ID: 1165773393

View in Genome Browser
Species Human (GRCh38)
Location 19:38390736-38390758
Sequence AACCCCAGGCTGTTCCACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165773379_1165773393 28 Left 1165773379 19:38390685-38390707 CCAGCCAGACTATCCTCGCTGTC 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1165773393 19:38390736-38390758 AACCCCAGGCTGTTCCACAGGGG 0: 1
1: 0
2: 2
3: 16
4: 181
1165773382_1165773393 4 Left 1165773382 19:38390709-38390731 CCCTGTACTGCTCCTCCTCCCCG 0: 1
1: 0
2: 1
3: 36
4: 442
Right 1165773393 19:38390736-38390758 AACCCCAGGCTGTTCCACAGGGG 0: 1
1: 0
2: 2
3: 16
4: 181
1165773384_1165773393 -8 Left 1165773384 19:38390721-38390743 CCTCCTCCCCGCTCCAACCCCAG 0: 1
1: 2
2: 5
3: 174
4: 1315
Right 1165773393 19:38390736-38390758 AACCCCAGGCTGTTCCACAGGGG 0: 1
1: 0
2: 2
3: 16
4: 181
1165773383_1165773393 3 Left 1165773383 19:38390710-38390732 CCTGTACTGCTCCTCCTCCCCGC 0: 1
1: 0
2: 1
3: 33
4: 383
Right 1165773393 19:38390736-38390758 AACCCCAGGCTGTTCCACAGGGG 0: 1
1: 0
2: 2
3: 16
4: 181
1165773380_1165773393 24 Left 1165773380 19:38390689-38390711 CCAGACTATCCTCGCTGTCTCCC 0: 1
1: 0
2: 0
3: 15
4: 161
Right 1165773393 19:38390736-38390758 AACCCCAGGCTGTTCCACAGGGG 0: 1
1: 0
2: 2
3: 16
4: 181
1165773381_1165773393 15 Left 1165773381 19:38390698-38390720 CCTCGCTGTCTCCCTGTACTGCT 0: 1
1: 0
2: 0
3: 16
4: 254
Right 1165773393 19:38390736-38390758 AACCCCAGGCTGTTCCACAGGGG 0: 1
1: 0
2: 2
3: 16
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165773393 Original CRISPR AACCCCAGGCTGTTCCACAG GGG Intronic
901039555 1:6355816-6355838 AGCCCGAGCCTGTTCCGCAGCGG + Intronic
901264682 1:7901789-7901811 AAACCCAGGATGTTCCAAACTGG - Intergenic
901771668 1:11533636-11533658 AGCCCCAGGCAGTTCCAGGGAGG + Intronic
905224008 1:36467571-36467593 AGAGCCAGGCAGTTCCACAGAGG + Exonic
905941357 1:41866096-41866118 CACACCAGGCAGATCCACAGTGG + Intronic
907581191 1:55574258-55574280 ACCCCAAGGCTGTTGCTCAGAGG - Intergenic
908718294 1:67094637-67094659 AGCCCCAGACTGCTCCACTGAGG - Intronic
911312401 1:96309615-96309637 GGCCACAGGCTGTTCAACAGAGG - Intergenic
912496882 1:110097603-110097625 AACCCAAGGCCGTTCCACCCTGG + Intergenic
912566686 1:110592568-110592590 AGCCTGAGGCTGTTCCGCAGAGG + Intergenic
913258156 1:116973898-116973920 CAGCCCAGGCTGTTCCAGGGTGG + Intronic
914720319 1:150283588-150283610 CACCCAAGGTTGTACCACAGAGG + Exonic
915163091 1:153933350-153933372 AACCCCATGCTCTTCCACCCAGG + Intronic
916121199 1:161529792-161529814 TACCCCAGGCTGAAGCACAGTGG - Intergenic
919851594 1:201676578-201676600 AACCCCAGCCTGGACCACTGGGG - Intronic
919997535 1:202766989-202767011 AACCCCATGATATTCCCCAGAGG - Exonic
920373296 1:205493003-205493025 AACCCCAGGCTCTTCCTCACTGG + Intergenic
922276976 1:224088288-224088310 CACTCCAGCCTGGTCCACAGAGG - Intergenic
1064097598 10:12435456-12435478 AACTCCAGCCTGTTGCACAAAGG - Intronic
1065448692 10:25831173-25831195 AACCCCAGTCAGCTCCACTGTGG + Intergenic
1065955159 10:30687388-30687410 GACCCCAGGCTGTTGTGCAGGGG - Intergenic
1069013013 10:63395442-63395464 AACTCCAGCCTGTGCAACAGAGG + Intronic
1073231865 10:101978414-101978436 AACTCCAGACTTTTCCAAAGTGG - Intronic
1077843636 11:6001562-6001584 AACCCCAAGTTGTTCCAGGGTGG + Intergenic
1079647152 11:22879687-22879709 AATACCAAGCTGATCCACAGAGG + Intergenic
1080229371 11:30001493-30001515 ACTCCCAGGTTGTTCCACATTGG + Intergenic
1080532334 11:33189213-33189235 CACTCCAGGCTGGGCCACAGAGG - Intergenic
1080660577 11:34292908-34292930 AATCCAAGGCCCTTCCACAGTGG - Intronic
1082167708 11:48966596-48966618 GGTCCCAGGCTGTTCCAGAGTGG - Intergenic
1082278703 11:50247218-50247240 AACCCCAGACTGCTGCACAGCGG - Intergenic
1084519821 11:69656344-69656366 CACCCCTGGCTGTGCCACAATGG + Intronic
1085123755 11:73983466-73983488 AACGCCAGGCCGCTCCACCGGGG - Intergenic
1085671436 11:78468220-78468242 AACCCCAGTATTTTCCAGAGTGG + Intronic
1088965935 11:114721128-114721150 ACCCCCAGGATGGTCCTCAGAGG - Intergenic
1089404680 11:118187670-118187692 GAACCCAGGCTGGTCCGCAGAGG + Intergenic
1089992139 11:122871446-122871468 TCCCCCAGGCTGGTCCACTGAGG - Exonic
1093305137 12:17507568-17507590 AAGCCCAGACTGTTCCAGACAGG - Intergenic
1098790448 12:74816412-74816434 AGCCCCTGCCAGTTCCACAGAGG - Intergenic
1098984430 12:76996405-76996427 AACCCCAGGCAGTTTCACACTGG + Intergenic
1099613538 12:84907312-84907334 AACTCCAGCCTGGGCCACAGAGG + Intronic
1101851608 12:108407651-108407673 AACCCCAGCCTCATCCAGAGAGG - Intergenic
1102522727 12:113488735-113488757 ACCCCAAGGCTTTCCCACAGAGG + Intergenic
1103544205 12:121688217-121688239 AACTCCAGGCTGGGCAACAGAGG - Intergenic
1105600416 13:21881607-21881629 AACTCCATGGTGTTCCCCAGTGG - Intergenic
1106233421 13:27840709-27840731 AAGCCCAGGCTTGTCCACTGGGG - Intergenic
1106424450 13:29612341-29612363 CACCCCAGGCTGGAGCACAGTGG + Intergenic
1109044185 13:57387067-57387089 CCCCCCAGACCGTTCCACAGTGG + Intergenic
1112999974 13:105623672-105623694 AAGCCCAGTCTGTGGCACAGAGG + Intergenic
1115221150 14:31059811-31059833 AACCCCAGGCTTGGCCACACTGG + Intronic
1118763335 14:68893981-68894003 AAACTCAGGCTGTTCTCCAGGGG - Intronic
1121421170 14:93816156-93816178 CACCCCCGGCTGTGCAACAGGGG - Intergenic
1121999254 14:98633056-98633078 AAGCCCAGGTTGTAACACAGAGG + Intergenic
1122791938 14:104187667-104187689 AGGGCCAGGCTGTGCCACAGTGG - Intergenic
1124528351 15:30479283-30479305 TTGCCCAGGCTGTACCACAGTGG + Intergenic
1128797908 15:70478515-70478537 AAGCCCTGGCTGCTCCACTGTGG - Intergenic
1130545943 15:84857734-84857756 AAGCCCAGCCACTTCCACAGTGG - Exonic
1130785522 15:87091666-87091688 AACACCAGCCAGTTGCACAGGGG - Intergenic
1131236527 15:90701687-90701709 CACTCCAGGCTGGGCCACAGAGG + Intergenic
1132089722 15:98938217-98938239 ATGCCCAGGCTTTTCCACATGGG - Intronic
1132157010 15:99502843-99502865 CACCCCAGGCTCCTCCACAGTGG - Intergenic
1132982357 16:2745009-2745031 AACCCCAGGCTGACCCACTGGGG + Intergenic
1135035553 16:19074005-19074027 AACCCCAGCACGTTCCACAAGGG - Exonic
1139060404 16:63243744-63243766 GACCCCAGCCTGTTTCCCAGAGG + Intergenic
1140248346 16:73271419-73271441 AAGCCCAGGCTGCTCCGGAGGGG + Intergenic
1140900427 16:79361835-79361857 AAGTCCAGGCTGTTACAGAGAGG + Intergenic
1141036440 16:80630355-80630377 CACCCAGGGCTGCTCCACAGAGG + Intronic
1141563367 16:84884951-84884973 AGGCCCAGGCTGTTTCCCAGTGG - Intronic
1144082704 17:11779126-11779148 AACCCCAACCTGTTCCATACGGG + Intronic
1144354229 17:14428842-14428864 ATGCCCAGGCTGGCCCACAGGGG + Intergenic
1144534223 17:16071243-16071265 CACTCCAGCCTGGTCCACAGAGG + Intronic
1145083231 17:19913185-19913207 AACTCCAGCCTGGTCAACAGAGG - Intronic
1148073351 17:44921437-44921459 GACCCCAGGCTGCTGCACTGGGG + Intergenic
1148632444 17:49121719-49121741 GACCCCAGGCTTTTTCACTGTGG - Intergenic
1148875252 17:50683464-50683486 AACACAAGGCTGAGCCACAGGGG + Intronic
1151459222 17:74244826-74244848 AACCCCAGGCTTTGATACAGTGG + Intronic
1152009204 17:77700621-77700643 AAACCCAGGCTGCACAACAGCGG + Intergenic
1155926226 18:31658427-31658449 CACCCCTGGCTGTGCCATAGTGG - Intronic
1158165565 18:54535739-54535761 AACTCCAGGCACTTCCACTGAGG + Intergenic
1158315873 18:56210741-56210763 AACTACAGGCTTTTCCACATGGG + Intergenic
1158462579 18:57659240-57659262 CACCCCAGCCTGGGCCACAGAGG + Intronic
1159105550 18:63999425-63999447 AACTCAATGCTGTTCCACATGGG + Intronic
1160590996 18:79944632-79944654 AACCCCTGACTGTTCCAGCGCGG + Intronic
1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG + Intergenic
1161758204 19:6150247-6150269 ATCGCCAGACTTTTCCACAGTGG - Intronic
1161819694 19:6522289-6522311 CACCCCAGGCTGTGCCAGGGGGG - Intergenic
1162457870 19:10796719-10796741 CACCCCACGCTGTCCCCCAGGGG + Intronic
1163173962 19:15551602-15551624 ACCACCAGGCTGCTCAACAGCGG - Exonic
1165773393 19:38390736-38390758 AACCCCAGGCTGTTCCACAGGGG + Intronic
1167249563 19:48392914-48392936 GACCACAGGCTGTTCCCCGGGGG - Intergenic
1167941731 19:52952334-52952356 CACTCCAGTCTGTTCAACAGAGG + Intronic
925616927 2:5752558-5752580 AGCCCCTGGCTGCTGCACAGAGG + Intergenic
925859011 2:8157043-8157065 ATCCCCAGGTCGTTCCAAAGGGG + Intergenic
927923381 2:26991322-26991344 GACCACAGGCTGTACCTCAGTGG - Intronic
928218332 2:29381044-29381066 AACCTCAGCCTCTTCCACAAAGG + Intronic
928386135 2:30869928-30869950 AATCCCAAACTTTTCCACAGGGG + Intergenic
928822046 2:35373063-35373085 TACACTAGGCAGTTCCACAGTGG - Intergenic
932113934 2:69027475-69027497 AACCCCAGTCATTTCCACAAAGG - Intronic
933217441 2:79646308-79646330 AACCCTTGGCTGCTTCACAGAGG + Intronic
935736613 2:106111455-106111477 AAGCCTAGCCTGTTACACAGTGG - Intronic
937322205 2:120967513-120967535 AACCAAAGGCTCTTCCACTGTGG - Intronic
937332648 2:121041966-121041988 CAGCCCAGGCCCTTCCACAGTGG - Intergenic
937470231 2:122168252-122168274 CACACCAGGCTGTTCCGCAGTGG - Intergenic
937903758 2:127041672-127041694 CACCCCAGGCTGATTGACAGGGG + Intergenic
942034485 2:171997705-171997727 CACTCCAGCCTGTGCCACAGAGG - Intronic
943476400 2:188362636-188362658 AACCCCAGGTTTTTTCACAAAGG + Intronic
945754709 2:213831928-213831950 AACCCCATGCTGTTGAACACTGG + Intronic
947473063 2:230415503-230415525 CACCCCTGGCTGTTCCAAGGCGG + Intergenic
1170987117 20:21268620-21268642 AACCGCAGGGTGCTCCAGAGAGG - Intergenic
1172055403 20:32151030-32151052 AATCCCAGGCTGTTACCCACAGG + Intronic
1172890292 20:38259694-38259716 AGCCCCAGGCAGATTCACAGGGG - Intronic
1173141781 20:40491111-40491133 ACCACCAGGCTGATCCCCAGGGG + Intergenic
1173825648 20:46046095-46046117 AACCCCAGGAAGTTCCCCATTGG + Intronic
1180944174 22:19680585-19680607 AAGCTCAGGCTGTTCCACAATGG - Intergenic
1181760799 22:25057458-25057480 AATCCCACGCTGTTCCACCAGGG - Intronic
1182821083 22:33216754-33216776 GACCCCACACTGTCCCACAGAGG + Intronic
1182927043 22:34134740-34134762 AAGCCCAGGCTGTTCCACTTAGG - Intergenic
1185118818 22:48953403-48953425 TGGCCCAGCCTGTTCCACAGAGG + Intergenic
1185128565 22:49025030-49025052 GAGCCCTGGCTCTTCCACAGGGG + Intergenic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
949829183 3:8196420-8196442 AACCCCAGGCAGGTCCAGAGAGG + Intergenic
952234276 3:31462945-31462967 AGCTCCAGGCTGATCCCCAGGGG + Intergenic
953117552 3:40008101-40008123 TACCCCAGGGTCTTCCCCAGAGG - Intronic
953789571 3:45937062-45937084 AGGCCCAGGCAGTTCCTCAGAGG + Intronic
954416379 3:50395468-50395490 CACCCCACCCTGTCCCACAGTGG + Intronic
955768786 3:62370309-62370331 AACCACAAGCTGACCCACAGCGG - Exonic
957467657 3:80615795-80615817 TACCCCACTCTCTTCCACAGTGG - Intergenic
963729299 3:148956176-148956198 AAGCCCAGGCGGTTCCACAGGGG - Intergenic
966131249 3:176642679-176642701 ATCTCCAGACTTTTCCACAGTGG + Intergenic
966611718 3:181874255-181874277 AACCCCAGCCTGGGCAACAGAGG - Intergenic
967070824 3:185961042-185961064 CACCACAGGGTGTGCCACAGGGG + Intergenic
969241219 4:5899426-5899448 AGCTCCAGGCTCTGCCACAGCGG + Intronic
970282128 4:14468791-14468813 TTCCCCAGACTGTTCTACAGAGG + Intergenic
972173254 4:36374327-36374349 CACCCCAGGCTGGGCGACAGAGG - Intergenic
974103896 4:57445875-57445897 AACCACAGGCTGATCAACACAGG + Intergenic
975930220 4:79512566-79512588 AAGCCCAGGCTGTTTCCCAGTGG + Intergenic
982611285 4:157576772-157576794 AACTCCATGCTGGTCTACAGTGG - Intergenic
983648492 4:170015899-170015921 AAATCCGAGCTGTTCCACAGGGG + Intronic
985830427 5:2224008-2224030 AACACCAGGCTCTTCCACTGGGG - Intergenic
989454735 5:41630079-41630101 GCCTCCAGGCTGTTCCAAAGGGG - Intergenic
991501681 5:67283133-67283155 TGCCCCAGCCTGCTCCACAGAGG + Intergenic
992497549 5:77308669-77308691 AACTCCATGCTGTGACACAGTGG + Intronic
992503689 5:77365484-77365506 TACCCCTGGCAGTTCCACAGTGG - Intronic
994229466 5:97297429-97297451 AACCCCAGGCAGTTCAGCACAGG - Intergenic
994601047 5:101905677-101905699 AACCCCATGCTGTTCTTCAAGGG - Intergenic
994960361 5:106594397-106594419 ATCCCCACACTGTTCCACACTGG - Intergenic
995743473 5:115378792-115378814 TAGCCCAGGCTTTTCCACACTGG - Intergenic
998578979 5:143350157-143350179 AACCCTAGGGTGTTCTAAAGAGG + Intronic
998713843 5:144857937-144857959 AACCCTAGGCTGTTTCACCCAGG + Intergenic
999246875 5:150159876-150159898 AAGCCCATGCTCTTCCCCAGAGG + Intergenic
1002333310 5:178460599-178460621 AAGCCGAGGCTGCTCAACAGTGG - Intronic
1004091367 6:12505656-12505678 AGCCCCAGACTGATCCACATGGG + Intergenic
1004428446 6:15522529-15522551 AACCCCAAGCTTTGCCAGAGTGG + Intergenic
1006647187 6:35522879-35522901 AACCCCAGGCCCTCCCACCGTGG + Intergenic
1006721184 6:36152674-36152696 AACCCCAGGCTGGAGTACAGTGG + Intergenic
1006899245 6:37489569-37489591 GCCCCCAGGCTGTTCCACCTTGG - Intronic
1007057047 6:38896824-38896846 CACCCCAGGCTGGAGCACAGTGG + Intronic
1008054365 6:46931018-46931040 CACCCCAGGCTGGGCAACAGAGG + Intronic
1012433104 6:99186764-99186786 AACTCCTGGCTATTCCTCAGGGG - Intergenic
1013307061 6:108859153-108859175 AACCCCAAACTCTTCCCCAGTGG + Intronic
1013608971 6:111776240-111776262 AACCCCTGGGTGATCCTCAGGGG - Intronic
1014362034 6:120490145-120490167 GGCCCCAGGCTCTTCTACAGTGG + Intergenic
1017785849 6:157756755-157756777 ATCCCCAGGCGGATCCCCAGAGG + Intronic
1018832412 6:167453772-167453794 ACCCCCAGGCTGTGCCAAGGAGG - Intergenic
1019299393 7:295841-295863 AAACCCAGGCAGAACCACAGAGG - Intergenic
1019542720 7:1558825-1558847 AACCCCACCTTTTTCCACAGAGG - Intronic
1019720805 7:2569441-2569463 AAGCCCAGGATGATCCAAAGGGG - Intronic
1021534188 7:21684385-21684407 GAACCCTGGCTGTTCAACAGTGG - Intronic
1021912298 7:25398069-25398091 AAAACAATGCTGTTCCACAGAGG - Intergenic
1027007277 7:74705984-74706006 AACTCCAGCCTGAGCCACAGAGG - Intronic
1030743648 7:113139183-113139205 AAACCCAGTATGTTCAACAGAGG + Intergenic
1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG + Intronic
1032543537 7:132724052-132724074 AACCCCAGAATGGTCCACAGAGG - Intronic
1033467789 7:141611909-141611931 AACACCCAGCTGTTCCAAAGTGG - Intronic
1034544591 7:151781558-151781580 AGCCCTAAGCTCTTCCACAGAGG + Intronic
1035295517 7:157864992-157865014 AGCCCAAGGCTGTGCCACATAGG + Intronic
1040302702 8:46196173-46196195 CACCCAGGGCTGTTCCACACAGG + Intergenic
1040776125 8:51045072-51045094 GACCCAATGCTCTTCCACAGTGG + Intergenic
1040986703 8:53302650-53302672 GACCCCAGGGTGTTCCACAGGGG + Intergenic
1042938040 8:74080193-74080215 CACCCCAGGCAGACCCACAGTGG - Intergenic
1048215048 8:132486503-132486525 AATCCCAGGTGGTTCCACAAAGG + Intergenic
1048908666 8:139113177-139113199 AACCTCAGGCTTCTCCACAGAGG - Intergenic
1049818360 8:144619017-144619039 CAGCCCAGCCTGGTCCACAGTGG + Intergenic
1049848264 8:144815736-144815758 AACTCCAGTGTTTTCCACAGTGG - Intergenic
1051462685 9:17340109-17340131 AACTCCAGCCTGGGCCACAGAGG + Intronic
1051604749 9:18908321-18908343 GACCCCAGGATGTACCCCAGTGG + Intronic
1052365752 9:27610728-27610750 AGCCCCAGGCTCCTCCACAGCGG + Intergenic
1053375762 9:37605052-37605074 AAATCCAGGCAGTTCCACTGTGG + Intronic
1053475794 9:38381396-38381418 AACCCCAGGCTGTGCATCTGTGG - Intergenic
1054965736 9:71025387-71025409 AAGCTCAGGCTGTCGCACAGTGG - Intronic
1059413832 9:114151106-114151128 AAACCCAGCCTGGTGCACAGTGG + Intergenic
1059879608 9:118675683-118675705 AACACCAAGCTGTTACACAGAGG - Intergenic
1060409058 9:123387964-123387986 CACCCCAGGCTGGCACACAGAGG - Intronic
1061202110 9:129143858-129143880 CACCCCCGCCTGTCCCACAGTGG + Intronic
1061502194 9:131010282-131010304 TAGCCCAGGCTGTAGCACAGTGG - Intronic
1186217075 X:7311814-7311836 CACTCCAGGCTGGTCAACAGAGG + Intronic
1192627019 X:72739551-72739573 GACCGCAAGCTTTTCCACAGAGG + Intergenic
1196034001 X:111123132-111123154 AACCCCCGGCTCCTCCACTGAGG + Exonic
1197654529 X:129102247-129102269 CACTCCAGCCTGTGCCACAGAGG + Intergenic
1198467410 X:136915940-136915962 CACCCCAGCCTGGTCAACAGAGG + Intergenic
1199187582 X:144934795-144934817 AACACCAGTCTTTTCCACAAGGG + Intergenic