ID: 1165779158

View in Genome Browser
Species Human (GRCh38)
Location 19:38422229-38422251
Sequence GCCCCAAGGCACCACGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165779152_1165779158 2 Left 1165779152 19:38422204-38422226 CCCTAGAATTCCTTTTGACTCTA 0: 1
1: 0
2: 0
3: 29
4: 347
Right 1165779158 19:38422229-38422251 GCCCCAAGGCACCACGGGAGAGG 0: 1
1: 0
2: 1
3: 16
4: 155
1165779151_1165779158 18 Left 1165779151 19:38422188-38422210 CCTTCTTTCGGACAGACCCTAGA 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1165779158 19:38422229-38422251 GCCCCAAGGCACCACGGGAGAGG 0: 1
1: 0
2: 1
3: 16
4: 155
1165779154_1165779158 -8 Left 1165779154 19:38422214-38422236 CCTTTTGACTCTAATGCCCCAAG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1165779158 19:38422229-38422251 GCCCCAAGGCACCACGGGAGAGG 0: 1
1: 0
2: 1
3: 16
4: 155
1165779153_1165779158 1 Left 1165779153 19:38422205-38422227 CCTAGAATTCCTTTTGACTCTAA 0: 1
1: 0
2: 1
3: 20
4: 262
Right 1165779158 19:38422229-38422251 GCCCCAAGGCACCACGGGAGAGG 0: 1
1: 0
2: 1
3: 16
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165779158 Original CRISPR GCCCCAAGGCACCACGGGAG AGG Intronic
900523442 1:3117046-3117068 GCCCCCAGGACCCACGGGAAGGG + Intronic
900650806 1:3729272-3729294 GCCCCAGACCCCCACGGGAGGGG - Intronic
900830466 1:4961713-4961735 GCCCCAAAGCCCCAAGGGACAGG + Intergenic
901757396 1:11449594-11449616 CCCCCAAAGCACCACGGGGGAGG + Intergenic
902098809 1:13967993-13968015 GCCCCTAGAGACCAAGGGAGAGG - Intergenic
904567075 1:31434493-31434515 GTCCTCAGGCTCCACGGGAGCGG + Exonic
905136926 1:35807628-35807650 GCCGGAAGGCACCACGGGAATGG - Intergenic
906292133 1:44626209-44626231 TCCCCAAAGCACCACAGGACTGG + Intronic
908127168 1:61043385-61043407 CCCCCAAGCCACGACGGCAGCGG + Intronic
908572141 1:65420882-65420904 ACCCCAAGGGACGAAGGGAGCGG - Intronic
915288266 1:154866690-154866712 GCCCCAAGGCACACAGGAAGTGG + Intronic
919928175 1:202203612-202203634 TCTCCAAGGCTCCAGGGGAGAGG - Intronic
922705674 1:227788832-227788854 GCCCCAAGCCACCTTTGGAGCGG - Intergenic
922719941 1:227895248-227895270 CCCCCAAGGCCCCAAGGCAGGGG - Intergenic
1068601711 10:58963916-58963938 CCACAAAGGCACCACAGGAGAGG - Intergenic
1069874508 10:71553384-71553406 GCCCCAGGGCACCAAGTGACAGG + Intronic
1070541183 10:77416461-77416483 GCCCCAAGCCACCACCCAAGGGG + Intronic
1072048986 10:91684717-91684739 GCCCCAAGGCCCACTGGGAGTGG - Intergenic
1072607775 10:96998839-96998861 GCCCCATGGCGCCAGGTGAGGGG + Exonic
1073444421 10:103572048-103572070 TGCCCAAGGCACCACCTGAGAGG - Intronic
1075271592 10:121056636-121056658 GCCACCAGGCACCAGGGGAAAGG - Intergenic
1075798577 10:125137938-125137960 ACCCCAGGGGACCGCGGGAGGGG + Intronic
1076473325 10:130735375-130735397 GCCCACAGGCACCAGGGGAGGGG + Intergenic
1076662409 10:132064466-132064488 GCTTCAGGGCAACACGGGAGGGG + Intergenic
1076835584 10:133019502-133019524 CGCCCAACGCACCACAGGAGAGG - Intergenic
1077463826 11:2724065-2724087 GCCCCCAGGCACCACCGGAGGGG - Intronic
1077516266 11:3003820-3003842 GGCCCGAGGCACCATGGGGGAGG - Intronic
1077633681 11:3827504-3827526 GCACCAAGGCACAACTGGTGGGG + Exonic
1079504029 11:21133575-21133597 GCCCCAAGGTAGCATGGGACTGG + Intronic
1084168704 11:67389904-67389926 CCCCCAAGGCTCCACGGAAGGGG + Intronic
1084943456 11:72626423-72626445 GCCCCATGGCCCCAAGGGAGTGG - Intronic
1085403190 11:76246641-76246663 GCCACCAGGCACCAGGGGGGCGG - Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1090416431 11:126543698-126543720 CCCCAAGGGCACCATGGGAGAGG - Intronic
1090429518 11:126634447-126634469 GGTCCCAGGCACCACGAGAGAGG - Intronic
1091563256 12:1630149-1630171 GTCCCCAGGCTCCCCGGGAGGGG - Intronic
1092391341 12:8082632-8082654 GCCCCAGGGGATTACGGGAGAGG - Intronic
1092904380 12:13088740-13088762 GCCACAAAGCCCCAAGGGAGGGG + Intronic
1092951465 12:13507471-13507493 GGACCAAGGAACCACAGGAGGGG + Intergenic
1094348508 12:29497769-29497791 GCCCATAGGCACCGCAGGAGGGG - Intergenic
1101937152 12:109067665-109067687 GCCCCAAGTCACTAGGGGAAAGG - Intronic
1102201572 12:111061051-111061073 GCCCCAAGGAAGCGGGGGAGGGG - Intronic
1104079236 12:125415691-125415713 TCCCCAAGGCACCTCCGCAGTGG + Intronic
1104739683 12:131163729-131163751 GCCTCAAGGCAGCATGGGGGGGG - Intergenic
1105786963 13:23759466-23759488 CCCCCAAGACAGCACGGGACGGG + Intronic
1113134036 13:107069399-107069421 GCCCCAAGGCACCATCAGATAGG - Intergenic
1113430762 13:110248424-110248446 GCCCCACGGCCACACGGCAGGGG + Intronic
1113562960 13:111298485-111298507 GCTCCAAGAGGCCACGGGAGAGG - Intronic
1113630870 13:111882754-111882776 CCACCAAGGCGCCACTGGAGAGG + Intergenic
1120869459 14:89323957-89323979 GCACAAAGGCACCACGCTAGAGG - Intronic
1122178312 14:99937087-99937109 GCCCCAAGAGCCCACGGGGGTGG + Intronic
1122220801 14:100238433-100238455 GGCCCCGGGCACCACGGGGGCGG - Intronic
1122804126 14:104248098-104248120 GGCCCAGGGCACCTCTGGAGAGG + Intergenic
1124552769 15:30696755-30696777 GGCCCAAGGCCCCAGTGGAGGGG - Intronic
1124678473 15:31708915-31708937 GGCCCAAGGCCCCAGTGGAGGGG + Intronic
1127402873 15:58608254-58608276 GCCACCAGGCACCACTGGAAAGG + Intronic
1129450701 15:75649578-75649600 GGCCCAAGCCACCACTGGAGCGG + Exonic
1129862387 15:78872774-78872796 GCCCCAGGGCACGCCGGGACTGG - Intronic
1130135882 15:81181623-81181645 GGCCAGAGGCACCACGGCAGGGG + Intronic
1130350250 15:83085131-83085153 GGCCCAAGGCACCAGGGGGTAGG + Intergenic
1131389420 15:92034759-92034781 GCCACATGCCACCACTGGAGGGG - Intronic
1132178330 15:99733093-99733115 GCTCCACGGCTCCACGGGCGGGG + Intronic
1132399419 15:101496389-101496411 GGACCAGGGCACCAAGGGAGGGG - Intronic
1132844638 16:1994340-1994362 GCACCAGGGCCCCACAGGAGGGG + Intergenic
1132866059 16:2093294-2093316 GCCCCTAAGCACCACTGCAGTGG - Intronic
1133779152 16:8923712-8923734 GACCCCAGGCACCAAGTGAGTGG + Intronic
1133975301 16:10596160-10596182 GCCCCAGGGAACCAGGGGTGGGG - Intergenic
1134142303 16:11731368-11731390 GTCCCCAGGCACAACTGGAGGGG - Intronic
1138205545 16:55121777-55121799 GCACCATGTCACCACTGGAGGGG + Intergenic
1147055752 17:37833606-37833628 GCCTCATTGCACCACGGGATGGG - Intergenic
1147726126 17:42567141-42567163 GACCCAAGGGTCCTCGGGAGAGG - Exonic
1155918161 18:31576247-31576269 GCCCCATGGCACCACAGGGATGG + Intergenic
1157887471 18:51383024-51383046 GCCCCAGGGCAGGAAGGGAGAGG - Intergenic
1158536992 18:58317201-58317223 GCTCCAGGGTGCCACGGGAGGGG + Intronic
1160039826 18:75335312-75335334 GCCTCCTGGAACCACGGGAGAGG - Intergenic
1160140410 18:76316686-76316708 GCCGCAAGGCACACCAGGAGGGG + Intergenic
1160988035 19:1848502-1848524 GCCGCAAGGGACCCCGGGAGGGG + Intergenic
1165419967 19:35717845-35717867 CGCGCAGGGCACCACGGGAGAGG - Intergenic
1165779158 19:38422229-38422251 GCCCCAAGGCACCACGGGAGAGG + Intronic
1165955312 19:39498859-39498881 GCCCCAAGGGACCAAGGGCGGGG - Intergenic
1166739235 19:45104140-45104162 CCCAGAAGGCAGCACGGGAGGGG - Intronic
1166743823 19:45130420-45130442 GCGCCAAAGCACACCGGGAGGGG - Intronic
1167097322 19:47381295-47381317 GCCCCCAGGCCCCACAGGATGGG + Exonic
1167666208 19:50823875-50823897 GCCCCCAGGCAACAGGGGAAGGG - Intergenic
925006487 2:447134-447156 GTCACAAGGGACCAAGGGAGGGG - Intergenic
925659249 2:6184679-6184701 GCGACAGGGCACTACGGGAGAGG + Intergenic
927464964 2:23329875-23329897 GCCCCGAGGGTCCACGGCAGGGG - Intergenic
928172856 2:29014554-29014576 GCACCAAGGTACCTGGGGAGCGG + Exonic
929576890 2:43057561-43057583 GGCCGAAGGCACTAGGGGAGGGG + Intergenic
929963123 2:46511320-46511342 GCCTCAGGGCACCAGGGGACTGG + Intronic
930008303 2:46915470-46915492 GCCCCTAGGGACCAGGGAAGGGG + Intronic
932451520 2:71813612-71813634 GCCCCCAGGAACCAGGGGAGAGG - Intergenic
932588123 2:73044910-73044932 GCCTCAAGGCCCCACCTGAGGGG + Intronic
937078610 2:119124890-119124912 ACCCCAGGGCACCTCAGGAGAGG - Intergenic
937082587 2:119151082-119151104 TCCCCAAGGCCCCAAGGGGGAGG + Intergenic
938260371 2:129891619-129891641 CTCCCAAGCCACCAGGGGAGAGG - Intergenic
940004473 2:148998517-148998539 GGCCCAGGGCACCAGGGGTGTGG + Intronic
942678201 2:178450760-178450782 GCCGCCAGGGACCACGAGAGGGG + Intronic
1171201664 20:23246882-23246904 GCCTCAAGTAACCACGGGGGTGG - Intergenic
1173548528 20:43916362-43916384 GCCCTCAGGCCCCAGGGGAGCGG + Intronic
1175641621 20:60635100-60635122 GCCCCCAGGAAAGACGGGAGTGG - Intergenic
1175986764 20:62767955-62767977 GCCCCAAGCCACTAGGGCAGAGG + Intergenic
1176002582 20:62839678-62839700 GCTCCAGGGCACCCAGGGAGAGG - Intronic
1176002600 20:62839726-62839748 GCTCCAGGGCACCCAGGGAGAGG - Intronic
1176002618 20:62839774-62839796 GCTCCAGGGCACCCAGGGAGAGG - Intronic
1176299858 21:5094521-5094543 GCCCCAGGGCACCCTGGAAGCGG - Intergenic
1179857164 21:44167390-44167412 GCCCCAGGGCACCCTGGAAGCGG + Intergenic
1181066106 22:20306842-20306864 GCCCCAAGGCAGGCAGGGAGGGG - Intergenic
1181277180 22:21694510-21694532 GCCCCAAGGCACGTGGGAAGAGG - Intronic
1181583260 22:23839310-23839332 GACCCACGACACCACGGGGGCGG + Intergenic
1183271188 22:36863495-36863517 GCATCAAGGCACCTCGTGAGCGG + Intronic
1184089586 22:42285158-42285180 GCCCCGTGGCACCAGGGAAGAGG - Intronic
950055632 3:10022055-10022077 GCCCCAGGGCGCCACTGGAGCGG + Intergenic
951563293 3:23988961-23988983 GCCCCAGCACACCACTGGAGAGG - Intergenic
955916267 3:63911918-63911940 GCCCCAGGGCAGCGCGGGAGAGG - Intronic
960717504 3:120591916-120591938 GCCCCAAAGCACCACATGGGAGG - Intergenic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
966868616 3:184276202-184276224 GGCCCCGGGCTCCACGGGAGGGG + Intronic
969964074 4:10976180-10976202 TGCCCAGGGCACAACGGGAGTGG - Intergenic
991536408 5:67673729-67673751 TCCTGAAGGCACCACTGGAGTGG - Intergenic
994710576 5:103259360-103259382 GCACCGCGGCACCGCGGGAGAGG - Intronic
996828203 5:127709309-127709331 GCACCAAGGCACCAAGGGGATGG + Intergenic
999498806 5:152126063-152126085 GTCCGAAGGCACCAGGGGCGGGG - Intergenic
1001405935 5:171477622-171477644 CCCCAAAGGCTCCAAGGGAGTGG - Intergenic
1002102398 5:176863905-176863927 TCCACAAAGCACCAAGGGAGAGG - Intronic
1002718977 5:181246618-181246640 CCCCCAAGGCCCCATAGGAGGGG - Intronic
1006367112 6:33622124-33622146 CCTCAAAGGCACCACGGGATCGG - Intronic
1012844613 6:104374263-104374285 GCCACAAGGAAACACAGGAGAGG + Intergenic
1017713849 6:157193811-157193833 ACCCAAAGGCATCATGGGAGGGG + Intronic
1018017651 6:159727057-159727079 GCCCCAGGGCATCACGGGAAGGG - Exonic
1019384427 7:746585-746607 GTCCCTAGGCACGACGGGCGGGG - Intronic
1019611716 7:1940106-1940128 GCCCCATGGCACGATGGCAGAGG + Intronic
1019640039 7:2098466-2098488 GACCCCAGGCAGCAGGGGAGAGG - Intronic
1020009966 7:4802298-4802320 GCCCCGAGGTACCTGGGGAGGGG - Intronic
1020009982 7:4802334-4802356 GCCCCGAGGTACCCGGGGAGGGG - Intronic
1020010001 7:4802373-4802395 GCCCCGAGGTACCCGGGGAGGGG - Intronic
1020010051 7:4802484-4802506 GCCCCGAGGTACCTGGGGAGGGG - Intronic
1020010095 7:4802595-4802617 GCCCCGAGGTACCCGGGGAGGGG - Intronic
1020010129 7:4802670-4802692 GCCCCGAGGTACCCGGGGAGGGG - Intronic
1020010258 7:4802967-4802989 GCCCCGAGGTACCCGGGGAGGGG - Intronic
1020010292 7:4803042-4803064 GCCCCGAGGTACCCGGGGAGGGG - Intronic
1020010326 7:4803117-4803139 GCCCCGAGGTACCCGGGGAGGGG - Intronic
1020010360 7:4803192-4803214 GCCCCGAGGTACCCGGGGAGGGG - Intronic
1020010509 7:4803531-4803553 GCCCCGAGGTACCCGGGGAGGGG - Exonic
1021989567 7:26128985-26129007 GCCCCAGATCACCATGGGAGGGG + Intergenic
1025019413 7:55468776-55468798 GCCCCAGGGTACCACGGGACAGG + Intronic
1029205335 7:98866418-98866440 GCCCCCAGGGAACACGGGATGGG - Intronic
1035461178 7:159040201-159040223 GCTCCAGAGCACCACAGGAGGGG + Intronic
1035473800 7:159128457-159128479 GGCCCAAGGCAGGAGGGGAGTGG - Intronic
1035699534 8:1627383-1627405 GTCCCTGGGCACCACGGGAGGGG + Intronic
1037863041 8:22419771-22419793 TCCACAATGCACCACGGAAGAGG + Exonic
1039491005 8:37947473-37947495 GACCCAGGGGACCAGGGGAGAGG - Intergenic
1039491023 8:37947524-37947546 GACCCAGGGGACCAGGGGAGAGG - Intergenic
1039878398 8:41607233-41607255 GCCCCAAGTCACAAGGGCAGGGG - Intronic
1044867041 8:96581728-96581750 GACAGAAGGCAGCACGGGAGTGG + Intronic
1045516236 8:102863439-102863461 ACAGCAATGCACCACGGGAGAGG + Intronic
1049297977 8:141853645-141853667 GCACCCAGGCACCCAGGGAGAGG + Intergenic
1049297988 8:141853868-141853890 GCACCCAGGCACCCAGGGAGAGG + Intergenic
1049297999 8:141853936-141853958 GCACCCAGGCACCCAGGGAGAGG + Intergenic
1049551556 8:143262136-143262158 GCCCCAGGGCAAGACGGGCGTGG - Intronic
1049673033 8:143878132-143878154 GCCCCGAGCCCTCACGGGAGAGG - Intronic
1049716390 8:144095055-144095077 GCCCCAGGGGCCGACGGGAGTGG + Exonic
1057036838 9:91817435-91817457 ACCTCAAGGCACCAGGGAAGGGG + Intronic
1057602508 9:96471059-96471081 GTCCCAGGGCACCCCGGAAGAGG + Exonic
1060656334 9:125374964-125374986 GCCCCAAGGCTCCTCCAGAGAGG - Intergenic
1061674764 9:132209516-132209538 GCCCCAAAGCCACGCGGGAGCGG + Intronic
1062119115 9:134824593-134824615 CCCCCAGGGCCCCCCGGGAGAGG + Exonic
1062204732 9:135329690-135329712 GCCCCCACCCACCACAGGAGTGG + Intergenic
1062375986 9:136262153-136262175 GCCCCCAGCCACCCTGGGAGGGG + Intergenic
1191107574 X:56781036-56781058 GTCCCAAGGCACAAAAGGAGGGG - Intergenic
1196392250 X:115219929-115219951 TCACCAAGGCACCATGGCAGAGG + Intronic
1200057350 X:153468617-153468639 GCCCAAAGGCACCAGAGGACTGG + Intronic
1201149216 Y:11086328-11086350 GCCCCCAGGTACCACAGGACAGG - Intergenic