ID: 1165780830

View in Genome Browser
Species Human (GRCh38)
Location 19:38433533-38433555
Sequence GCCGTTGGCCGCCGGAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165780830_1165780846 18 Left 1165780830 19:38433533-38433555 CCCCACCTCCGGCGGCCAACGGC No data
Right 1165780846 19:38433574-38433596 AGATTTGGGGTATGTGGGCAGGG No data
1165780830_1165780837 3 Left 1165780830 19:38433533-38433555 CCCCACCTCCGGCGGCCAACGGC No data
Right 1165780837 19:38433559-38433581 GCAAACCTCCAGCCAAGATTTGG No data
1165780830_1165780842 12 Left 1165780830 19:38433533-38433555 CCCCACCTCCGGCGGCCAACGGC No data
Right 1165780842 19:38433568-38433590 CAGCCAAGATTTGGGGTATGTGG No data
1165780830_1165780845 17 Left 1165780830 19:38433533-38433555 CCCCACCTCCGGCGGCCAACGGC No data
Right 1165780845 19:38433573-38433595 AAGATTTGGGGTATGTGGGCAGG No data
1165780830_1165780838 4 Left 1165780830 19:38433533-38433555 CCCCACCTCCGGCGGCCAACGGC No data
Right 1165780838 19:38433560-38433582 CAAACCTCCAGCCAAGATTTGGG No data
1165780830_1165780848 30 Left 1165780830 19:38433533-38433555 CCCCACCTCCGGCGGCCAACGGC No data
Right 1165780848 19:38433586-38433608 TGTGGGCAGGGCTCCGGCGAAGG No data
1165780830_1165780839 5 Left 1165780830 19:38433533-38433555 CCCCACCTCCGGCGGCCAACGGC No data
Right 1165780839 19:38433561-38433583 AAACCTCCAGCCAAGATTTGGGG No data
1165780830_1165780847 24 Left 1165780830 19:38433533-38433555 CCCCACCTCCGGCGGCCAACGGC No data
Right 1165780847 19:38433580-38433602 GGGGTATGTGGGCAGGGCTCCGG No data
1165780830_1165780843 13 Left 1165780830 19:38433533-38433555 CCCCACCTCCGGCGGCCAACGGC No data
Right 1165780843 19:38433569-38433591 AGCCAAGATTTGGGGTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165780830 Original CRISPR GCCGTTGGCCGCCGGAGGTG GGG (reversed) Intergenic
No off target data available for this crispr