ID: 1165782789

View in Genome Browser
Species Human (GRCh38)
Location 19:38443640-38443662
Sequence CAACCTCGGTGGGCGTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165782781_1165782789 6 Left 1165782781 19:38443611-38443633 CCGGCATGCACACAGCCGCATGG 0: 1
1: 0
2: 1
3: 13
4: 278
Right 1165782789 19:38443640-38443662 CAACCTCGGTGGGCGTGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 101
1165782778_1165782789 21 Left 1165782778 19:38443596-38443618 CCATGCCATCCTGCTCCGGCATG 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1165782789 19:38443640-38443662 CAACCTCGGTGGGCGTGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 101
1165782780_1165782789 12 Left 1165782780 19:38443605-38443627 CCTGCTCCGGCATGCACACAGCC 0: 1
1: 0
2: 1
3: 15
4: 204
Right 1165782789 19:38443640-38443662 CAACCTCGGTGGGCGTGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 101
1165782779_1165782789 16 Left 1165782779 19:38443601-38443623 CCATCCTGCTCCGGCATGCACAC 0: 1
1: 0
2: 2
3: 11
4: 175
Right 1165782789 19:38443640-38443662 CAACCTCGGTGGGCGTGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 101
1165782783_1165782789 -9 Left 1165782783 19:38443626-38443648 CCGCATGGTGAGTGCAACCTCGG 0: 1
1: 0
2: 1
3: 17
4: 320
Right 1165782789 19:38443640-38443662 CAACCTCGGTGGGCGTGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 101
1165782776_1165782789 30 Left 1165782776 19:38443587-38443609 CCTGTATGGCCATGCCATCCTGC 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1165782789 19:38443640-38443662 CAACCTCGGTGGGCGTGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165782789 Original CRISPR CAACCTCGGTGGGCGTGGGC AGG Intronic
900230276 1:1553478-1553500 AAAACTAGGTGGGCGTGGCCAGG + Intronic
900639292 1:3681209-3681231 CACCCCCGCTGGCCGTGGGCAGG + Intronic
901034788 1:6329899-6329921 GAACCTCGGTGGGCCTGTGATGG - Intronic
902379860 1:16047886-16047908 GAACCTTGGCGGGGGTGGGCAGG - Exonic
903681852 1:25102737-25102759 AAACCTCTGTGGGGGTGGGAGGG - Intergenic
915529445 1:156494854-156494876 CAACCTGGATGGGAGTGGGAGGG + Intronic
918188531 1:182149082-182149104 CAACCTGGCTGTGCGTGGGAAGG - Intergenic
922324283 1:224513839-224513861 CAACCACGGAGGGCCTGGGAGGG - Intronic
923459639 1:234197204-234197226 CAGCCTCAGTGGGAGTGGGTAGG - Intronic
1064229607 10:13518347-13518369 CAACTTCGGTGGCTGTGTGCAGG + Intronic
1067040671 10:42951734-42951756 CAGCCTGGGTGGGCCTGGCCTGG - Intergenic
1070593711 10:77818188-77818210 CAACCTGGGTGGGCCTGGGGAGG + Intronic
1070966987 10:80535974-80535996 CAACCTGGGTGTGCCTGGCCTGG - Intergenic
1076454301 10:130578740-130578762 CTGCCTCTGTGGGCCTGGGCAGG + Intergenic
1082997200 11:59263679-59263701 CCACCTCAGTGGGCGAGGCCAGG + Intergenic
1083748109 11:64746143-64746165 CAGCCTCGCTGGCCGGGGGCGGG - Intergenic
1084303290 11:68265094-68265116 AAAGCTGGGTGGGGGTGGGCAGG + Intronic
1084567482 11:69939715-69939737 CAGCCTGGGGCGGCGTGGGCTGG - Intergenic
1084665846 11:70575808-70575830 CAAACTTGGGGGGCGTGGGCTGG + Intronic
1090226855 11:125076898-125076920 CAACCTCGGTGGCCATGGGAAGG - Intronic
1090748095 11:129723322-129723344 CCACCTGTGTGGGCCTGGGCAGG - Intergenic
1092123032 12:6057742-6057764 CCACCGCGGAGGGCGGGGGCGGG - Intronic
1096464570 12:51841150-51841172 CCACCTGGGTGTGAGTGGGCAGG + Intergenic
1097182746 12:57180400-57180422 CAACCTGGATGGGAGTGGGCTGG + Exonic
1102277888 12:111597901-111597923 GAACATCGGTGGGTGAGGGCTGG - Intronic
1104978969 12:132564483-132564505 AAACCTTGGAGGGCGAGGGCAGG - Intronic
1106508399 13:30391856-30391878 CAACTTAGGTGGGAGTGGGGAGG + Intergenic
1110817950 13:79882337-79882359 CCTCCTCGCAGGGCGTGGGCTGG + Intergenic
1113808927 13:113125940-113125962 CAACGTCAGAGGGCGTGGTCAGG + Intronic
1117978931 14:61322622-61322644 CGACCGCGGTGGGTGTGTGCAGG + Intronic
1118159743 14:63276201-63276223 CAGCTTCGGTGGGGGGGGGCGGG + Intronic
1119326019 14:73759923-73759945 CAGCCTCGGGAGGCGCGGGCTGG - Exonic
1122263524 14:100536314-100536336 CAACCACGGAGGGTGTGGGGAGG + Intergenic
1122419637 14:101567253-101567275 CCACCCCGATGGGGGTGGGCAGG + Intergenic
1122799365 14:104221993-104222015 CAGCCCTGGTGGGTGTGGGCTGG + Intergenic
1123006868 14:105327988-105328010 AAACCTCGGGTGGCCTGGGCCGG - Intronic
1123809799 15:23912416-23912438 CGGCATCGGTGGGCGTGGTCTGG - Intergenic
1132697976 16:1210351-1210373 GAACCTGGGTGGGCGGGGGCGGG - Exonic
1136996529 16:35194700-35194722 CATCCTCGGTGGGCATGGCCTGG - Intergenic
1139429525 16:66903763-66903785 CAGCCTCTGGGGGCCTGGGCGGG - Intergenic
1140872764 16:79122117-79122139 CCACCTCGGAGCGCGTGGGCCGG + Intronic
1142359960 16:89621290-89621312 CAACCGTGGGGGGCCTGGGCAGG + Intronic
1143576455 17:7796598-7796620 GCATCTTGGTGGGCGTGGGCAGG - Exonic
1146661252 17:34666421-34666443 CCTGCTCGGTGGGCCTGGGCGGG + Intergenic
1147446813 17:40479723-40479745 GGACCACGGTGGGCGTGGGGAGG + Exonic
1147636443 17:41967143-41967165 GAGCCTGGGTGGGCCTGGGCCGG + Intronic
1149637022 17:58179159-58179181 CAACCTGGCTGGGTGTTGGCAGG - Intergenic
1151977743 17:77492014-77492036 CTGCCTCGGTGGGTGTGGGTGGG + Intronic
1152379990 17:79937399-79937421 GAAGCTCGGCGGGGGTGGGCAGG - Exonic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1155954210 18:31943289-31943311 CAAGTGCGGTGGGCGGGGGCGGG + Intronic
1157466980 18:47955822-47955844 CTGCATCGGTGGGCGTGGGATGG - Intergenic
1160445791 18:78925947-78925969 CAACCCCGATGTGCGTGGGCTGG + Intergenic
1160532992 18:79576501-79576523 CTACCTCCGTGGGCCTTGGCCGG + Intergenic
1161397561 19:4052584-4052606 CAGCCTCGGTGGGCGTGGCTGGG + Intronic
1163255495 19:16153499-16153521 AAGGCTCGGTGGGCGTGGCCTGG + Intronic
1163255528 19:16153666-16153688 GAAGCTCGGTGGGCGTGGCCTGG + Intronic
1164794219 19:31013567-31013589 CCTCCTCAGTGGGCCTGGGCGGG - Intergenic
1165782789 19:38443640-38443662 CAACCTCGGTGGGCGTGGGCAGG + Intronic
1166898009 19:46036198-46036220 GATCCTCGCTGGGCCTGGGCTGG - Intergenic
1167526739 19:49988929-49988951 CAGCCTCAGTGGGGGAGGGCGGG + Intronic
1167578800 19:50330360-50330382 CAACCAGGGTAGGCGAGGGCAGG + Intronic
930318624 2:49827466-49827488 TAAGCTCGCTGGGCGTGGGGAGG - Intergenic
935590547 2:104843239-104843261 CTTCCTCGGTGGGCGAAGGCGGG - Intergenic
937227031 2:120375905-120375927 CAACCGAGGTGGGGTTGGGCAGG - Intergenic
937318528 2:120947233-120947255 CAACCCAGGTGGGGCTGGGCTGG - Intronic
937860690 2:126706653-126706675 CCACCCCCTTGGGCGTGGGCTGG - Intergenic
937932636 2:127218909-127218931 CAACGGAGGTGGGCGTGGGAAGG + Intronic
948742944 2:240060155-240060177 CTCCCTGGGTGGGCGTGGGAAGG - Intergenic
1171567638 20:26209221-26209243 CGATCGCGGTGGGCTTGGGCTGG - Intergenic
1171908648 20:30921568-30921590 CGATCGCGGTGGGCTTGGGCAGG + Intergenic
1175199013 20:57265690-57265712 CAACCTCGGTGAGTAAGGGCAGG - Exonic
1177710296 21:24765007-24765029 ATACCTCAGTGGTCGTGGGCTGG + Intergenic
1179457306 21:41508243-41508265 CACCCTGGGCGGGCGGGGGCGGG + Intronic
1180171388 21:46060526-46060548 CAGCCTTGGTGGCCCTGGGCAGG + Intergenic
1180342082 22:11627753-11627775 CTATCGCGGTGGGCTTGGGCAGG + Intergenic
1183600246 22:38835758-38835780 CAGCCTCTGTGGCTGTGGGCAGG + Intronic
1185285240 22:49997071-49997093 CACCCTGGGTGGGGGAGGGCAGG + Exonic
1185396003 22:50588955-50588977 CAACCTGAGTGTGCGTCGGCAGG + Intronic
949559378 3:5187969-5187991 CCACCTCGGGGCCCGTGGGCCGG + Exonic
952942423 3:38454499-38454521 TCACCTCCGGGGGCGTGGGCTGG + Intronic
953406609 3:42662952-42662974 CAACGTCGGGGTGCTTGGGCAGG + Intronic
954415034 3:50389141-50389163 CAGCCCCGGTGGGCCTGGGGCGG + Intronic
954623200 3:52007288-52007310 AAACCTGGGTGGGGGTGGGAGGG - Intergenic
954793991 3:53152188-53152210 CAACCTGTGTGGCCTTGGGCCGG + Intergenic
960944777 3:122958455-122958477 CATACTCGGTGGCCCTGGGCAGG - Intronic
965984717 3:174736959-174736981 CAACCTGGCTGGGTGTGCGCAGG - Intronic
967182848 3:186921615-186921637 CCACCTCAGTGGGCCTGAGCTGG + Intergenic
976769407 4:88634699-88634721 CAACCCCTGTTGGCGGGGGCGGG - Intronic
983203687 4:164889158-164889180 TAACCTCGGTGAGGGTGGGGTGG + Intronic
985920338 5:2966559-2966581 CACCCTGGGTGGGGCTGGGCTGG - Intergenic
992080809 5:73233407-73233429 CCACCTCGTTCGGCGTGGGGCGG - Intergenic
997453871 5:134004113-134004135 CAGCTTCTGCGGGCGTGGGCCGG + Intronic
997817762 5:137034953-137034975 CAGCCTTGGTGGGGGTGGGAGGG + Intronic
1002600714 5:180352864-180352886 CGACCTCGGTCGGCATGGGGTGG + Intronic
1006456256 6:34133563-34133585 CGGCCTGGGTGGGCATGGGCAGG + Exonic
1010083104 6:71886726-71886748 CAGCCTCGGCCGGCGGGGGCGGG - Intronic
1018903800 6:168063861-168063883 CAACCTCGGTGGGCAGGGCCAGG + Intronic
1018920041 6:168166110-168166132 CAGCCTGGGTGGCTGTGGGCAGG + Intergenic
1019368387 7:647162-647184 CAACCCCGGAGGAGGTGGGCAGG - Intronic
1034224281 7:149470848-149470870 CATCCTGGGTGGGGGGGGGCGGG - Intergenic
1035020307 7:155796912-155796934 CAGCCTCGGGGGGCTGGGGCCGG - Intergenic
1035916293 8:3628330-3628352 CACCCTCGGCCGGTGTGGGCAGG - Intronic
1038319479 8:26514101-26514123 TAGCCGCGGGGGGCGTGGGCAGG + Intergenic
1039360922 8:36876123-36876145 GGACCTCGGTGGCTGTGGGCAGG - Intronic
1048858062 8:138700668-138700690 CAGCCTAGGTGGGGGTGGCCAGG - Intronic
1049258931 8:141628417-141628439 CAATCTCTGTGGGCTTGGCCTGG + Intergenic
1049961932 9:745203-745225 GAACCTCGGTGGGTGGGGCCAGG - Exonic
1055583481 9:77732370-77732392 CCATCTCGGTGGGGGTGGGCAGG - Intronic
1061683912 9:132259348-132259370 CGCCCCCGGTGGCCGTGGGCGGG - Intergenic
1189234280 X:39475702-39475724 AACCCTCGGTGGGGGTGGGGTGG + Intergenic
1189377071 X:40474563-40474585 CCACCTCGCTGGGGGTAGGCCGG - Intergenic
1192657315 X:73004453-73004475 CGCCCTTGGTGGGGGTGGGCGGG - Exonic
1192664805 X:73078554-73078576 CGCCCTTGGTGGGGGTGGGCGGG + Exonic
1194394461 X:93364191-93364213 CAAGCTCGTTGTGCCTGGGCAGG + Intergenic