ID: 1165778841

View in Genome Browser
Species Human (GRCh38)
Location 19:38420531-38420553
Sequence GCGTCCTAGGAACTAGACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165778833_1165778841 24 Left 1165778833 19:38420484-38420506 CCGGGGAGTCACTTGGAAGTGGG No data
Right 1165778841 19:38420531-38420553 GCGTCCTAGGAACTAGACTGGGG 0: 1
1: 0
2: 0
3: 7
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165778841 Original CRISPR GCGTCCTAGGAACTAGACTG GGG Intronic
902247346 1:15129487-15129509 GGGTTCTAGGAACCAGAGTGTGG - Intergenic
907791203 1:57666422-57666444 GCTTCCTAGGAAATAGACTTTGG + Intronic
914622388 1:149423600-149423622 ACGTCCTAGGATCTTGGCTGTGG - Intergenic
918239021 1:182605583-182605605 AGTTCCTAGGAACTAGACTCGGG + Intergenic
1063052494 10:2467853-2467875 GCGTCATAAGAAATAGACTCTGG - Intergenic
1068139626 10:52989361-52989383 GTCTCTTAGGAAATAGACTGAGG + Intergenic
1069354579 10:67569485-67569507 GAGTCCTAGAAACTAAAATGTGG + Intronic
1073273714 10:102289589-102289611 GCTTCCTAGGAAATAGCCTAAGG + Intronic
1075438762 10:122463048-122463070 GCGTTGTAGGAACCAGACAGCGG + Intronic
1093674354 12:21918776-21918798 GGGTTCTAGCCACTAGACTGTGG - Intronic
1100421250 12:94435990-94436012 GCTTCCTAGGAGCCAGACTGAGG - Intronic
1107418476 13:40223150-40223172 ACGTCCTAGGGATTAGAATGAGG - Intergenic
1114410571 14:22496669-22496691 GTGTCCTAGGAACAAAACAGGGG + Intergenic
1114736204 14:25046717-25046739 ACTTCCTATGACCTAGACTGTGG - Intronic
1124168110 15:27347433-27347455 GGCTTCTAGGAAATAGACTGGGG - Intronic
1127775853 15:62263898-62263920 CCTTCCTGGGAACTGGACTGGGG - Intergenic
1129384884 15:75190952-75190974 GCTTCCTAGGAATTGGCCTGAGG + Intergenic
1140730410 16:77851117-77851139 GAGCCCTAGCAACTAGAGTGTGG - Intronic
1148564022 17:48622604-48622626 GCATACTAGGAGCTTGACTGGGG + Exonic
1156513702 18:37662160-37662182 GAGTCCTAAGAACTGGACTTGGG - Intergenic
1164567576 19:29338844-29338866 GCATCCTAGGAACCAGTCCGTGG - Intergenic
1164788398 19:30956152-30956174 GGTTCCTAGGTAATAGACTGTGG + Intergenic
1165778841 19:38420531-38420553 GCGTCCTAGGAACTAGACTGGGG + Intronic
925150243 2:1610689-1610711 CTGTCCCAGGATCTAGACTGAGG - Intergenic
929569223 2:43009506-43009528 GCCTGTTAGGAACTGGACTGTGG + Intergenic
929671890 2:43882445-43882467 GCGTGCAAGGAACTGGAATGCGG + Intergenic
931639387 2:64368611-64368633 GAGACTTAGGGACTAGACTGTGG + Intergenic
935617827 2:105103691-105103713 CTGTAATAGGAACTAGACTGTGG + Intergenic
1170686711 20:18576035-18576057 GAATCCTGGGAACTAGACTGGGG + Intronic
1172372101 20:34401642-34401664 TAGACCTAGGAAGTAGACTGTGG + Intronic
1178299569 21:31440966-31440988 GGGTGCTGGGAACTAGAATGGGG - Intronic
949258284 3:2076559-2076581 GAGTCCTAGGAAAGAGAATGGGG + Intergenic
954609786 3:51938188-51938210 GCTTCCTTGGAGCTAGGCTGTGG + Exonic
956074826 3:65493819-65493841 GGGTCCCAGGCACTAGAGTGTGG - Intronic
960157372 3:114309492-114309514 GCTTCCTAAGACTTAGACTGGGG + Exonic
965142756 3:164861127-164861149 GCATCCTAAGTACTAGAGTGAGG + Intergenic
969143339 4:5099309-5099331 AGGTTCTAGGAACTAGAATGTGG + Intronic
969877793 4:10148797-10148819 AGGTCCTAGGACCTGGACTGAGG - Intergenic
970991577 4:22219081-22219103 GCTTCCTAGCAACTAGCCTGAGG - Intergenic
971978346 4:33720647-33720669 GCCTCCTAGCAACTAGACCTTGG + Intergenic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
975429943 4:74277419-74277441 GCATCCTAGTAACTACAATGGGG - Intronic
984990509 4:185376130-185376152 GTGGCCTGGGAAGTAGACTGAGG - Intronic
986290863 5:6397706-6397728 GTGTCCTAGGAATTAGACTCGGG - Intergenic
987056683 5:14200047-14200069 GTGTCCTGGCAACTAGACAGTGG + Intronic
988258129 5:28848119-28848141 GCGTCCTAGAAACTTCACTGAGG - Intergenic
992116121 5:73540068-73540090 GCTTCCCAGGAACTAGAGTCTGG + Intergenic
1000088700 5:157911371-157911393 GCGGCCTAGGAACTAGGGAGAGG + Intergenic
1000768997 5:165327649-165327671 GCGGCCTAACATCTAGACTGAGG + Intergenic
1002716968 5:181233999-181234021 GTATCCTAGGAACAAGAGTGAGG + Intronic
1003840617 6:10115437-10115459 ACGCCCTGGGACCTAGACTGTGG + Intronic
1018748967 6:166785330-166785352 GCGACCTAGGGAGGAGACTGAGG - Intronic
1027339515 7:77191007-77191029 GGGTCCTAGGAACATGCCTGTGG - Intronic
1030162400 7:106522390-106522412 ATGTAATAGGAACTAGACTGAGG + Intergenic
1039607596 8:38895242-38895264 GCTGCCTAGTAACTAGACTCTGG - Intergenic
1047445307 8:124913953-124913975 GCCCCCTAGAACCTAGACTGGGG - Intergenic
1047942462 8:129838791-129838813 GCGTTTTAGAGACTAGACTGGGG + Intergenic
1049790848 8:144472152-144472174 GCGCCCTAGGAACTATGCCGGGG - Exonic
1059761868 9:117345271-117345293 AAGGCCTAGGACCTAGACTGTGG - Intronic
1062197176 9:135280788-135280810 GGGTCCAAGGCACTGGACTGAGG + Intergenic
1186133829 X:6497587-6497609 GCGTCTTAGGAGCTAGACTTTGG - Intergenic
1196609526 X:117695580-117695602 GGGACCTAGGGACTAGAATGGGG - Intergenic