ID: 1165774209

View in Genome Browser
Species Human (GRCh38)
Location 19:38395422-38395444
Sequence GGATCCTTGAGGCTAAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165774205_1165774209 -2 Left 1165774205 19:38395401-38395423 CCAAGAGTGCGCTAGGGAACTGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1165774209 19:38395422-38395444 GGATCCTTGAGGCTAAGACTGGG 0: 1
1: 1
2: 0
3: 7
4: 138
1165774204_1165774209 -1 Left 1165774204 19:38395400-38395422 CCCAAGAGTGCGCTAGGGAACTG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1165774209 19:38395422-38395444 GGATCCTTGAGGCTAAGACTGGG 0: 1
1: 1
2: 0
3: 7
4: 138
1165774202_1165774209 4 Left 1165774202 19:38395395-38395417 CCAGACCCAAGAGTGCGCTAGGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1165774209 19:38395422-38395444 GGATCCTTGAGGCTAAGACTGGG 0: 1
1: 1
2: 0
3: 7
4: 138
1165774200_1165774209 5 Left 1165774200 19:38395394-38395416 CCCAGACCCAAGAGTGCGCTAGG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1165774209 19:38395422-38395444 GGATCCTTGAGGCTAAGACTGGG 0: 1
1: 1
2: 0
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165774209 Original CRISPR GGATCCTTGAGGCTAAGACT GGG Intronic
903328844 1:22586659-22586681 GTACCCTTGAGCCCAAGACTGGG + Intronic
904014160 1:27407434-27407456 GGATACTAGAGGTTAAAACTGGG + Exonic
908029260 1:59982462-59982484 GGATTCATGAGGCCAAGACCTGG + Intergenic
910330676 1:86069172-86069194 GGGTCCTTGAGACCAGGACTAGG + Intronic
912694610 1:111831845-111831867 AGATCCTTGAGGCCAGGAATGGG + Intronic
915363844 1:155302592-155302614 GGATACTTGAGGCCAGGAGTTGG - Intergenic
918964385 1:191322612-191322634 AAATCCATGAGGATAAGACTGGG - Intergenic
922456342 1:225776754-225776776 GGATCCTTGAGGAGAAGGTTTGG - Intergenic
1065134998 10:22659140-22659162 GGTTCCTTCTGGCTAACACTTGG + Intronic
1068020192 10:51572417-51572439 GGACTCTTGAGGCTGAGACCAGG + Intronic
1072218724 10:93309639-93309661 GGATTCTTGAAGCTAGGACAAGG + Intronic
1074173358 10:110968713-110968735 GGATCCTTGAGCCCAGGAGTTGG + Intronic
1074408485 10:113201846-113201868 GGGTCCTTGATGCTAGGCCTTGG + Intergenic
1074850337 10:117434402-117434424 AGATTCTTGAGGATAACACTTGG + Intergenic
1078189688 11:9082801-9082823 GGTTGCTTGAGGCTGGGACTGGG + Intronic
1078637508 11:13065753-13065775 GGGTCCGTGAGGCTAGGACCAGG + Intergenic
1081599812 11:44485245-44485267 TGATTCTTGAGGCTCAGAGTGGG - Intergenic
1083067146 11:59936583-59936605 AGATACACGAGGCTAAGACTGGG + Intergenic
1083922918 11:65790118-65790140 GGTTCCTTGAGGATAAACCTAGG + Intronic
1085266417 11:75240572-75240594 GGCTCCTGGAGGCTCCGACTTGG - Intergenic
1085379582 11:76102458-76102480 GGAGCTTTGGGGCCAAGACTGGG + Intronic
1090267282 11:125361209-125361231 GGATCCTTGAGGGCAGGACCAGG - Intronic
1091585823 12:1816094-1816116 GGATCCTGGGGGAGAAGACTCGG - Intronic
1091758942 12:3074876-3074898 GGATCCTTGAGTCCAGGAGTTGG + Intergenic
1093237362 12:16627921-16627943 GGATCCTTAACGCCTAGACTAGG + Intergenic
1094663594 12:32495917-32495939 GGTCCCTTGAGACTAGGACTGGG - Intronic
1097238804 12:57558997-57559019 GGATCCTTGAGGCCAGGAGTTGG - Intronic
1097921887 12:65084596-65084618 GGATTCCTGTGGCTAAGAATGGG + Intronic
1101611244 12:106294242-106294264 GGTTGCTTGAGGCTAGGAGTTGG - Intronic
1102417048 12:112772887-112772909 GGATACTTGAGGGGAAGAGTGGG - Intronic
1102760540 12:115380995-115381017 GGAGCAGTGAAGCTAAGACTAGG - Intergenic
1104321677 12:127757312-127757334 TGATCCTTGAGACTGAGGCTGGG + Intergenic
1104897749 12:132172558-132172580 GAATCCTTGAGTCTAAGAAAAGG - Intergenic
1107483692 13:40806452-40806474 GGTAGCTTGGGGCTAAGACTCGG + Intronic
1109433568 13:62268847-62268869 GGATCCTTGATGCTAGGATGGGG - Intergenic
1110384067 13:74888107-74888129 GGATCCTAGAGGATAATGCTGGG + Intergenic
1113216546 13:108047698-108047720 GTATCCTTGAAGCTGAGTCTTGG + Intergenic
1113503687 13:110798458-110798480 GGAGCGTTGAGGCTGGGACTTGG + Intergenic
1114783724 14:25570099-25570121 GGATCCTCAAGCCTAGGACTAGG - Intergenic
1115861212 14:37687994-37688016 GGGTCCTTGAGTCCAGGACTTGG + Intronic
1116057882 14:39886081-39886103 GGGTCCCTGATTCTAAGACTTGG + Intergenic
1116545350 14:46158784-46158806 GGCTCCTTGAGGACTAGACTTGG - Intergenic
1118456317 14:65948292-65948314 GTGACCTTGAGGCTGAGACTGGG + Intergenic
1119203928 14:72779900-72779922 GGATGCCTGAGGCTCAGCCTTGG - Intronic
1119294100 14:73519262-73519284 GGATCCTAGGGGCTTAGATTAGG - Intronic
1120751765 14:88204386-88204408 GGATCCTGAAGGCTCAGACAAGG - Intronic
1121235693 14:92389898-92389920 GGATGCTTGGGAATAAGACTTGG - Intronic
1129565451 15:76617705-76617727 AGACCCGTGAGGCTAAGGCTTGG + Intronic
1130398228 15:83523590-83523612 GGCTCCCTGAGGCTGAGATTGGG + Intronic
1130755022 15:86754027-86754049 GGAAACTTGAGTCAAAGACTTGG + Intronic
1133055867 16:3145234-3145256 GGACCCTGGAGGCTGGGACTGGG + Intronic
1133755671 16:8760850-8760872 GGATCCCTGAGGCCAAGAGTTGG + Intronic
1135723035 16:24833251-24833273 GGACCCTGGAGGATAAGAGTGGG + Intergenic
1135840192 16:25869173-25869195 TGGTCCCTGAGGCTATGACTTGG - Intronic
1136531077 16:30869732-30869754 GATTGCTTGAGGCTAAGAGTTGG - Intronic
1138123329 16:54418406-54418428 AGATGTTTGAGGCTTAGACTTGG - Intergenic
1145194378 17:20876442-20876464 GGAACCTTGAGGATATGATTAGG + Intronic
1145297662 17:21604638-21604660 GGAACCTTGAGGATATGATTAGG - Intergenic
1145352594 17:22098780-22098802 GGAACCTTGAGGATATGATTAGG + Intergenic
1150564037 17:66322547-66322569 GGTTTCTTGAGGCTAGGAGTTGG - Intronic
1159020736 18:63141229-63141251 GCATCCTTGAGGATGTGACTTGG + Intronic
1159653779 18:71007718-71007740 GGATCTTAGAGGCTAATATTTGG + Intergenic
1160168201 18:76531719-76531741 ACCTCCTTGAGGCTAAGTCTTGG - Intergenic
1163048709 19:14664482-14664504 GATTCCTTGAGGCTAGGAGTTGG + Intronic
1165707024 19:37983516-37983538 GCATACCTGAGGCTAAGACTCGG - Intronic
1165774209 19:38395422-38395444 GGATCCTTGAGGCTAAGACTGGG + Intronic
1168240806 19:55087986-55088008 GGTTCCATGAGGCTGTGACTGGG - Intergenic
928505163 2:31944012-31944034 GGATTTTTGAGTCTCAGACTAGG - Intronic
929386895 2:41419433-41419455 GGATTTTTGAGCCTAAGATTAGG + Intergenic
931018625 2:58016438-58016460 GAATCCTTGAAGCTGAGACCTGG - Intronic
932536565 2:72603431-72603453 GGATCCTTGGGGATAAGATTAGG + Intronic
933286432 2:80389358-80389380 GGATCATGGAGGCTAATAATAGG + Intronic
936050814 2:109222571-109222593 GGATGCTGGAGGCTAAGCCCAGG - Intronic
936189482 2:110328815-110328837 GGGCCCTTGAGGCTCAGACGAGG + Intergenic
938056099 2:128215802-128215824 GAATCCTTGAGGCCAGGAGTTGG + Intergenic
941421004 2:165282635-165282657 GATTCCTTGAGGCTAGGAGTTGG - Intronic
947920253 2:233864469-233864491 GGATACATGAAGCTAAGCCTTGG + Intergenic
1169029922 20:2399047-2399069 TGATCCATGAGTCTAGGACTTGG - Intronic
1169292696 20:4366243-4366265 GGCTTCTTGAGGCTTAGGCTGGG - Intergenic
1169429798 20:5526221-5526243 GTATCCTTGATTCTAACACTAGG - Intergenic
1171562913 20:26144096-26144118 GGAACCTTGAGGATATGATTAGG + Intergenic
1173174783 20:40756240-40756262 GGAACCTAGAGACTAAGAATAGG - Intergenic
1175546586 20:59782012-59782034 GAATCCTTGAGGCCTAGATTGGG - Intronic
1177538212 21:22457444-22457466 CAAGCCTTGAGGCTCAGACTTGG - Intergenic
950158148 3:10739308-10739330 GGCTCCTTGAGGCTAAAGCCTGG - Intergenic
951419404 3:22466525-22466547 GGATCCTTGAGGTAAAGCCATGG + Intergenic
953336114 3:42095322-42095344 GGATCCTTGAGGTTTAGACCCGG + Intronic
954034861 3:47846000-47846022 GGATCCTTGTGGGCAAGACTGGG - Intronic
955095393 3:55792208-55792230 CAATCTTTGAGGTTAAGACTGGG + Intronic
956222991 3:66923747-66923769 GGGTCCCTGAGGCTAGGTCTAGG + Intergenic
967318348 3:188171637-188171659 GGATCCTTGAGGATAAGACTTGG - Intronic
967535426 3:190596588-190596610 GGTTTCTTAAGGCTGAGACTTGG - Intronic
968567492 4:1321831-1321853 GGAGACTTGATGCTAAGCCTGGG + Intronic
970224742 4:13845976-13845998 AGATCCTTGGGGACAAGACTTGG - Intergenic
970529247 4:16965392-16965414 GGGTCCTTGAGGAGAAGACAAGG - Intergenic
973027351 4:45289327-45289349 GGAGCTTTGGGGCTGAGACTGGG + Intergenic
974656551 4:64831101-64831123 GGCTCCTGGAGGCTCAAACTTGG + Intergenic
975793223 4:77977962-77977984 AGATCAATGAAGCTAAGACTTGG + Intergenic
976852951 4:89569276-89569298 GGTTCCTTTAGGAAAAGACTGGG + Intergenic
982746958 4:159114038-159114060 GGATCCTTGAGCCCAGGACGAGG - Intronic
991099675 5:62778870-62778892 GGATCCTCCAGGCAAACACTGGG + Intergenic
992108603 5:73471343-73471365 AGATCCTTGAGCCTAGGAGTTGG - Intergenic
993934396 5:93983407-93983429 GGATCCTTCTGGCTAAATCTGGG + Intronic
997476248 5:134144235-134144257 GGAAGCTGGAGGCTAGGACTGGG + Intronic
998886656 5:146701576-146701598 GGATGCTTGAAGCTTAGACATGG + Intronic
999775334 5:154808372-154808394 GGATCCTGGAACTTAAGACTTGG - Intronic
1003025298 6:2549786-2549808 GGTTTCTTGAGGTTAAGGCTTGG - Intergenic
1003268791 6:4589380-4589402 GAATCCTTGTGGCTGAGACAGGG - Intergenic
1003996255 6:11542989-11543011 GGAGTCTAGAGGCAAAGACTTGG - Intronic
1007108052 6:39296822-39296844 GGAGCCTCGAGGCAGAGACTGGG - Intergenic
1008558765 6:52702519-52702541 GATTCCTTGAGGCCAAGAGTTGG - Intergenic
1014337689 6:120158151-120158173 GGATACTTAAAACTAAGACTAGG - Intergenic
1019365935 7:632846-632868 GGCTCCTTGAGGCTGTGGCTGGG - Intronic
1019523431 7:1470505-1470527 GGATCCTCGAGGCAAAGCCCAGG - Exonic
1019594577 7:1852455-1852477 GGATCCCTGAGGCTGAGATGGGG + Intronic
1022509485 7:30926035-30926057 GGCTACTTCAGGCTGAGACTGGG + Intergenic
1025274884 7:57571333-57571355 GGAACCTTGAGGATATGATTAGG - Intergenic
1028459922 7:91080512-91080534 GGAGCCTTGAGGTTAAGAACTGG - Intronic
1029203145 7:98852480-98852502 GAATACTTGAGGCTAGGAGTTGG - Intronic
1029351208 7:100014348-100014370 GGATTCTTGAGCCCAAGAGTTGG - Intergenic
1030344956 7:108422927-108422949 GGCTCCTGGAGGCTAAGATGGGG - Intronic
1031972841 7:128076445-128076467 GGATCCTTGACGAGCAGACTGGG - Intronic
1038099905 8:24361698-24361720 GGATTGTTGAGTCTAGGACTTGG - Intergenic
1039589830 8:38737034-38737056 GGATCCTAGAGGTCAAGAATTGG + Intronic
1039721588 8:40169992-40170014 GGCTCCTTGAGGGAAGGACTTGG + Intergenic
1039860777 8:41455263-41455285 GGATCCTGGAGGCCAGGAGTTGG + Intergenic
1039863279 8:41478026-41478048 GGATCCTTGAGACCAGGAATTGG - Intergenic
1050865181 9:10488902-10488924 GGGTCCTTGATTCTAGGACTTGG - Intronic
1053661897 9:40290264-40290286 GGACCCTTGAGGCTGAGCCAGGG - Intronic
1054374023 9:64436500-64436522 GGACCCTTGAGGCTGAGCCAGGG - Intergenic
1054522712 9:66086020-66086042 GGACCCTTGAGGCTGAGCCAGGG + Intergenic
1054528673 9:66157858-66157880 GGGTCCATGAGGCAAAGAATAGG - Intergenic
1061476477 9:130870787-130870809 GGCTCCGTGAGGCTGAAACTTGG - Intronic
1061763753 9:132868676-132868698 TGATCCAGGAGGATAAGACTCGG - Intronic
1061770102 9:132913024-132913046 GGATCCCTGAGCCTAGGAGTTGG - Intronic
1061976409 9:134070128-134070150 GGTTCCTTGAGGTCAAGACCAGG - Intergenic
1203626148 Un_KI270750v1:25190-25212 GGAACCTTGAGGGTATGATTAGG - Intergenic
1187549006 X:20282514-20282536 GGCTTCTTGAGGCTCAGACTTGG - Intergenic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1188711857 X:33410794-33410816 GTAGCCTGGAGTCTAAGACTTGG - Intergenic
1189419978 X:40848281-40848303 GGATGCTTGAGGCCAGGAGTTGG - Intergenic
1190136770 X:47805526-47805548 GGATACTAGAGGTTAAAACTGGG - Intergenic
1190334272 X:49252992-49253014 GGATCCTTGGGGCTGGGGCTTGG + Intronic
1193480594 X:82022981-82023003 GGTTCTTTGTGCCTAAGACTTGG - Intergenic
1196249182 X:113438720-113438742 TGATGCTTGAGGTTAAGAATGGG + Intergenic
1197487425 X:127071091-127071113 GGATACTTGGGGGTAAGGCTGGG - Intergenic
1198955615 X:142126189-142126211 GGTGGCTTGGGGCTAAGACTTGG + Intergenic