ID: 1165778960

View in Genome Browser
Species Human (GRCh38)
Location 19:38421054-38421076
Sequence AGCTATGGGTGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 416}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165778960_1165778972 10 Left 1165778960 19:38421054-38421076 CCCTCTGCCCTCCACCCATAGCT 0: 1
1: 0
2: 4
3: 47
4: 416
Right 1165778972 19:38421087-38421109 GAGGATATGAGGTCAGCAGGCGG 0: 1
1: 0
2: 0
3: 24
4: 279
1165778960_1165778969 -1 Left 1165778960 19:38421054-38421076 CCCTCTGCCCTCCACCCATAGCT 0: 1
1: 0
2: 4
3: 47
4: 416
Right 1165778969 19:38421076-38421098 TCACAGTCCTGGAGGATATGAGG 0: 1
1: 0
2: 3
3: 34
4: 332
1165778960_1165778971 7 Left 1165778960 19:38421054-38421076 CCCTCTGCCCTCCACCCATAGCT 0: 1
1: 0
2: 4
3: 47
4: 416
Right 1165778971 19:38421084-38421106 CTGGAGGATATGAGGTCAGCAGG 0: 1
1: 0
2: 3
3: 16
4: 218
1165778960_1165778973 11 Left 1165778960 19:38421054-38421076 CCCTCTGCCCTCCACCCATAGCT 0: 1
1: 0
2: 4
3: 47
4: 416
Right 1165778973 19:38421088-38421110 AGGATATGAGGTCAGCAGGCGGG 0: 1
1: 0
2: 2
3: 21
4: 253
1165778960_1165778976 26 Left 1165778960 19:38421054-38421076 CCCTCTGCCCTCCACCCATAGCT 0: 1
1: 0
2: 4
3: 47
4: 416
Right 1165778976 19:38421103-38421125 CAGGCGGGCAGCCAGGTCGGCGG 0: 1
1: 0
2: 2
3: 34
4: 337
1165778960_1165778974 19 Left 1165778960 19:38421054-38421076 CCCTCTGCCCTCCACCCATAGCT 0: 1
1: 0
2: 4
3: 47
4: 416
Right 1165778974 19:38421096-38421118 AGGTCAGCAGGCGGGCAGCCAGG 0: 1
1: 0
2: 2
3: 34
4: 392
1165778960_1165778975 23 Left 1165778960 19:38421054-38421076 CCCTCTGCCCTCCACCCATAGCT 0: 1
1: 0
2: 4
3: 47
4: 416
Right 1165778975 19:38421100-38421122 CAGCAGGCGGGCAGCCAGGTCGG 0: 1
1: 0
2: 5
3: 47
4: 410
1165778960_1165778967 -9 Left 1165778960 19:38421054-38421076 CCCTCTGCCCTCCACCCATAGCT 0: 1
1: 0
2: 4
3: 47
4: 416
Right 1165778967 19:38421068-38421090 CCCATAGCTCACAGTCCTGGAGG 0: 1
1: 0
2: 2
3: 38
4: 297
1165778960_1165778977 30 Left 1165778960 19:38421054-38421076 CCCTCTGCCCTCCACCCATAGCT 0: 1
1: 0
2: 4
3: 47
4: 416
Right 1165778977 19:38421107-38421129 CGGGCAGCCAGGTCGGCGGACGG 0: 1
1: 0
2: 1
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165778960 Original CRISPR AGCTATGGGTGGAGGGCAGA GGG (reversed) Intronic
900556952 1:3285337-3285359 AACAATGGGGTGAGGGCAGAGGG - Intronic
900753300 1:4415160-4415182 GGGGTTGGGTGGAGGGCAGAAGG - Intergenic
901353429 1:8620138-8620160 AGCTATGGGAGGGCAGCAGAAGG + Intronic
901532946 1:9864807-9864829 ACCTATAGGTGGAGGGCCCAGGG + Intronic
901757383 1:11449563-11449585 AGCTTTGGGGAGAGGGCAGAGGG - Intergenic
901804232 1:11727550-11727572 AGCCCTTGGTGGAGGGCAGATGG + Intergenic
901919438 1:12525808-12525830 AGCCAGGGGTGGTGGGCAGAAGG + Intergenic
902214966 1:14928868-14928890 AACACAGGGTGGAGGGCAGAGGG - Intronic
902228032 1:15009075-15009097 AGCTAAGGCTGGAGGGAAGGGGG - Intronic
902289911 1:15429069-15429091 AGGGATGTGTGGAGGGCAGGCGG - Exonic
903318355 1:22526458-22526480 AGCCAGGGATGGAGGGCAAAGGG - Exonic
903742775 1:25567819-25567841 AGCCTTGCGTGGAGGGGAGAAGG - Exonic
904391545 1:30189333-30189355 TGCTATGGCTGGAAAGCAGAAGG - Intergenic
904498365 1:30900453-30900475 AGCAAGGGGTGGATGACAGAGGG + Intronic
906078591 1:43069218-43069240 AGCTGCAGGGGGAGGGCAGAGGG - Intergenic
906088555 1:43157329-43157351 AGGAAAGGGTGGAGGGCACAAGG + Intergenic
906533752 1:46539838-46539860 AACCATGGGTTGGGGGCAGAGGG - Intergenic
907557603 1:55358294-55358316 AGCTAAGGGGTGAGGGTAGAGGG + Intergenic
908460460 1:64343999-64344021 GCCTTTGGCTGGAGGGCAGATGG - Intergenic
908992284 1:70106713-70106735 TGCTATGGCTGGAGTGCTGATGG - Intronic
909274127 1:73663412-73663434 ATCAAAGGGTGGAGGGAAGAAGG - Intergenic
909556130 1:76956511-76956533 AGCTAGGGGAGGAGGGAAGTTGG - Intronic
910643165 1:89486479-89486501 AGCTTTGGGTAGATGGCAGGAGG + Intergenic
912715955 1:111983677-111983699 AGTTATGGATGGTGGGCAGATGG - Intronic
913264472 1:117031067-117031089 AGATATGGGTGAGAGGCAGATGG + Intronic
913286343 1:117230073-117230095 AGCAATGGGTGGAGGGGATGTGG + Intergenic
916534154 1:165687465-165687487 AGCCAGGGGTGGGGGGTAGAGGG + Intronic
916716108 1:167447958-167447980 AGCTATGGGTGGGGGGGTGGGGG + Intronic
917439061 1:175050572-175050594 AGATGAGGGTGGAGTGCAGAAGG - Intergenic
918553695 1:185773995-185774017 AGCTATGCGTGGAGCTCAGTGGG + Intronic
919819860 1:201466054-201466076 AGCCCTGGGAGGAGGGCAGAAGG - Exonic
920420883 1:205832561-205832583 AGCTGTGGCTGGAGGGAGGAGGG - Intronic
920560125 1:206932809-206932831 AGCCATGGGAGAAGGGCAGAGGG + Intronic
921135603 1:212256590-212256612 AGCCATGGGAGGGGAGCAGAAGG - Intergenic
921370376 1:214416998-214417020 AGCTTTGGGTGGAGGGGAAAAGG + Intronic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
923608171 1:235464417-235464439 AGGGAGGGGTGGAGGGAAGAAGG - Intronic
924597855 1:245463052-245463074 AAGTGTGGGTGGAGGACAGAGGG - Intronic
924708420 1:246516401-246516423 ACCCATGGGTGGGGGGCAGCAGG - Intergenic
1062904494 10:1170685-1170707 AGCTCTGTGTGGAGGGGAGAGGG - Intergenic
1066274512 10:33855688-33855710 AGATATGAGTTGGGGGCAGAAGG + Intergenic
1067265833 10:44744372-44744394 ACCTGAGGGTGGAGGGCGGAAGG - Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067564563 10:47327247-47327269 TGCTCTGGCTGGAGGTCAGAGGG - Intergenic
1069729349 10:70600939-70600961 AGCCATGGGTGGAGGGATGGAGG + Intronic
1070129096 10:73644465-73644487 AGCAATGGCTGGAGGGCTGGAGG - Intergenic
1071192825 10:83122107-83122129 AGCATTGGGAGGAGGGCATAGGG - Intergenic
1071515580 10:86294581-86294603 AGCACTGGAGGGAGGGCAGATGG + Intronic
1072001708 10:91201581-91201603 GGCTGTGGGTGGAGGGAGGAGGG - Intronic
1072519165 10:96215015-96215037 AACTGTGGGTTGAGGGCTGAGGG + Intronic
1073231658 10:101976041-101976063 AGCTATTCGGGGAGGGCAGGGGG + Intronic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1074620534 10:115115219-115115241 AGCTGTGGGTGGTGGTCAGTTGG + Intronic
1074822075 10:117187282-117187304 AACACTGGGTGGAGGGCAAAGGG - Intergenic
1075013410 10:118893585-118893607 TGCTAAGGGTGGAGGGGATATGG + Intergenic
1075274924 10:121084747-121084769 AGTCCTGGTTGGAGGGCAGAGGG + Intergenic
1075278054 10:121113034-121113056 AGCTGAGGCTGGAGGGCAGCAGG + Intergenic
1075322043 10:121499288-121499310 AGCTTGAGGTGGAGGGCACATGG - Intronic
1075515125 10:123102593-123102615 AGCTCTGGGAGGGGAGCAGAGGG - Intergenic
1075520330 10:123139859-123139881 GGCTCTGGTTGGAGGGAAGAAGG + Intergenic
1075723971 10:124602462-124602484 AGCTCTGGGTTGTGGGCAGCAGG + Intronic
1076075748 10:127532581-127532603 AGCTCTGGGAGGAAGGCAGGGGG - Intergenic
1076786926 10:132754517-132754539 AGCCAGGGGTGGAGGGGTGAGGG - Intronic
1077077249 11:707267-707289 AGCTATGGCTTGAGGGAGGAAGG - Intronic
1077108910 11:853582-853604 AGCTTTGGGTGGAGTGGGGAGGG + Intronic
1077423024 11:2461787-2461809 AGTTATGGGTGGCGGGTAGATGG + Intronic
1079311059 11:19366327-19366349 AGCTCTGGATGGATGGCAGGAGG + Intronic
1080800515 11:35605761-35605783 AGGAATGGGTGGGCGGCAGAGGG + Intergenic
1081320965 11:41690974-41690996 AGCTAAGGGAGGCGTGCAGAGGG - Intergenic
1081704106 11:45170680-45170702 GGTTTTGAGTGGAGGGCAGAGGG + Intronic
1081722428 11:45300117-45300139 TACTATGGGAGGGGGGCAGAAGG + Intergenic
1081812135 11:45920119-45920141 AGCAAGGTGTGGAGGGGAGAGGG + Intergenic
1081831663 11:46120543-46120565 GGGGAGGGGTGGAGGGCAGAGGG + Intronic
1081909947 11:46694341-46694363 GGCTCTCGGTGGAGGCCAGATGG - Intronic
1081965224 11:47165212-47165234 AGCTGTGGGGGCAGGACAGAAGG + Exonic
1081977517 11:47245082-47245104 AGCTCTGGGTGGAGAGCAGCAGG + Intronic
1081996655 11:47369448-47369470 CACTCTGGGTGGAGAGCAGATGG - Intronic
1082789402 11:57336846-57336868 AGCTATGAGTTCAGGGGAGAAGG - Intergenic
1083151176 11:60792779-60792801 AGCCATGTGTGCAGGGGAGAGGG - Intronic
1083305909 11:61761911-61761933 AGCTGTGGGTGGTGGGCGGGTGG + Intronic
1083664597 11:64267591-64267613 GGCGCTGGGTGGAGGGCAGGAGG + Intronic
1083842312 11:65311480-65311502 AGCAATGGGTAAAGGGCACAGGG + Intergenic
1083901327 11:65644934-65644956 AGCTGTGGGTGGGAGACAGAAGG - Exonic
1083922694 11:65788969-65788991 AGGTGAGGGTGGAGGGCGGAGGG - Intronic
1084417566 11:69042288-69042310 AGCTATGGGAGGCAGGCAGCGGG - Intergenic
1084557892 11:69885720-69885742 GGCTGAGGGGGGAGGGCAGAAGG + Intergenic
1084859125 11:72006769-72006791 AGGTTTGGGAGGAGGGGAGAGGG - Intronic
1084875905 11:72133142-72133164 TGCAATGGAGGGAGGGCAGAGGG + Intronic
1085036017 11:73300550-73300572 AGATCTGGGAGGAGGGCACAAGG - Intergenic
1085789239 11:79482503-79482525 ACCTGGGGGTGGAGGACAGAAGG + Intergenic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1087037109 11:93766840-93766862 ACCTATGGGTGGAGGGTTCAGGG - Intronic
1087216331 11:95499234-95499256 AACAATGGGAGGAGGGCAGTGGG - Intergenic
1088815305 11:113416752-113416774 AGATATGGGTGGAGGCCCAATGG - Intronic
1088992588 11:114966862-114966884 AGCTGGGGGTGGAGATCAGAAGG + Intergenic
1089125242 11:116172176-116172198 ATGTTTGGGTGGAGGGGAGAGGG - Intergenic
1089127855 11:116190029-116190051 AGCTGGGGGTGGAGGGGAGAGGG + Intergenic
1089264245 11:117246927-117246949 AGCTTTGTGAGAAGGGCAGAAGG + Exonic
1090255993 11:125284813-125284835 AGCTGGGGGTGGAGGACAGCAGG - Intronic
1091412632 12:254140-254162 AGCTGAGGGTGGAGGGCTGGAGG + Intronic
1091847199 12:3666425-3666447 AGCTAAGGATGGGAGGCAGATGG + Intronic
1094491671 12:30964520-30964542 AACTCTGGGTGAAGGGAAGATGG - Intronic
1095507979 12:42918492-42918514 AGCTCTGGGTGGGGGGAAGGAGG - Intergenic
1096072382 12:48782534-48782556 AGGTAGGGATGGAGGGCAGCAGG - Intronic
1096114568 12:49048026-49048048 AGCTTTGGCCGGGGGGCAGAGGG - Exonic
1096115030 12:49050624-49050646 AGCTTCTGGTGGAGGGCTGATGG + Exonic
1096627921 12:52906588-52906610 TGCTGTGGGTGGAAGGCAGGAGG + Intronic
1096740319 12:53688765-53688787 AGGTAAGGGTGGAGGGCAGCAGG - Intergenic
1096817479 12:54210646-54210668 AGCTCTGGGGGCAGGGCAGGGGG - Intergenic
1099672478 12:85712189-85712211 ACATATGGGTGGAGGACACATGG - Intergenic
1101985570 12:109443925-109443947 CGCTAGGGGAGGAGGGCAGATGG - Intronic
1102796320 12:115691897-115691919 AGAAAGGGGTGGAGGGGAGAGGG - Intergenic
1103163875 12:118753546-118753568 AGCTTTGGGTTGAAGGCAGATGG + Intergenic
1103608295 12:122104903-122104925 AGCCACGGGGGGAAGGCAGAAGG - Intronic
1103818427 12:123677741-123677763 AGCTGTAGGTGGAAGACAGAGGG - Intronic
1104068785 12:125327409-125327431 AGCTATGATGGGAGGGGAGAGGG - Intronic
1104298035 12:127536388-127536410 ACCTGAGGGTGGAGGGCAGGAGG + Intergenic
1104462030 12:128963833-128963855 GGCTGTGGGTGGTGCGCAGATGG + Intronic
1104464702 12:128980740-128980762 AGCTTTGTGTGGAAGGCAGACGG + Intronic
1104969814 12:132526192-132526214 GCCTGTGGGTGGAGGGCAGGCGG + Intronic
1105941477 13:25151833-25151855 AGCAAGGGGTGGAATGCAGAAGG - Intergenic
1107059307 13:36139465-36139487 AGCACTGGGTGGGGGGCAGTGGG - Intergenic
1108083381 13:46760332-46760354 AACTATAGGTGGAGAGGAGAGGG - Intergenic
1109602382 13:64649219-64649241 ATCTAATGGTGGAAGGCAGAAGG - Intergenic
1109995927 13:70125903-70125925 GGTTGTGGGAGGAGGGCAGAGGG + Intergenic
1110022677 13:70494724-70494746 GGAGATAGGTGGAGGGCAGATGG - Intergenic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1111758259 13:92426757-92426779 AACTATGGATGGAGGACAGAGGG + Intronic
1112080040 13:95959423-95959445 GGCTATGGTTGGTGGGCAGCAGG - Intronic
1112237437 13:97649051-97649073 GGATGTGGGTGGAGGGGAGAGGG - Intergenic
1113114150 13:106857167-106857189 ACCTATGGGTGGAGGGTTCAGGG + Intergenic
1113758771 13:112833123-112833145 AGCTCAGTGTGGAGGGCACAGGG - Intronic
1113865258 13:113517803-113517825 GACTGTGGGTGGAGGGAAGAGGG + Intronic
1116630315 14:47322877-47322899 AGTTATGGTTGGAAGGGAGAGGG - Intronic
1118315891 14:64725931-64725953 AACTAATGGTGTAGGGCAGAGGG + Intronic
1118322513 14:64761573-64761595 AGGTAGGGATGCAGGGCAGAAGG + Intronic
1119193394 14:72699932-72699954 AGCTGTGGGAGGAGGAAAGAGGG + Intronic
1119420967 14:74507945-74507967 GGCTCTGGGGGGAGGGCACAGGG - Intronic
1119740006 14:77008103-77008125 AGGTGTGGGTGAAGGGCAGCAGG + Intergenic
1119767661 14:77200505-77200527 AGTGATGGGTGGGAGGCAGATGG - Intronic
1120253612 14:82090534-82090556 AGCTAATGGTAGAAGGCAGAAGG + Intergenic
1121015753 14:90547983-90548005 AGCTCTGGGTGGGGGTCAGTTGG + Intronic
1121704207 14:95979081-95979103 AGCTCTGGCTGGAGGGGAGCTGG - Intergenic
1121963181 14:98280468-98280490 AGGGTGGGGTGGAGGGCAGACGG - Intergenic
1122097403 14:99381747-99381769 AGCTCTGGGTGCTGAGCAGAGGG - Intergenic
1122266730 14:100550181-100550203 GGCTCTCGGTGGAAGGCAGAAGG - Intronic
1122549636 14:102543131-102543153 AGCCAGGGGTGGAGGGCAGAGGG + Intergenic
1122858718 14:104572520-104572542 AGGTATGGGGGGAGGGCTGTGGG - Intronic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1123634202 15:22287038-22287060 AGCTATGGGAGGGCAGCAGAAGG - Intergenic
1124947270 15:34281041-34281063 GGGTATGGGCGGAGGGCAGGGGG + Intronic
1125328694 15:38562717-38562739 TGCTAGGGGTGGAGGGGAGGTGG + Intronic
1129525089 15:76208645-76208667 AGTTATGGCTGGCGGGCAGCTGG + Intronic
1129692315 15:77720901-77720923 AGCCGTGGGTGGAGGGATGAGGG - Intronic
1131158087 15:90087281-90087303 TGTTATGGGGAGAGGGCAGAAGG + Intronic
1132107949 15:99077837-99077859 ACCTAAGGGTGGAGGGAGGAAGG - Intergenic
1132513208 16:353978-354000 AGGCCTGGGTGGAGAGCAGAGGG - Intergenic
1132571866 16:647762-647784 GGCTGTGGGAGGAGGGCAGTCGG - Exonic
1132858531 16:2058244-2058266 AGCCCTTGGTGGAGGGGAGAAGG - Intronic
1133464333 16:6015771-6015793 AGATATGGCAGAAGGGCAGAAGG - Intergenic
1133703695 16:8333302-8333324 AGTTATGGGTGGAGGGAGGATGG - Intergenic
1133737911 16:8629726-8629748 AGGTATGGGGGCAGAGCAGAGGG + Intronic
1133826671 16:9284173-9284195 AGATATGGGTGGAGAGGGGAAGG - Intergenic
1135821524 16:25690899-25690921 AGCTGTGGCTGGGGGGCAAATGG + Intergenic
1136399434 16:30009841-30009863 AGGTAGGGGAGGAGGGCAGTGGG - Intronic
1136686182 16:31996165-31996187 TGCTACAGGTGGAGGGCGGAAGG + Intergenic
1136786794 16:32939694-32939716 TGCTACAGGTGGAGGGCAGAAGG + Intergenic
1136882978 16:33914096-33914118 TGCTACAGGTGGAGGGCAGAAGG - Intergenic
1138259720 16:55607941-55607963 ACTTCAGGGTGGAGGGCAGAAGG - Intergenic
1138281108 16:55772942-55772964 AACTATGAGTGGAGGGGACATGG + Intergenic
1138343393 16:56305560-56305582 AGGGATGGGCGGAGGGCAGTGGG + Intronic
1138450981 16:57093202-57093224 AGGGGTGGGAGGAGGGCAGAGGG - Intronic
1139002230 16:62526343-62526365 AGGGATGGGTGGATGGGAGATGG - Intergenic
1139149766 16:64367708-64367730 AGCTATGGGTGGAAGACATGAGG + Intergenic
1141092437 16:81139459-81139481 AGGGATGGGTGGAGGGGAGGAGG + Intergenic
1141155471 16:81593927-81593949 AGGTAAGGGTAGAGGGAAGAGGG - Intronic
1141736122 16:85854749-85854771 AGATATGGGTGCAGGGCTGTAGG + Intergenic
1141749079 16:85946364-85946386 AGCTTTGGGGTGAGGGGAGAGGG - Intergenic
1142178850 16:88657517-88657539 AGCTGAGGCTGGAGGGCAGCGGG + Exonic
1203089030 16_KI270728v1_random:1201364-1201386 TGCTACAGGTGGAGGGCAGAAGG + Intergenic
1143012845 17:3875784-3875806 GGCTCAGGGTGGGGGGCAGAGGG - Intronic
1143155751 17:4834883-4834905 GGATATGGCTGGAGGGGAGAGGG + Intronic
1144232265 17:13219907-13219929 ACTTAAGGGTGGAGGGCAGGTGG - Intergenic
1145245219 17:21264689-21264711 AGCTCTGGGCAGAAGGCAGATGG - Intergenic
1146907004 17:36624288-36624310 AGGAAGGGGTGGATGGCAGAAGG - Intergenic
1147147144 17:38491833-38491855 TGCTACTGGTGGAGGGCGGAAGG + Intronic
1147149906 17:38508718-38508740 GGCTGTGGGTGGAGGAGAGAGGG + Intronic
1147595063 17:41711797-41711819 AGCAATGGGTTGTGGGCTGATGG - Intergenic
1148445614 17:47735147-47735169 GGCTTGGGGTGGAGGGGAGAGGG + Intronic
1148502630 17:48103340-48103362 AGGAATGGGTGGGGGGCAGGGGG - Intronic
1148790876 17:50171950-50171972 TGCCATGGGTGGAGGCCAGCAGG - Intronic
1148835766 17:50464969-50464991 AGGTATGGGTGGAGGTGAGAAGG + Exonic
1148865347 17:50625507-50625529 ACCTATGTGTGGAGGGCAGCAGG + Intronic
1149845572 17:60007553-60007575 AGACATGAGTGGAAGGCAGAGGG + Intergenic
1150281859 17:63933540-63933562 TGCCATGGTTGGAAGGCAGAGGG + Intergenic
1150633841 17:66898906-66898928 AGCGATGGGTGGAGGGCGGGGGG - Intergenic
1150850076 17:68696026-68696048 AGCAATGGGTGGAGGGCAGTGGG - Intergenic
1151599009 17:75094895-75094917 AGCGTTGGGAGCAGGGCAGAGGG + Intronic
1151725623 17:75882102-75882124 GGCTGTGGGTGGGGAGCAGAGGG - Intronic
1151772411 17:76172825-76172847 ATCTAGGGGTGGCGGGCAGTGGG + Intronic
1151846540 17:76659884-76659906 AGGGATGGATGCAGGGCAGAGGG - Intergenic
1151966004 17:77432036-77432058 AGCTGGGGGTGGGGGGCAGCAGG + Intronic
1152271745 17:79328982-79329004 AGGTATGGGCTGAAGGCAGAGGG + Intronic
1152649171 17:81484000-81484022 AGCCAGGGGCGCAGGGCAGAGGG + Intergenic
1152736654 17:82000510-82000532 AGTGATGGGGGGAGGGGAGAAGG + Intronic
1152841706 17:82573307-82573329 AGGTATGGGGGGTGGGCACAAGG - Intronic
1153492569 18:5664451-5664473 AGCTATGGGTGGGAGGAAGCTGG + Intergenic
1155245419 18:23904186-23904208 AGAACTGGGTGGAGGGCGGAGGG + Intronic
1155403593 18:25464141-25464163 AGTTATGGGTGGTGGAGAGAGGG + Intergenic
1155715508 18:28937974-28937996 AGCTAAGGGTGGAACTCAGATGG - Intergenic
1156084270 18:33380063-33380085 ATCTGGGGGTGGAGTGCAGAGGG + Intronic
1156499341 18:37547274-37547296 AGCCTTGGGTGGACGGCTGAGGG + Intronic
1156508429 18:37614438-37614460 AGATTGGGGTCGAGGGCAGAGGG + Intergenic
1156812934 18:41274194-41274216 AGCTGGGGGGAGAGGGCAGATGG + Intergenic
1157886885 18:51377291-51377313 AGTAGTGGGTGGAGGGAAGATGG + Intergenic
1158888896 18:61855037-61855059 AGCTAATGGTGGTGGGGAGAGGG + Intronic
1160507946 18:79437678-79437700 GGCAGAGGGTGGAGGGCAGAGGG - Intronic
1160520723 18:79506457-79506479 AGGGCTGTGTGGAGGGCAGACGG - Intronic
1160894210 19:1395160-1395182 AGCCACGGGTGGAGGGCAGTGGG + Intronic
1161028812 19:2048670-2048692 GGAGATGGGTGGAGGCCAGAGGG + Intronic
1161995045 19:7706878-7706900 AGCTTTGGGCCCAGGGCAGAAGG - Intergenic
1162030067 19:7913446-7913468 AGTCAGGGATGGAGGGCAGAGGG + Exonic
1162126057 19:8500045-8500067 ACCCATGGGGGGAGGGCAGTGGG - Intronic
1162176932 19:8837570-8837592 TTCTCTGGCTGGAGGGCAGAAGG + Intronic
1163369227 19:16892778-16892800 AACTATGGGGGCAAGGCAGAGGG + Intergenic
1163574578 19:18103107-18103129 AGCTGTGGGTGGAAAGCAGATGG + Intronic
1165778960 19:38421054-38421076 AGCTATGGGTGGAGGGCAGAGGG - Intronic
1166218686 19:41352380-41352402 AGCAATAGGGGGAGGGTAGAAGG - Intronic
1166343753 19:42152869-42152891 AGCTCTGGGAGGTGGGCAGGGGG + Intronic
1166747522 19:45148462-45148484 GGCCATGGGTGAAGGGAAGAAGG + Intronic
1166860100 19:45805023-45805045 AGGGTAGGGTGGAGGGCAGAGGG + Intronic
1167655070 19:50758495-50758517 AGCCATGGTTAGAGGGCGGAGGG - Intergenic
1168124603 19:54276500-54276522 AGCTGTGTGTGCAGGGCAGGGGG - Intronic
1168177384 19:54635038-54635060 AGCTGTGTGTGCAGGGCAGGGGG + Intronic
925173537 2:1767182-1767204 AGCCAGGGCAGGAGGGCAGAAGG - Intergenic
925409432 2:3631557-3631579 AGCTATGGGTTTAGGGCAGAAGG + Intronic
925505100 2:4553858-4553880 GGCTTTGTGTAGAGGGCAGAGGG - Intergenic
925721443 2:6832031-6832053 AGGTCAGGGAGGAGGGCAGAAGG + Intergenic
925784465 2:7417563-7417585 AACTCTGGGTGGAAAGCAGAAGG - Intergenic
925979282 2:9164137-9164159 AGCTAATGATTGAGGGCAGAGGG - Intergenic
926296753 2:11574477-11574499 GCCTGTGGGTGGAGGGCAGTGGG + Intronic
926676403 2:15626182-15626204 GGGTATGTGTGGAGGGGAGAGGG - Intronic
927708230 2:25310263-25310285 AGCAGAGGGTGGGGGGCAGAGGG - Intronic
928020838 2:27703568-27703590 TTCAATGGGTGGAGGGCTGAAGG + Intergenic
929005634 2:37390384-37390406 AGAATTGGGTGGAGGGCAGAAGG + Intergenic
929700108 2:44154950-44154972 AGCTATTGGGAGGGGGCAGAAGG + Intergenic
929763612 2:44826212-44826234 AGATTTGTCTGGAGGGCAGAAGG - Intergenic
932423130 2:71612976-71612998 AGCTCTGGGTGGGGGGCACCAGG + Intronic
932437020 2:71707946-71707968 AGTGAGGGGTGGAGGGCAGGTGG - Intergenic
932447129 2:71787868-71787890 AGCTAGGGATGGAGGGAACAAGG - Intergenic
932451303 2:71812366-71812388 AGCTATGGGTCCTGGGCAGGTGG + Intergenic
933302789 2:80561531-80561553 AGCAATGTGATGAGGGCAGATGG + Intronic
933547202 2:83729690-83729712 GGCTAGGTGTGGAGGCCAGAAGG + Intergenic
933939337 2:87232529-87232551 AGCTCTGAGGGGAGGGCAGAAGG - Intergenic
934605207 2:95689884-95689906 AGCCATGGGAGGATGGCAGAGGG - Intergenic
935019732 2:99218157-99218179 GGCTAGAGGTGCAGGGCAGATGG + Intronic
935511047 2:103974547-103974569 AGGTATGGGTGCAGGTAAGATGG - Intergenic
935986414 2:108677626-108677648 GACTATGGGTGGAGGGCATGGGG - Intronic
936138861 2:109921287-109921309 GACTATGGGTGGAGGGCATGGGG - Intergenic
936205835 2:110450198-110450220 GACTATGGGTGGAGGGCATGGGG + Intronic
936353796 2:111733249-111733271 AGCTCTGAGGGGAGGGCAGAAGG + Intergenic
937083311 2:119155874-119155896 AGTTGTGGGTGGAGGTCAGAGGG - Intergenic
937369345 2:121286673-121286695 ACCTATGGCTGGAGGGAGGAGGG - Intergenic
938716619 2:134027691-134027713 AGCTGGGGGCGGAGGACAGAGGG + Intergenic
938724212 2:134092401-134092423 TGCTATGTGGGGAGGGCAGTGGG - Intergenic
940007038 2:149017265-149017287 AGCTGTGGGTGGGCGGTAGATGG + Intronic
942190613 2:173465318-173465340 TGCCATGGCTGGAGGCCAGATGG + Intergenic
943753220 2:191531724-191531746 ACCTGTGGGAGGAAGGCAGATGG + Intergenic
944046335 2:195415587-195415609 AGGTATGGGGGGAGGGGGGAGGG + Intergenic
946252060 2:218419772-218419794 AGCTCCGGGTAGAGGGGAGATGG - Intronic
946482355 2:220069309-220069331 AGCAACGGGTGGAAGGCAAATGG - Intergenic
948335224 2:237202130-237202152 AGCTGTGGGTGGATAGCAGGAGG + Intergenic
948371775 2:237494208-237494230 GGCAGAGGGTGGAGGGCAGAGGG + Intronic
948524113 2:238559914-238559936 AGCTGTGGGCTGAGGGCTGAGGG - Intergenic
948564645 2:238876131-238876153 GGGTGTGGGTGGAGGGCGGATGG + Intronic
948693793 2:239722638-239722660 AGCTAAGGGTGGTGGCCTGAGGG + Intergenic
948710448 2:239821866-239821888 GGCTCTGGCTGGAAGGCAGAGGG + Intergenic
948833363 2:240611800-240611822 CTCTAGGGGTGAAGGGCAGAGGG + Intronic
948883356 2:240871310-240871332 GGCTGTGGGTGGAGCTCAGAGGG - Intronic
948975552 2:241461455-241461477 AGCAATGTGGGGAGGTCAGAGGG - Intronic
1169315086 20:4583815-4583837 GGCGGTGGGTGGAGGGTAGAAGG + Intergenic
1170313297 20:15016255-15016277 TGTTATGGGTGGAGGACAGCAGG + Intronic
1170881970 20:20304760-20304782 AGCTGTGGGTGGAGAGGAGAGGG + Intronic
1171458093 20:25283092-25283114 AACAATGGGAGGAGGGCAGGTGG + Intronic
1171527875 20:25830095-25830117 AGGGTTGGGTGGAGGGCACATGG - Intronic
1171548951 20:26025785-26025807 AGGGTTGGGTGGAGGGCACATGG + Intergenic
1171936917 20:31283523-31283545 ATCTGAGGGTGGAGGGCAGGAGG + Intergenic
1172917510 20:38454034-38454056 AGCTATGGTTGGAGGTGAGGGGG - Intergenic
1174831328 20:53814987-53815009 ACCTATGAGTGGAGGGCTCAGGG + Intergenic
1175224952 20:57439386-57439408 AGCTGGGGGTGCAGGGCAGAGGG - Intergenic
1175864041 20:62165109-62165131 AGCTAGCGGTGGCGGGGAGAAGG + Intronic
1175988472 20:62776120-62776142 AGCTGTGGGTGCTGGGCAGGTGG - Intergenic
1178095564 21:29211821-29211843 AGCTGTGGGGGGATGGGAGAAGG - Intronic
1178375393 21:32062992-32063014 AGCTATGGCTTGTGGGCAAACGG - Intergenic
1178455404 21:32745421-32745443 AGAGATGGCTAGAGGGCAGAGGG - Intronic
1180210954 21:46295377-46295399 GGGTTTGGGTGGAGGGAAGAGGG - Intronic
1181307038 22:21922893-21922915 TGCACTGGGTGGCGGGCAGATGG - Exonic
1181324610 22:22034934-22034956 AGCTTTGGGAGGTGAGCAGAAGG - Intergenic
1181392778 22:22595574-22595596 AGCTTTGGGTGTATGGCGGATGG - Intergenic
1181454960 22:23053925-23053947 CCCTATGGGTCTAGGGCAGATGG - Intergenic
1181516717 22:23418307-23418329 AGCTGTGGGAGCAGAGCAGAGGG - Intergenic
1181545442 22:23599695-23599717 AACCAGGGCTGGAGGGCAGAGGG - Intergenic
1181814868 22:25430204-25430226 AACCAGGGCTGGAGGGCAGAGGG + Intergenic
1182249069 22:28985112-28985134 AGCAACGAGTGGAGGGCAAAGGG - Intronic
1182655143 22:31884166-31884188 AGCTACTGGGCGAGGGCAGATGG - Intronic
1182915860 22:34029901-34029923 AGCTAGGGGTGAAGGGGATAGGG - Intergenic
1183172831 22:36200530-36200552 AGCTAGGGGAGGACAGCAGAGGG - Intronic
1183174993 22:36216852-36216874 AGCTATCCATGGAGGGGAGAAGG - Intergenic
1183177388 22:36234054-36234076 AGCTAGGGGAGGACAGCAGAGGG - Intronic
1183319546 22:37156732-37156754 AGCTATAAGTAGAGGGCACACGG + Intronic
1184649477 22:45913071-45913093 ACCCATGGGTGGAGGGGAGATGG - Intergenic
1185176163 22:49328222-49328244 AGCTCTGAGAGGAGGGGAGAAGG - Intergenic
1185201459 22:49508264-49508286 AGATATGGGGGGATGGAAGATGG + Intronic
950233449 3:11296761-11296783 GAAGATGGGTGGAGGGCAGAAGG - Intronic
950460154 3:13116259-13116281 AGCTATATGTGGGGGCCAGATGG + Intergenic
952500152 3:33954103-33954125 AGCTAAGGCTGGAGGGAAAATGG - Intergenic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
954041366 3:47890210-47890232 AGCTGTGGGGGGATGGGAGATGG + Intronic
954255979 3:49406629-49406651 AGCCAAGGGTGGTGGGCAGGTGG + Intronic
954996195 3:54884083-54884105 AGGAATGGGAGGAGGGCAAAAGG + Intronic
955408651 3:58641975-58641997 CGCTGTGGGGTGAGGGCAGATGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956988049 3:74726927-74726949 ATATATGGTTGGAGGGGAGAGGG + Intergenic
958478767 3:94619792-94619814 AGTGATGGGGGGAGGGCAGAAGG + Intergenic
960145951 3:114202712-114202734 ACTTAAGGGTGGAGGGCGGAAGG + Intergenic
960594501 3:119395771-119395793 AGCTATGTGCGAAGGGCAGAAGG + Intronic
960827159 3:121801028-121801050 AAGTATGGGTGGAAGGTAGAGGG - Intronic
961108694 3:124264732-124264754 AGAAATGTGTGGATGGCAGAAGG - Intronic
961646829 3:128397221-128397243 TGCCATGGGTGGGGGGCAGCAGG - Intronic
963933841 3:151032578-151032600 ATCGGAGGGTGGAGGGCAGAAGG + Intergenic
966855766 3:184193032-184193054 AGGTGTGGCTGGAGGGCACAGGG + Intronic
966881611 3:184354054-184354076 GGCTGTGGGTGAAGGGCAGAGGG - Intronic
967055188 3:185824590-185824612 AGCTGTGGGGGGAGGGGAGCGGG + Intronic
967481786 3:189981063-189981085 AGGTATGGGGGGATGGCAGGAGG - Intronic
968603981 4:1522872-1522894 TGCTAGGGATGGAGGGCAGATGG - Intergenic
969189522 4:5505909-5505931 GGGTATGGGTGTTGGGCAGAGGG - Intergenic
969510506 4:7614880-7614902 ATTGATGGGTGGATGGCAGATGG - Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
970176966 4:13349248-13349270 AGCTGTGGTGGGAGGGGAGAGGG + Intergenic
971238802 4:24868823-24868845 AGCTCTGAGTGGACTGCAGAGGG + Intronic
973956099 4:56064985-56065007 AGCTGTGGTTGCAGGGCAGTGGG + Intergenic
975423818 4:74202560-74202582 TGCTGTGGGAGGAGGGCACAAGG + Intronic
977354982 4:95934077-95934099 TCCTATGGCAGGAGGGCAGAGGG + Intergenic
979343921 4:119562645-119562667 AGGTAGGGGTGGAGGGTGGAGGG - Intronic
980929969 4:139176405-139176427 CGCTCTGGGTGGCGGGCAGGCGG - Intronic
981792188 4:148551107-148551129 GGCTAAGGGTGGGTGGCAGACGG - Intergenic
982053254 4:151524588-151524610 AGCCATGGGTGGTGAACAGAGGG + Intronic
983845646 4:172514581-172514603 ATCTGGGGGTGGAGGGCAAATGG - Intronic
985043381 4:185915696-185915718 TGCTGGGGGTGGGGGGCAGAAGG - Intronic
985058474 4:186056581-186056603 AGCTGGGGGTGGAAGGCAGAAGG - Intergenic
985232473 4:187835885-187835907 AGTCATGAGTGGAGGTCAGATGG - Intergenic
986286780 5:6365139-6365161 TGCTAGAGGTGGAGGGCAGGGGG - Intergenic
986353147 5:6898924-6898946 AGTTGAGGGTGGAGGGTAGAAGG + Intergenic
987330066 5:16848672-16848694 CGCTACGGATGGACGGCAGAAGG + Intronic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
990845092 5:60128371-60128393 AGCTATGGGCCCAGGGAAGAAGG - Intronic
992371815 5:76151599-76151621 AGCTATGGGTGCAGGGAGGAGGG + Intronic
993398033 5:87414920-87414942 AGGTGTGGGTGGAGGGTAGAAGG - Intergenic
994757163 5:103808760-103808782 AGCTATGGGTGAAGGTCAAATGG - Intergenic
994767049 5:103931713-103931735 AGAAATGGGTGGAGGGGAGCGGG + Intergenic
996419721 5:123249041-123249063 AGCTACTGATGGAGGGGAGAGGG + Intergenic
996423264 5:123285654-123285676 AGGGGTGGGTGGAGGGCAGGAGG - Intergenic
997013275 5:129904177-129904199 AGCTGGGGGAGGAGGGAAGAGGG + Intergenic
997235685 5:132270861-132270883 AGGAATGGCTGGAGGCCAGAGGG + Intronic
997980495 5:138465153-138465175 GGCTCTGGGAGGAGGGAAGAAGG + Intergenic
999652525 5:153781452-153781474 AAATATGGGTGGAGGGCAGAAGG - Intronic
1001327770 5:170741912-170741934 GGCTTTGGGATGAGGGCAGAAGG - Intergenic
1003148674 6:3530453-3530475 AGCTGTGGCTGGAAGGAAGAGGG + Intergenic
1003442620 6:6158083-6158105 AGCTATGGGAGCAGGGCTGAAGG + Intronic
1005164896 6:22908535-22908557 GACTATGGGTGGAGGGCAGCAGG + Intergenic
1006318282 6:33304027-33304049 TGGTAGAGGTGGAGGGCAGAGGG + Intronic
1006446084 6:34080549-34080571 TGCAAAGGCTGGAGGGCAGAAGG + Intronic
1006944856 6:37778429-37778451 AGTTATGGATGGAGGACAGTAGG - Intergenic
1007250106 6:40489639-40489661 AGGCCTGGGAGGAGGGCAGAAGG + Intronic
1007774691 6:44218532-44218554 AGCTAGTGGTGGTGGGAAGAGGG + Intergenic
1007925544 6:45646770-45646792 AGCTGAGGGTAGAGGGCAGAGGG + Intronic
1008614644 6:53214714-53214736 AACAGTGGGAGGAGGGCAGAGGG - Intergenic
1009452427 6:63817494-63817516 AGCTACTAGTGGAGGGGAGAGGG + Intronic
1011649839 6:89495346-89495368 ACCTCTGGGAGGAGGGTAGAGGG + Intronic
1012814006 6:103999094-103999116 ATCAGAGGGTGGAGGGCAGAAGG - Intergenic
1013628229 6:111958826-111958848 AGGCAGGGGTGGAGTGCAGAAGG - Intergenic
1014144437 6:117981065-117981087 AGCTTTGGTTGTAGGGCAAAAGG + Intronic
1016814009 6:148287021-148287043 GCCTATGGGTGGAGTCCAGAGGG + Intronic
1017920792 6:158870224-158870246 AGTTGTGGGTGGGGGACAGAAGG + Intronic
1018001906 6:159586830-159586852 AGCTATGGAGGGTGGGCACATGG + Intergenic
1018798906 6:167207672-167207694 AGGTGTGGGTGGAGGACTGAAGG + Intergenic
1019117596 6:169777772-169777794 AGCTGTGGGTGGGGGGAAGGGGG - Intronic
1020749829 7:12126382-12126404 AGCTCTGTGAGCAGGGCAGATGG - Intergenic
1020914311 7:14172846-14172868 AGCTTGGGGTGGAGGGTAGAGGG - Intronic
1021092775 7:16502440-16502462 AGCGAGGGGTGGAGAGCAGCGGG + Intronic
1021177121 7:17461812-17461834 AACTATGGGAGCAGGGCAGTAGG + Intergenic
1021593288 7:22288209-22288231 AGCCATAGGCGGAGGGCAGTAGG - Intronic
1021667129 7:22995188-22995210 AGCTTTGGGTGGATGGTTGAAGG - Intronic
1022960789 7:35424348-35424370 ATCCTTGGGTGGAGGGTAGAGGG + Intergenic
1023494018 7:40775317-40775339 AGCTAGTGGTTGAGAGCAGAAGG - Intronic
1023746431 7:43326758-43326780 AGCTTTGGCTGCAGAGCAGAGGG - Intronic
1024026397 7:45413511-45413533 AGCTAGGGGTGGCTGGCAAAAGG + Intergenic
1024629492 7:51235631-51235653 AGCCGTGGGTGGTGGGCAAAGGG - Intronic
1025801322 7:64789218-64789240 AGGTGTGGGAGGAGGGCAGCAGG - Intergenic
1026462049 7:70623008-70623030 TGCTATGGCAGGAGGGCACACGG - Intronic
1027956357 7:84883562-84883584 ATCTGAGGGTGGAGGGTAGAAGG - Intergenic
1028166254 7:87541152-87541174 AGGTAAGGGTGGAGAGGAGAAGG + Intronic
1028713179 7:93934387-93934409 AGGGGTGGGTGGAAGGCAGAGGG - Intergenic
1029038797 7:97551071-97551093 AGATAGCGGTGAAGGGCAGAAGG - Intergenic
1029515766 7:101022076-101022098 AGGGATGGGGGGAGGGCAAAGGG - Intronic
1031039343 7:116822576-116822598 ACCTATGGGGGGAAGGAAGATGG - Intronic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1033629135 7:143140008-143140030 AGCTGTTGCTGGAGGGCAGTGGG - Intergenic
1034470406 7:151251744-151251766 AGCGATGGGGGGACGGCAGGGGG - Intronic
1034837146 7:154363049-154363071 AACAATGGGTGGAGGGGAGGAGG - Intronic
1035214553 7:157355502-157355524 AGCTGGTGGTGGAAGGCAGATGG + Intronic
1035714098 8:1740632-1740654 GGCTATGCGTGCAGGGGAGAGGG - Intergenic
1036620171 8:10419739-10419761 CTCTTTGGGTGGAGGGCAGGCGG + Intronic
1037542832 8:19888794-19888816 AGCTGTGGGTGGAGAGGAGCTGG - Intergenic
1038150399 8:24938258-24938280 AGATAGGGAAGGAGGGCAGAAGG + Intergenic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1039147654 8:34466775-34466797 GGCTCTGGGGTGAGGGCAGAAGG + Intergenic
1039856431 8:41418851-41418873 AGGTATGGGTGGTGGGAGGATGG + Intergenic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040073959 8:43211059-43211081 AGCTCTGGGTGCAGGGTAGGTGG + Intergenic
1041749585 8:61245799-61245821 AGGGATGGCTGGAGGGCAGGAGG + Intronic
1041789581 8:61678150-61678172 AGGTATGGGTGGAAAGCAAAAGG - Intronic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1042938327 8:74082771-74082793 AAATATGACTGGAGGGCAGAAGG + Intergenic
1044874402 8:96650156-96650178 AGGTGTGGGTGCTGGGCAGAGGG + Intronic
1045118825 8:99013351-99013373 AGCCGAGGGTGGAGTGCAGAGGG + Intronic
1046263319 8:111799435-111799457 AGCTATGTGTGAAAGCCAGAGGG + Intergenic
1048193123 8:132308369-132308391 AGGGATGGATGGAGGGCAGGGGG + Intronic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049207500 8:141370329-141370351 AGCTATGGAGGAGGGGCAGAGGG + Intergenic
1052482823 9:29053407-29053429 ACCTATGGGTGGGGGGAAGGGGG + Intergenic
1052528260 9:29649646-29649668 AGCTTAGGGTGGAGGTCTGAGGG + Intergenic
1052584509 9:30409050-30409072 AGTCTTGGGTGGAGGGCACAGGG - Intergenic
1052833397 9:33233377-33233399 AGCTCTGGGTGGACAGAAGATGG + Intronic
1054452441 9:65410360-65410382 AGCTATGGGGGGAGGGTGGGAGG + Intergenic
1054681091 9:67919642-67919664 AGCGGTGTGTGGAAGGCAGAAGG + Intergenic
1056743462 9:89280067-89280089 AGCTGGGGTTGGAGGGTAGATGG - Intergenic
1056853014 9:90100143-90100165 AGCCAAGGGTGGTGGGAAGAGGG + Intergenic
1057131413 9:92656815-92656837 CGCTTTGGGAGAAGGGCAGACGG - Intronic
1057141687 9:92730136-92730158 TTCCATGGGTAGAGGGCAGACGG + Intronic
1057330101 9:94106313-94106335 AGCTCTGCCTGGAGAGCAGAAGG + Intronic
1057445669 9:95112742-95112764 AGCTACTGGTGGAAGACAGAGGG - Intronic
1061390734 9:130315819-130315841 ACCTATGGGTGGAGAGAGGAAGG + Intronic
1062020386 9:134316541-134316563 GGCAAGGGGTGGAGGGCAGAGGG - Intergenic
1062139112 9:134945680-134945702 GGCAGAGGGTGGAGGGCAGAGGG + Intergenic
1062322938 9:135999156-135999178 AGCTCTGGGTGGATGGAAAATGG + Intergenic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1062657482 9:137611811-137611833 TGCTCTGGGTGGCAGGCAGAAGG + Intronic
1186416908 X:9391777-9391799 GGCTGTGGGTGGAGGGCAACGGG + Intergenic
1187069673 X:15875676-15875698 AGCTGTGGAAGGAGGACAGAGGG + Intergenic
1187676969 X:21725937-21725959 AGCAAGGGGCAGAGGGCAGAAGG + Intronic
1187969670 X:24647191-24647213 GGGGATGGGTGGAGGGTAGAGGG - Exonic
1189101686 X:38197051-38197073 AGAGATGGGCGGAGGGGAGATGG + Intronic
1190128425 X:47725275-47725297 AGGGATGGCTGGAGGGCAGGTGG - Intergenic
1192503943 X:71669732-71669754 TGATAGGGGTGGAGGGGAGAGGG + Intergenic
1192510037 X:71716156-71716178 TGATAGGGGTGGAGGGGAGAGGG - Intronic
1192516660 X:71765397-71765419 TGATAGGGGTGGAGGGGAGAGGG + Intronic
1192529168 X:71871279-71871301 TGATAGGGGTGGAGGGGAGAGGG - Intergenic
1192554623 X:72079934-72079956 GGCTGTGGGTGGAGTGCAGCGGG + Intergenic
1192796992 X:74432137-74432159 TGCTACGGGTTGGGGGCAGATGG + Intronic
1193030747 X:76896080-76896102 ACTTGTGGGTGGAGGGTAGAAGG + Intergenic
1194301124 X:92187280-92187302 AGGTATGAGGGGAGGTCAGATGG - Intronic
1197290786 X:124654648-124654670 AGTTAGGGCTGGAGGGAAGAAGG + Intronic
1200059520 X:153478039-153478061 AGGCTTGGGTGGAGGGGAGAAGG - Intronic
1200152960 X:153960197-153960219 GGCTATGGGAGGAGGGGAGTCGG + Intronic
1201672013 Y:16533466-16533488 ATCTGTGGGTGGAGTGTAGATGG + Intergenic
1202305588 Y:23466714-23466736 AGCTATGGGAGGGCAGCAGAAGG - Intergenic
1202565221 Y:26203875-26203897 AGCTATGGGAGGGCAGCAGAAGG + Intergenic