
1091683241 12:2541748-2541770 TGCCTGTCAGCAGGAGTGGCTGG - Intronic
1092294370 12:7186399-7186421 TGCCTGAGAGCACAGGGGGAGGG + Intergenic
1092558788 12:9587317-9587339 TCCATGACAGCAGGGTTGGATGG - Intergenic
1092671651 12:10868386-10868408 TGGGTGCCAGCAGTGCTGGATGG - Intronic
1092997436 12:13963372-13963394 GGCATGACAGCTGTAGTGGAGGG + Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093355718 12:18164386-18164408 GGCCTCACAACTGTGGTGGAAGG + Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095480137 12:42626066-42626088 TACCTGAAAGCAGTCATGGAAGG - Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352667 12:50913154-50913176 TGCCTGACAGCACAGCGGGAGGG - Intergenic
1097362075 12:58669125-58669147 TGCCCCACAGCTGTGGTAGAAGG - Intronic
1098077946 12:66753447-66753469 AGCAGGTCAGCAGTGGTGGAAGG - Intronic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1103322558 12:120100515-120100537 TCCCAGACAGAGGTGGTGGAAGG + Intronic
1103477145 12:121227152-121227174 TCTCTGACAGCAGTGGTGACAGG + Intronic
1104380891 12:128307035-128307057 TTCCTTCCAGCAATGGTGGAAGG - Intronic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1104936441 12:132366776-132366798 TGCCTGGTAGCAGTGCTGGCTGG - Intergenic
1106673984 13:31937582-31937604 TGCCTGGCGATAGTGGTGGAGGG - Intergenic
1107291912 13:38864152-38864174 TGCCATACAGCAGTGGTGTATGG - Intronic
1107670881 13:42745189-42745211 TGCCTGGCATCAGTGATTGACGG - Intergenic
1108511016 13:51155982-51156004 TGCCTGACATCAGTGTAGGTAGG + Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109520657 13:63505769-63505791 TGCCTGAGAGCACAGCTGGAGGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111709798 13:91796518-91796540 TGCCTGAGAGCACAGGGGGAGGG - Intronic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116086221 14:40241643-40241665 TCTCTGACAGCAGTGATGCATGG + Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116861669 14:50000639-50000661 TGCCAGGCAGCCGTGCTGGAGGG - Intronic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119886693 14:78149503-78149525 TTGATGACAGGAGTGGTGGAAGG + Intergenic
1122510210 14:102260369-102260391 TGCCTGACAGGGTTGTTGGAAGG + Intronic
1122900863 14:104781817-104781839 TGCCTGACACCTCTGGAGGACGG + Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123628182 15:22241957-22241979 GGCCTCACAGTCGTGGTGGAAGG - Intergenic
1123812772 15:23945678-23945700 TACCTGACAGCAAGGGTGGGAGG - Intergenic
1123825159 15:24073786-24073808 TGCCTGACATTCCTGGTGGAGGG + Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124060828 15:26292334-26292356 TGCCTGACAGAGGTGTTGGGAGG + Intergenic
1124694733 15:31854510-31854532 TGCCTGACATCATTGGAGGTGGG - Intronic
1125166715 15:36714743-36714765 GGCCTGAGAGCAGTGGTTCATGG - Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127069764 15:55277529-55277551 TGCCTGACAGCAAAGGTGAGGGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128905101 15:71460460-71460482 TGCCTGCCAGTAGGGCTGGATGG + Intronic
1129060011 15:72853236-72853258 GGGCTCACAGCAGTGGAGGAGGG + Intergenic
1129328110 15:74812674-74812696 GGCCTGACAGCAGGCCTGGAAGG + Intergenic
1129563973 15:76601806-76601828 TGAATGACAGCAGTGATAGAAGG - Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129917237 15:79284250-79284272 TGCCAGATTGCAGTGGTGGGAGG + Intergenic
1130822161 15:87507256-87507278 GGCCTCACAGTAGTGGTGGAAGG + Intergenic
1131178460 15:90224647-90224669 TTCCTGAGAGCACTGGTGAAGGG + Intronic
1131442094 15:92467024-92467046 TGCCTGTCAGCAGTGAGGGCTGG - Exonic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132585293 16:703532-703554 TGGCTGACAGCTGGGGTGGCTGG + Intronic
1133648189 16:7784262-7784284 TGCTTGACTGAAGTGGGGGATGG - Intergenic
1135070858 16:19350319-19350341 TGTCTAAAAGCTGTGGTGGATGG + Intergenic
1135668713 16:24356864-24356886 GGCCTCACAACAATGGTGGAAGG + Intronic
1135718600 16:24794944-24794966 TCCCAGGCAGCACTGGTGGAGGG - Intronic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1136670745 16:31854882-31854904 CAGATGACAGCAGTGGTGGATGG - Intergenic
1137858721 16:51823361-51823383 TGCCTGGAAGCAGGAGTGGAGGG - Intergenic
1140482294 16:75268029-75268051 TGCCTGCCAGGAGTGGGTGAGGG - Intronic
1141287606 16:82687201-82687223 TGCCTGTGAACAGTGATGGAAGG + Intronic
1141782329 16:86171381-86171403 TGCCTCACAGCACTGGTGGGAGG + Intergenic
1141975761 16:87515371-87515393 GGCCTCACAGTCGTGGTGGAAGG + Intergenic
1143196344 17:5078806-5078828 TGCCTGTCAGCCGTGGGGGTGGG + Intronic
1143323602 17:6083909-6083931 TGACTTACAGAAGTGATGGAAGG + Intronic
1143503154 17:7350491-7350513 TGCCTGACAGCAATGTTGATGGG - Intronic
1143522357 17:7451960-7451982 TGCATGAAAGCAGGGGTTGAGGG - Intronic
1143655810 17:8292951-8292973 AGCCTGATAGAAGTGGTGGCTGG - Intronic
1144442930 17:15300297-15300319 TGCTTTGCAGCAGTGCTGGAAGG - Intergenic
1145759750 17:27419414-27419436 CACCTGAGGGCAGTGGTGGAAGG + Intergenic
1146355901 17:32133971-32133993 TGCCTCGCAGCAATGGGGGATGG - Intergenic
1146997883 17:37336547-37336569 TGCCTGACAGCACAGCAGGAGGG + Intronic
1147211390 17:38874416-38874438 TGGCTCACAGCGGTTGTGGAGGG + Intronic
1147987457 17:44314833-44314855 TGCCTGACGGCAGTGGTGGAGGG + Intronic
1148630182 17:49101309-49101331 TGCCTGATGGCAGTGCTGTAAGG - Intergenic
1148642865 17:49201396-49201418 TGTGTGACAGCAGAGGTCGAAGG + Intergenic
1149053758 17:52337898-52337920 TGCCTGCCAACCTTGGTGGAAGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149451260 17:56751758-56751780 TGCCTGACATCAGGGCTGCAGGG - Intergenic
1151224419 17:72638166-72638188 TGCCTGAGAGCACCGGGGGAGGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151946224 17:77321370-77321392 GCCCTGGGAGCAGTGGTGGAGGG - Intronic
1152902033 17:82947771-82947793 TGAGTGACAGCAGTGGTAGGTGG - Intronic
1153340370 18:3967148-3967170 TGCCTGTCTACATTGGTGGAGGG + Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155176899 18:23308560-23308582 TGGCTGATAGCAGTGGAGGTGGG - Intronic
1156274042 18:35564523-35564545 TACCTGAGAGCATTGGTGAAAGG - Intergenic
1157259309 18:46164923-46164945 TGCCTGAGAGCACAGTTGGAGGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157485538 18:48084431-48084453 TGACTCACAGCAGTGGCGGCAGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1160694173 19:474597-474619 TGCGTGCCAGCCGTGGGGGATGG - Intronic
1162007761 19:7790724-7790746 TGGTTCTCAGCAGTGGTGGATGG - Intergenic
1162023388 19:7879177-7879199 TCCCTGGCAGCAGTATTGGAGGG - Intergenic
1163833172 19:19557495-19557517 AGCCTGAAGGCAGTGGTGGTGGG - Intergenic
1164458392 19:28427540-28427562 TGCTGGAGAGCACTGGTGGAGGG - Intergenic
1165772002 19:38385573-38385595 TGCCTGACAGCAGTGGTGGAGGG - Exonic
1166168995 19:41013836-41013858 TGCCTGACCACATTGCTGGATGG - Intronic
1166745473 19:45140002-45140024 TGCCTGGCTGCAGTGCTGGCTGG + Intronic
1166810307 19:45510192-45510214 TGCCTGACAGCAATTCTGGCTGG + Intronic
1168082068 19:54017445-54017467 TGCCTGGCAACAGTGGTGTTAGG + Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168285210 19:55328298-55328320 TTCCTGACAGCAGTGCATGAGGG + Intronic
925897187 2:8481561-8481583 TGCCTGACCGCAGGGGAGGCTGG + Intergenic
927418319 2:22903016-22903038 GGCGTGACAGCAGAGGGGGAAGG + Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929829466 2:45335330-45335352 TGCCTCACAGCACTGCTGCAAGG + Intergenic
929880940 2:45836903-45836925 TGCCTGACAGCAGATGGGAAGGG + Intronic
930196689 2:48517641-48517663 GGCCTGGCAGAAGGGGTGGAAGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933031550 2:77334577-77334599 TGCCTCACAATAATGGTGGAAGG - Intronic
933500172 2:83101574-83101596 TGCCTGAGAGCAGAGCTGGAGGG + Intergenic
934671594 2:96217253-96217275 TGCCTGAGAGCACAGGGGGAGGG - Intergenic
935023982 2:99258546-99258568 TGCCTGGTAGGAGTGGAGGAAGG + Intronic
935215065 2:100969353-100969375 GGCCTGACAGGGGTGGTGGTAGG - Intronic
935502377 2:103857165-103857187 TGACTGGCAGCCTTGGTGGAGGG + Intergenic
936840737 2:116764950-116764972 TGCCTGACATTCCTGGTGGATGG + Intergenic
937221960 2:120346871-120346893 TTCCGGAGAGCAGGGGTGGAGGG - Intronic
937857804 2:126685294-126685316 AGCCAGACAGCAATGGGGGAAGG - Intronic
938749930 2:134318587-134318609 TCCCTGTCAGCAGATGTGGAGGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939493184 2:142900471-142900493 TGCCTGAGAGCACAGGGGGAGGG - Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940858093 2:158745441-158745463 TGGCTGAACGCAGTGGTGGAAGG - Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942830274 2:180231871-180231893 TGCCTGAGAGCACAGGGGGAAGG + Intergenic
942831196 2:180238729-180238751 TGCCTGAGAGCACAGGGGGAGGG + Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
943653226 2:190479408-190479430 TGCCTAAAAGCATTGCTGGATGG + Intronic
944044468 2:195392866-195392888 TGACTGACAGCTGTGTGGGAAGG - Intergenic
944847805 2:203686352-203686374 TACATGAGAGCAGTCGTGGAAGG - Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
946550260 2:220793531-220793553 TGCCTCACAATAATGGTGGAAGG - Intergenic
948064758 2:235069283-235069305 GGCCTCACAGCCATGGTGGAAGG + Intergenic
948175510 2:235939638-235939660 TGGATGAGAGCAGTGTTGGAGGG - Intronic
1169660315 20:7972062-7972084 TGTCTGCCAGGAGTGATGGAAGG + Intergenic
1170885126 20:20334060-20334082 TGCCTGGCAGCACTGGTGCTGGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1172997878 20:39084047-39084069 GGCCTGAGAGCAGTGACGGATGG + Intergenic
1173822950 20:46030493-46030515 TGGCTGACAGCCGTGATGGATGG - Intronic
1174352102 20:49975822-49975844 TAGCTGTCAGCAGGGGTGGAAGG - Intergenic
1174365228 20:50052789-50052811 AGACTGGCGGCAGTGGTGGAGGG + Intergenic
1174452382 20:50628383-50628405 TGCGTGACAGCAGTCAGGGAGGG - Intronic
1175709673 20:61209266-61209288 TGACTAACAGAAGTGGAGGAAGG - Intergenic
1175742227 20:61427770-61427792 TGCCTGCCTGCAGTGAGGGAAGG - Intronic
1176199899 20:63855496-63855518 TGCCTGAGAGTAGAGGAGGAGGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177393745 21:20507877-20507899 AGCCTGAGGGCAGTGGTGGCAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179444752 21:41423443-41423465 TGCCTGAGAGCACAGGGGGAGGG - Intronic
1179565857 21:42248328-42248350 GTCCAGACAGCAGTGGTGGAGGG + Intronic
1180793972 22:18592855-18592877 TGCCTGCAAGAGGTGGTGGAGGG + Intergenic
1180801157 22:18632559-18632581 TGCCAGGCTGCAGAGGTGGAGGG + Intergenic
1180852386 22:19028118-19028140 TGCCAGGCTGCAGAGGTGGACGG + Intergenic
1181220564 22:21362702-21362724 TGCCAGGCTGCAGAGGTGGACGG - Intergenic
1181227768 22:21402465-21402487 TGCCTGCAAGAGGTGGTGGAGGG - Intergenic
1181250884 22:21532374-21532396 TGCCTGCAAGAGGTGGTGGAGGG + Intergenic
1181319743 22:21995169-21995191 AGCCTGCAAGCTGTGGTGGATGG - Intergenic
1181859121 22:25804815-25804837 TGCCTGACAGCCTTGGCAGATGG + Intronic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1182681617 22:32084079-32084101 TGGCTGACAGCAGAGGGTGAGGG + Intronic
1182846068 22:33432031-33432053 TGCTTGAATTCAGTGGTGGATGG - Intronic
1182846788 22:33437979-33438001 GGCCTGGCTGCAGTGCTGGAAGG - Intronic
1183050001 22:35253197-35253219 ATCCTGACAGCAATGGCGGATGG + Intergenic
1183089209 22:35509792-35509814 TGTCTGAGAGCAGAAGTGGAGGG - Intergenic
1184604432 22:45564030-45564052 TGCCTGGCAGGACTGGTGTAAGG - Intronic
950654945 3:14430778-14430800 GGCCTGAAAGATGTGGTGGAGGG - Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951853918 3:27173317-27173339 TACCTGGCAGCAATGGTGGGAGG - Intronic
952589639 3:34934849-34934871 TGCCTGACAGCAGAGGGGGCAGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953853131 3:46480990-46481012 TGCCTATCAGCAGTGGAGGAGGG - Intronic
954572853 3:51656609-51656631 GGCCAGTCAGCAGTGGTGGCAGG + Intronic
954911515 3:54114557-54114579 GGCCAGGCAGCAGTGGTGGGGGG + Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955795648 3:62633727-62633749 TGCTTCACAGCAGTGGTGCAGGG + Intronic
957079023 3:75621672-75621694 AGCCTGCCACCAGTGGTAGATGG + Intergenic
957847295 3:85754350-85754372 TGCCTGACAGTCCTGGTGGGGGG + Intronic
960003336 3:112755736-112755758 TGCCTGGGGACAGTGGTGGATGG - Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961373943 3:126450180-126450202 TGCCTGTGAGCAGCTGTGGAGGG - Intronic
961827732 3:129607434-129607456 TGCCTGAGAAAGGTGGTGGAGGG - Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963188505 3:142443510-142443532 TGCCTGACAGCACAGTGGGAGGG + Intronic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575863 3:147059966-147059988 TGCCTGAGAGCACAGCTGGAGGG + Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
967384602 3:188899169-188899191 AGGCTGCCTGCAGTGGTGGATGG - Intergenic
968534348 4:1113820-1113842 GGCGCGACAGCAGTGGGGGAGGG + Intergenic
968786031 4:2623018-2623040 TGCGGGACAGCAGTGGTAGGGGG - Intronic
968846014 4:3041909-3041931 GCCCTGACAGCAGTGGAGAATGG - Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969731765 4:8961765-8961787 AGCCTGCCACCAGTGGTAGATGG - Intergenic
969791362 4:9495872-9495894 AGCCTGCCACCAGTGGTAGATGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972766799 4:42158754-42158776 TGCCTGAGAGCACAGCTGGAGGG - Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975844566 4:78511403-78511425 TGCCACACACCAGTGGTGGCTGG + Intronic
976189264 4:82473508-82473530 TGCCTGAGAGCACAGGGGGAGGG + Intergenic
976430437 4:84957693-84957715 TACTTGACTGCAGTGGTGCAGGG - Intronic
976525457 4:86082917-86082939 TGCCTGACAGCATGGCTAGATGG - Intronic
976963644 4:91009315-91009337 TGCCTGAAAGCACTGGGAGAGGG - Intronic
977034568 4:91933494-91933516 TGCCTCACAACTGTGGTGGTTGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977919114 4:102624348-102624370 TCGCTGGCAGCAGTGGTGGAGGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980444714 4:132889006-132889028 TGCCTGAGAGCACAGGGGGAGGG + Intergenic
980581756 4:134763343-134763365 GGTCTGACAACAGTGGGGGAAGG + Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981425415 4:144597073-144597095 GGCCTGACAGCATGCGTGGAGGG + Intergenic
981676208 4:147345908-147345930 TGCCTCACAGTCATGGTGGAAGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
985350706 4:189058462-189058484 TGCCTGAGAGCACAGGGGGAGGG + Intergenic
985884636 5:2668172-2668194 TGCCTGGCAGCGGAGGCGGAGGG - Intergenic
986215428 5:5714986-5715008 AGCCAGACAGCAGTTGAGGAGGG + Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
986858111 5:11895027-11895049 TGCCTGAGAGCAGGGGGAGAAGG + Intronic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989043165 5:37249468-37249490 GGCCTGAGAGCAGGGCTGGAGGG - Intergenic
989279615 5:39626013-39626035 GGCCTGACAGTCATGGTGGAAGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991269628 5:64764501-64764523 TGCATGAGGGGAGTGGTGGAAGG + Intronic
991677793 5:69105947-69105969 TTCCAGACAGCAGTGGTGGGGGG - Intronic
991948708 5:71926938-71926960 TGCCTCTCAGCAGTGATGGGTGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992595850 5:78346783-78346805 TGAATGACTGCAGGGGTGGATGG - Intergenic
992932635 5:81665343-81665365 TGCCACACAGCACTGATGGATGG + Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
993941884 5:94068576-94068598 TGCCTGAGAGCACAGGGGGAGGG - Intronic
994428137 5:99621408-99621430 TGCCTGACATCTGTCGTCGAGGG + Intergenic
994684065 5:102927140-102927162 TGCCTTACAGCAGTGGACAATGG - Intronic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996098748 5:119426293-119426315 TGCCTGGCTGCAGTGGAGGCTGG + Intergenic
996709704 5:126532170-126532192 TACCTGGCAGCTGGGGTGGATGG + Intergenic
996850069 5:127941708-127941730 TTCCTGGTAGCAGTGGGGGAGGG + Intergenic
997218234 5:132132761-132132783 TGAATGACAGCAGTGATGCAAGG - Intergenic
997233749 5:132260878-132260900 TTCTTGAAAGCAGTGGTGGCTGG - Intronic
997364984 5:133319908-133319930 TGCCCGACAGCACTGGGGAAGGG + Intronic
999699663 5:154217125-154217147 TGCCTGACCTCAGAGGTTGAGGG - Intronic
1000147137 5:158464562-158464584 TGCCTGACAGTGATGGTTGAAGG + Intergenic
1000880054 5:166686979-166687001 TGCCTGAAAGAAGTGGGGGCCGG - Intergenic
1001951612 5:175820443-175820465 TGCCTGAAAGCAGGTGTGGTGGG + Intronic
1002283680 5:178148355-178148377 TGGCTGAGGGCAGGGGTGGAAGG - Exonic
1003269625 6:4595981-4596003 TGCCTGAGAGCACAGGGGGAGGG - Intergenic
1003287036 6:4743392-4743414 TGCCTGCCAACAGAGATGGAAGG - Intronic
1003511893 6:6788673-6788695 TGCCTGCCAGAAGAGGAGGAAGG + Intergenic
1004374474 6:15079673-15079695 TGACTGTCAGCAGAGGTGGGTGG + Intergenic
1004874095 6:19937892-19937914 TGACTGGCAGCAGTGGGGGGTGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1005841296 6:29746041-29746063 AGCATGAAGGCAGTGGTGGAAGG + Intergenic
1007011919 6:38426330-38426352 TGCCTGACAGCACGGCGGGAGGG + Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1007102900 6:39262134-39262156 TGGCTCAGAGCAGAGGTGGATGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009023905 6:57974780-57974802 TGCCTGAGAGCACAGGAGGAGGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009845282 6:69126618-69126640 TGCCTGCCAACATTGGAGGAGGG + Intronic
1010704091 6:79087141-79087163 GGCCTCACAGTCGTGGTGGAAGG - Intergenic
1011190348 6:84720937-84720959 TGCCTGAGAGCACAGGGGGAGGG - Intronic
1011210016 6:84945176-84945198 TGCCTGAGAGCACAGGGGGAGGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013137983 6:107300612-107300634 TGCCTGAGAGCACAGGGGGAGGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015865007 6:137719040-137719062 TGCCTGAGAGCACAGGGGGAGGG - Intergenic
1016108533 6:140192007-140192029 TGGCTAATAGCAGTTGTGGAGGG + Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018473034 6:164113207-164113229 GGCCTCACAACAATGGTGGAAGG - Intergenic
1019257963 7:63667-63689 TGCCTGACTGCAGGGGCAGAGGG - Intergenic
1019728550 7:2617003-2617025 AGCCCGACAGCAGTGCTGAAAGG - Intergenic
1020309525 7:6857669-6857691 AGCCTGCCACCAGTGGTAGATGG + Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022631336 7:32088124-32088146 TGCGAGACAGTAATGGTGGAAGG - Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023938790 7:44757248-44757270 TTCCTGACAGCTGTAGTGGAGGG + Intronic
1024318678 7:48044415-48044437 TGCCTGAGAGCAAAGGGGGAGGG - Intronic
1026624331 7:71979057-71979079 TGCCTGACCTCAGTCCTGGAGGG - Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028180793 7:87721289-87721311 AGCCAGAAAGCAGAGGTGGATGG + Intronic
1028298699 7:89169355-89169377 TGCCTGAGAGCACAGGTGGAGGG - Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031259386 7:119498202-119498224 AGCCAGAGAGCAGAGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031992957 7:128209761-128209783 AGCCAGACAGCAGTGGGAGAAGG + Intergenic
1032933767 7:136704886-136704908 TGATTGACAGGAGAGGTGGAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034457191 7:151177115-151177137 TCCCTTACAGCAGTGGAGGCTGG - Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035160298 7:156945022-156945044 TGCCTGGCTGGAGTGGAGGATGG - Intergenic
1037379989 8:18274845-18274867 TGCCTGAGAGCACAGGAGGAAGG - Intergenic
1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039859987 8:41448745-41448767 TGCCTGACAATACTGTTGGATGG + Intergenic
1040102761 8:43519789-43519811 TGCCTGAAAACAGTGGTGGGTGG + Intergenic
1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG + Intergenic
1041377136 8:57216215-57216237 TTCCTGACTGCTGTGGGGGAGGG + Intergenic
1041945245 8:63433610-63433632 TGCCAAACAGCAGTGTTGAAGGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042675231 8:71313131-71313153 TGTATGGCAGCAGTGGTGAATGG - Intronic
1043589228 8:81808453-81808475 TTGCTGACAGCTGTGGTGGTGGG + Intronic
1044149346 8:88755097-88755119 TGCCTCACAGTCATGGTGGAAGG + Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045109512 8:98926898-98926920 TTCCAGGCAGCAGTGGTGGGTGG + Intronic
1045224832 8:100234424-100234446 TGCCTGAGGGTAGGGGTGGAGGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046527078 8:115394554-115394576 GGCCTCACAGTCGTGGTGGAAGG - Intergenic
1047444470 8:124907010-124907032 TGCCTGAGAGCACAGGGGGAGGG - Intergenic
1048100283 8:131343415-131343437 TGCCTGAGAGCACAGGGGGAGGG - Intergenic
1048646106 8:136421612-136421634 TGCCTGACAACTGTAGTGGATGG - Intergenic
1049102770 8:140590958-140590980 AGCCAGGGAGCAGTGGTGGATGG - Intronic
1049254328 8:141605742-141605764 TTCCTGGCAGCAGTGGAGGCTGG + Intergenic
1052146459 9:25056066-25056088 TGCCTGACAATCATGGTGGAAGG + Intergenic
1052446175 9:28564596-28564618 TGTGTGACAGCAGTGGTGAAAGG - Intronic
1052935445 9:34089134-34089156 TCACTGACAGCTGTGGTGGGAGG + Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1054792549 9:69269509-69269531 TGCATCACAGTAGTGGTGGTGGG - Intergenic
1055789874 9:79912159-79912181 TGCCTGAGAGCACAGGGGGAAGG - Intergenic
1056122661 9:83504600-83504622 GGCCTGAAAGAAGTGGTGGGGGG - Intronic
1058439992 9:104997876-104997898 TACCTTACAGCATTGGTGTAGGG + Intergenic
1060010377 9:120038549-120038571 TGGCTGGCTGCAGTGGTGGGTGG - Intergenic
1060728216 9:126020121-126020143 TGCCTGACTCCAGCTGTGGAGGG + Intergenic
1061089094 9:128416701-128416723 TGGCTGAGGGCAGAGGTGGAAGG + Intronic
1061958803 9:133977608-133977630 TGAGTGACAGCTGTCGTGGATGG - Intronic
1062166925 9:135112586-135112608 TGCCTGAAAGCAGGTGTGCATGG - Intronic
1062488379 9:136792156-136792178 TTCCTGACAGACGTGGTGGGTGG - Intronic
1062613043 9:137383504-137383526 TGCCAGACAGAGGTGGGGGAGGG - Intronic
1185982867 X:4798841-4798863 TGCCTTTCTGCAATGGTGGAGGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188518494 X:31012763-31012785 AGCCAGATAGAAGTGGTGGAGGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189395238 X:40615789-40615811 TACCTCACAGCAGTGTTGCAAGG - Intergenic
1189901815 X:45714185-45714207 TGCCTGAAAACAATGGTGGATGG - Intergenic
1189954304 X:46262194-46262216 TGCCTGACAGCACAGGGGGAGGG - Intergenic
1190892949 X:54586900-54586922 TGGGTGCCAGCAGTGGTGGTAGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191647983 X:63504677-63504699 AGTCTGACATCAGTTGTGGAAGG - Intergenic
1191924717 X:66297214-66297236 TGCCTGAGAGCACAGGGGGAGGG - Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193307184 X:79962952-79962974 TGCCTGAGAGCACAGCTGGAGGG + Intergenic
1194034671 X:88855265-88855287 TGCCTCACAGTCATGGTGGAAGG - Intergenic
1194492536 X:94569350-94569372 TGCCTGAGAGCACAGGGGGAGGG - Intergenic
1195256572 X:103096771-103096793 TGCAATACAGCAGTGGTGAATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195464233 X:105162242-105162264 TTCCTCACAGCAGTCATGGATGG - Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197866901 X:131028693-131028715 GGCCTCACAGCAGTATTGGAAGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198862247 X:141083981-141084003 CGCCTGAGAGCACTGGGGGAGGG + Intergenic
1198900443 X:141503391-141503413 CGCCTGAGAGCACTGGGGGAGGG - Intergenic
1199203704 X:145123578-145123600 GGCCTCACAACCGTGGTGGAAGG + Intergenic
1199432047 X:147772973-147772995 TGCCTGACAGCACAGTGGGAGGG + Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1199772927 X:150985443-150985465 TGCCGGACACCAGTGGCAGAAGG - Intronic
1200109892 X:153735377-153735399 TTCCCGCCAGCAGTGTTGGAGGG + Intronic