ID: 1165787619

View in Genome Browser
Species Human (GRCh38)
Location 19:38471553-38471575
Sequence AACCAGATTTATAAGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165787615_1165787619 28 Left 1165787615 19:38471502-38471524 CCCAGGTGACAGAGCAAGACCTG 0: 6
1: 189
2: 2098
3: 12670
4: 51864
Right 1165787619 19:38471553-38471575 AACCAGATTTATAAGACAGAGGG 0: 1
1: 0
2: 0
3: 28
4: 299
1165787616_1165787619 27 Left 1165787616 19:38471503-38471525 CCAGGTGACAGAGCAAGACCTGT 0: 2
1: 12
2: 115
3: 707
4: 4695
Right 1165787619 19:38471553-38471575 AACCAGATTTATAAGACAGAGGG 0: 1
1: 0
2: 0
3: 28
4: 299
1165787617_1165787619 9 Left 1165787617 19:38471521-38471543 CCTGTCTCTAAGAAAAAAAGAGT 0: 1
1: 4
2: 90
3: 1026
4: 8554
Right 1165787619 19:38471553-38471575 AACCAGATTTATAAGACAGAGGG 0: 1
1: 0
2: 0
3: 28
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165787619 Original CRISPR AACCAGATTTATAAGACAGA GGG Intronic
900430649 1:2601322-2601344 CACCTGATTTATAACACAGAAGG + Intronic
901427752 1:9193450-9193472 AAGCACATTTATTACACAGAAGG + Intergenic
901504787 1:9677743-9677765 AAACACATTTATAAAACATATGG - Intronic
903243519 1:21999637-21999659 AACCACTTTTATTTGACAGAAGG - Intergenic
903395092 1:22994909-22994931 AACCACATTCATGAGACACAGGG + Intergenic
903773798 1:25780442-25780464 AAGCAGTTTTCTAAGACAAAGGG + Intronic
905571805 1:39012205-39012227 TACTAGCGTTATAAGACAGAAGG - Intergenic
907696364 1:56733974-56733996 AAACAGATCAATGAGACAGAAGG - Intronic
908336592 1:63131657-63131679 CACCAGATTTTGAAGACAGCTGG + Intergenic
910620267 1:89245710-89245732 AAACAGATCAATGAGACAGAAGG + Intergenic
911598057 1:99819004-99819026 AAACACATTTGTAAGTCAGATGG - Intergenic
913478433 1:119261316-119261338 AAGCATATTTACAAGACAGCTGG + Intergenic
914960615 1:152203317-152203339 AACCAGATTTCTAAGAGCAAGGG - Intergenic
915289724 1:154875334-154875356 AAAAAGATTTATTAGACAGATGG + Intergenic
919053373 1:192538864-192538886 AACCAGATACTCAAGACAGATGG + Intergenic
919159841 1:193814680-193814702 AAGCAGAATAAAAAGACAGATGG - Intergenic
919205289 1:194414509-194414531 TACCAGAATTATGAGACAAATGG + Intergenic
922619452 1:226981067-226981089 AACTAGATTCACAGGACAGAAGG + Intronic
923333978 1:232950916-232950938 AACGTGATTTAAAAGACACAGGG + Intronic
923584449 1:235254520-235254542 AAATAGATTTATAACACTGATGG + Intronic
923697271 1:236265711-236265733 CACCAGATTTAAAAAACAGTAGG - Intronic
923840128 1:237661673-237661695 ATCCAGATTTAGAAGGCACAAGG + Intronic
924444288 1:244114824-244114846 AAACAGATTTTTAAGACATTTGG - Intergenic
924649817 1:245915749-245915771 AACCAAAAATATAAGAGAGAAGG + Intronic
1063155429 10:3375083-3375105 AACCAGAATTTTAACACAGAGGG + Intergenic
1063803947 10:9615816-9615838 AACGAGATTTCTGAGAAAGAAGG - Intergenic
1064107027 10:12508881-12508903 AACCACATTCATAAGCCACAAGG + Intronic
1064492632 10:15876078-15876100 AGACAGATTAACAAGACAGAAGG - Intergenic
1067299856 10:44998356-44998378 AACCAGGATGATAAGACACATGG - Exonic
1067897828 10:50203474-50203496 AACCAGACTTAAAAAACATAAGG - Intronic
1068800049 10:61130412-61130434 AACCAAATTTATTAGAAAGAAGG - Intergenic
1069019281 10:63467147-63467169 AACCAAAATTATAAGGAAGATGG + Intergenic
1071741731 10:88366297-88366319 AATGAGAATTTTAAGACAGAAGG - Intronic
1073722842 10:106193632-106193654 AGCAAGGTTTATATGACAGAAGG + Intergenic
1074010577 10:109474828-109474850 AAGCAGTTTTATAAACCAGAGGG + Intergenic
1075018551 10:118929408-118929430 AACTAAATTTAAAAGACAGTTGG + Intergenic
1077831290 11:5874055-5874077 AATCAGATATACAACACAGAAGG - Intronic
1078277085 11:9859708-9859730 TACCAGATATATAAGACATCTGG + Intronic
1078482863 11:11694124-11694146 AAACAGATCAACAAGACAGAAGG + Intergenic
1078642764 11:13111706-13111728 AACTAGATTTACATGACAGAAGG - Intergenic
1078994284 11:16681039-16681061 AGACAGATTAACAAGACAGAAGG + Intronic
1079124126 11:17706880-17706902 AACAAAATTTATGAGACAAATGG + Intergenic
1079439965 11:20502654-20502676 AACCAGATTTATAAGCACTATGG + Intronic
1079750136 11:24186238-24186260 AAGCAGGTTTATAAGACCAAAGG - Intergenic
1079793656 11:24771259-24771281 AACCAGCTTTAGTAGACAGTAGG + Intronic
1081308973 11:41547345-41547367 ATACAGATTAATGAGACAGAAGG + Intergenic
1081837649 11:46169999-46170021 AACCTGATTTATGACAAAGATGG + Intergenic
1082183656 11:49151828-49151850 AACCAGTTTTATAGGATACATGG + Intronic
1082219416 11:49615952-49615974 AATCATATTTAGAAGATAGAAGG - Intergenic
1085134695 11:74075555-74075577 AATGAGATTTATAAAACAGAAGG + Intronic
1085370912 11:76004374-76004396 AACCGCATGTAGAAGACAGAAGG - Intronic
1085586722 11:77715296-77715318 AACATGATGTAAAAGACAGATGG + Intronic
1085857320 11:80189812-80189834 AACCAGATCTAGCACACAGATGG + Intergenic
1085927196 11:81036444-81036466 AACAGGATTAATAGGACAGATGG + Intergenic
1086493010 11:87374686-87374708 AATCAGATTTATGAGACATCGGG - Intergenic
1086875095 11:92086291-92086313 AACCAGAATTCAAAGACAGATGG + Intergenic
1087355067 11:97082609-97082631 AATCACCTTTATAAGAAAGAAGG + Intergenic
1087464195 11:98484757-98484779 AAACAGAATAAAAAGACAGAGGG - Intergenic
1087733105 11:101800545-101800567 ACCCAGTATTAGAAGACAGAGGG - Intronic
1088033949 11:105288985-105289007 ATCCAGATTAGAAAGACAGAAGG + Intergenic
1089248534 11:117139873-117139895 AAACAGATCAACAAGACAGAAGG + Intergenic
1092017523 12:5171598-5171620 AAAGGGATTTATCAGACAGAGGG + Intergenic
1093510232 12:19917970-19917992 AACCAGATTTATCACACTTAGGG - Intergenic
1093761014 12:22910879-22910901 AACCAGTTTAACAAGACAGAAGG + Intergenic
1095597771 12:43978883-43978905 AACAAGATTAATAGGACAGATGG - Intronic
1095760555 12:45830192-45830214 AACCAATATTATAAAACAGAAGG - Intronic
1099128234 12:78793736-78793758 AATCAGATTTAGAAGATAAAAGG - Intergenic
1099314513 12:81067157-81067179 AAACAGATCAACAAGACAGAAGG + Intronic
1099544462 12:83960592-83960614 AATCACATTTATAAGACTGGAGG + Intergenic
1099809927 12:87567982-87568004 AACCACCTTTGTAAGACAAATGG - Intergenic
1100403068 12:94249204-94249226 AACCCCATTTATCATACAGATGG - Intronic
1102794647 12:115678191-115678213 AAACAAATTTAAAAGCCAGATGG + Intergenic
1105816409 13:24040284-24040306 AACCAGGTTTGTGAGACACACGG - Intronic
1106085030 13:26534219-26534241 AACCAGGTTGATAAGGCATATGG + Intergenic
1106090337 13:26586705-26586727 CTCCAGATTTATAATACAGATGG - Intronic
1106121968 13:26867511-26867533 AAAGAGATTTATAGTACAGAGGG - Intergenic
1108205185 13:48081467-48081489 AACCAAATTTATAAAACCCATGG + Intronic
1108285452 13:48903092-48903114 AATCATAGTTATAGGACAGAAGG + Intergenic
1108813192 13:54255666-54255688 AAACAGATTCATAAAACAAAAGG - Intergenic
1109112925 13:58346197-58346219 AACCTCTTTTAAAAGACAGATGG - Intergenic
1110059989 13:71028890-71028912 AACAGGATTAATAGGACAGATGG - Intergenic
1110076537 13:71251830-71251852 AAACAGAATTATAAGACAAGGGG - Intergenic
1110503049 13:76251194-76251216 AATCAGAGTTAAAAGACAAATGG - Intergenic
1111265516 13:85807339-85807361 AAACAAATTTAGAAGCCAGAGGG - Intergenic
1111371597 13:87326263-87326285 AAACTGATTTATTAGACAGCAGG + Intergenic
1112741515 13:102478768-102478790 TACCAAGTTTATTAGACAGAAGG - Intergenic
1113043458 13:106128699-106128721 AAGCAGATTTATGTCACAGATGG - Intergenic
1114573497 14:23692494-23692516 AGTCAGATTTATAAGGCAGTGGG - Intergenic
1115142234 14:30185294-30185316 AACCAAATTTGCAAGAAAGAAGG - Intronic
1116273991 14:42806801-42806823 AACAGGATTAATAGGACAGAAGG + Intergenic
1116284306 14:42952264-42952286 AAACTGATTTATAATTCAGAAGG + Intergenic
1116653519 14:47624150-47624172 AAAAAGATTTATCAGACAAAAGG - Intronic
1117214635 14:53537853-53537875 AACCAGATGTCTAAGAAATAAGG - Intergenic
1117364717 14:55014808-55014830 AAAAAGATTCATAAGAAAGATGG + Intronic
1117544756 14:56783588-56783610 AACCAGATCTATAACACACATGG - Intergenic
1119693346 14:76693895-76693917 AAACAGAATTAAAAGACAAATGG - Intergenic
1120481010 14:85049272-85049294 AATGAGATTTAAAAGACTGATGG - Intergenic
1123468342 15:20532226-20532248 AACATGTTTTAAAAGACAGATGG + Exonic
1123649773 15:22468837-22468859 AACATGTTTTAAAAGACAGATGG - Exonic
1123728659 15:23127436-23127458 AACATGTTTTAAAAGACAGATGG + Intergenic
1123740175 15:23277657-23277679 AACATGTTTTAAAAGACAGATGG - Intergenic
1123746823 15:23324901-23324923 AACATGTTTTAAAAGACAGATGG + Intergenic
1124015971 15:25876124-25876146 TATTAGATGTATAAGACAGATGG + Intergenic
1124279090 15:28348217-28348239 AACATGTTTTAAAAGACAGATGG + Intergenic
1124303608 15:28563391-28563413 AACATGTTTTAAAAGACAGATGG - Intergenic
1126338009 15:47607656-47607678 TGCAAGATTTATAAAACAGAGGG - Intronic
1126542984 15:49842364-49842386 AACAGGATTAATAGGACAGATGG + Intergenic
1127570856 15:60239739-60239761 AAACAGATAAATGAGACAGAAGG + Intergenic
1128915733 15:71560628-71560650 AACTATATTTATAACACAAATGG - Intronic
1128961392 15:72008990-72009012 AATTAGATTTATAAGTTAGATGG - Intronic
1129588210 15:76889751-76889773 AGACAGATTAATGAGACAGAAGG + Intronic
1130129953 15:81132428-81132450 GACCTGATTTATAAGAAATATGG + Intronic
1131096850 15:89661145-89661167 ATTCAGTTTTAAAAGACAGAAGG - Intergenic
1132364360 15:101245983-101246005 ATTCAGATTTATAAGATAGGAGG + Intronic
1133404882 16:5515457-5515479 AAGGAGATTAATAAGATAGAAGG - Intergenic
1135301532 16:21332583-21332605 AGACAGATTAACAAGACAGAAGG - Intergenic
1138295307 16:55880295-55880317 GACCAGAATTACAGGACAGATGG + Intronic
1138763411 16:59570940-59570962 AACCCTAATTATAAGAAAGAGGG - Intergenic
1140165686 16:72548322-72548344 AAACAGATATATAAGACCAATGG + Intergenic
1141709972 16:85692668-85692690 AACCAGAGTCAACAGACAGAAGG + Intronic
1144738451 17:17567950-17567972 AGCCAGATTTCTGAGCCAGATGG + Intronic
1146129911 17:30263197-30263219 AGCCAGAATTATAACCCAGATGG - Intronic
1147041192 17:37720588-37720610 TACCAAATTTATAAAACAGGGGG + Intronic
1148950568 17:51307529-51307551 AAACAGATCAATGAGACAGAAGG + Intergenic
1149586908 17:57795810-57795832 CACCTGATTTATAACAAAGATGG + Intergenic
1150170522 17:62989044-62989066 AAGGAAATTTATAAGAGAGAGGG - Intergenic
1150350624 17:64441735-64441757 TACCATATTGATAAGACTGACGG - Intergenic
1151313468 17:73308467-73308489 AACCAGAATGAGAACACAGAAGG + Intronic
1151781859 17:76251993-76252015 AAGGAGATTGATAATACAGAGGG - Intergenic
1152979259 18:259177-259199 TACCTGATTTCTCAGACAGAGGG + Exonic
1153189428 18:2521542-2521564 AAACATATTGATAGGACAGATGG - Intergenic
1153951359 18:10060420-10060442 AAACAGAATTATAACAAAGAGGG - Intergenic
1155178970 18:23326632-23326654 AAACAGATCAACAAGACAGAAGG + Intronic
1155639626 18:27998171-27998193 GACCACATTTATAAGGTAGATGG - Intronic
1156412537 18:36846239-36846261 AACCAGATTGAAAATTCAGAGGG - Intronic
1159106970 18:64013862-64013884 AAGCAGAGTTATGAAACAGAAGG + Intergenic
1160114974 18:76069984-76070006 AGCCAGAGTTAGAAGACACAAGG - Intergenic
1161912309 19:7203756-7203778 AAACAGAATCATAAGTCAGAAGG + Intronic
1163967438 19:20760518-20760540 ACCCAGACTTCTATGACAGAGGG - Intronic
1164056360 19:21625256-21625278 AACAGGATTAATAGGACAGATGG + Intergenic
1164293110 19:23885192-23885214 AACAGGATTAATAAGACAGATGG - Intergenic
1165085875 19:33346947-33346969 AAACAGATTTTCCAGACAGAGGG + Intergenic
1165787619 19:38471553-38471575 AACCAGATTTATAAGACAGAGGG + Intronic
925242402 2:2343222-2343244 AACCAGATCTAAGTGACAGAGGG + Intergenic
927610524 2:24535010-24535032 AGACAGATCAATAAGACAGAAGG - Intronic
928223779 2:29429288-29429310 AACCAGACTGAAAAGAAAGAAGG + Intronic
928417668 2:31109932-31109954 AACAATATTTATAAAATAGAAGG + Intronic
930072548 2:47379263-47379285 AATAAGAATTATAAGAAAGAGGG - Intronic
931619523 2:64195791-64195813 AACCAGATTTTTAAAAGAGCTGG - Intergenic
933225825 2:79748327-79748349 AAACAGATTTCTATGATAGAAGG - Intronic
933625062 2:84588972-84588994 ACACACATTTCTAAGACAGATGG - Intronic
935870304 2:107441027-107441049 AACCACAGTTACAAGACAGAAGG + Intergenic
935995227 2:108763990-108764012 AACAAGAATCATGAGACAGATGG + Exonic
937753852 2:125512398-125512420 ACCCAGACTTGTAAGACAAATGG - Intergenic
938155527 2:128936423-128936445 AAACAAATTATTAAGACAGAAGG - Intergenic
939338062 2:140856639-140856661 AACTTTATTTACAAGACAGAGGG + Intronic
939438610 2:142211741-142211763 AAGAAGTTTTATAAGACAAAGGG + Intergenic
939857755 2:147381050-147381072 GACCAGATTTCCAGGACAGAGGG + Intergenic
940827559 2:158429973-158429995 AAGCAGAGTTATAAAAAAGAGGG + Intronic
940840155 2:158570425-158570447 GACTAGATTTTTAAGATAGAGGG - Intronic
940879367 2:158931062-158931084 AACCAGATTGGTCAGTCAGATGG + Intergenic
944577785 2:201106280-201106302 GACCACATCTATAAGCCAGAAGG + Intergenic
945016657 2:205525628-205525650 AATCATATTTATAATACAGTAGG + Intronic
946660927 2:221998590-221998612 AACGGGATTTATAGGATAGAAGG + Intergenic
1169611319 20:7383105-7383127 AACCAAAATGATAAAACAGAGGG - Intergenic
1169734140 20:8819225-8819247 AACTTGATTTATGAGAGAGATGG + Intronic
1169876156 20:10299232-10299254 AGCAAGTTTTAGAAGACAGAGGG - Intronic
1170366551 20:15604303-15604325 AACCAGGGTTAAAAGCCAGAGGG - Intronic
1170687316 20:18581158-18581180 GACTGGATTTATAAGAAAGAAGG - Intronic
1171443286 20:25184391-25184413 AGACAGATTAACAAGACAGAAGG - Intergenic
1172590095 20:36111840-36111862 AACCATATTTATTTCACAGATGG + Intronic
1173060320 20:39654175-39654197 AAACAGATTTATAATATGGAAGG - Intergenic
1174020914 20:47527929-47527951 AACCTGATTTTCAAAACAGAAGG - Intronic
1175323356 20:58105249-58105271 AACCATGTTTAAAAGAGAGAGGG + Intergenic
1175558591 20:59895860-59895882 AACAAGATTTTTAGAACAGAAGG + Intronic
1177006289 21:15676223-15676245 ACCCAGATTTGTAAGAGGGAAGG - Intergenic
1177303787 21:19286089-19286111 AACCAGATATATGACACAGGTGG + Intergenic
1177564933 21:22808222-22808244 AACCAGGTTTAATAGACATACGG - Intergenic
1178233870 21:30819737-30819759 AAGCAGATTTCTAAGAGGGAAGG + Intergenic
1178565917 21:33684649-33684671 AACCTGATTTAAAAGAATGACGG - Intronic
1179677613 21:42994482-42994504 AACCAGTTTTGTTAGAGAGAAGG + Intronic
1179828818 21:43983315-43983337 AACCACCTTTAAAAAACAGAGGG - Exonic
1180862168 22:19089882-19089904 AACCTGATTTTAAAAACAGATGG - Intronic
1183121795 22:35735735-35735757 AACAAGATTTAAAAGAGAGCTGG + Intergenic
949509483 3:4755671-4755693 GACCAGATTAATAAGAGTGAAGG + Intronic
950724738 3:14909421-14909443 AACCATATTCATAAAAAAGAAGG + Intronic
950940732 3:16888259-16888281 CACCACATTTACAAAACAGATGG - Intronic
953330550 3:42049577-42049599 ATCCAGATTGAGAAAACAGAGGG - Intronic
953338701 3:42115936-42115958 ACCCAGATCTAAAAGACAGAAGG - Intronic
953506426 3:43490196-43490218 AACTGGATTTATCAGAAAGAGGG - Intronic
953842205 3:46397787-46397809 AGGAAGATTTATAAGACAGTGGG + Intergenic
957181611 3:76886134-76886156 AACCAGAGTAAAGAGACAGAGGG - Intronic
957642964 3:82882797-82882819 AATCAGATTTAAAAATCAGAAGG - Intergenic
957670771 3:83299578-83299600 AACCTAATGTATAAGACAAAGGG + Intergenic
959075360 3:101743701-101743723 AACCAGAATTAAAAGACTGATGG + Intronic
959424622 3:106171133-106171155 AACCAGAGTTAGAAGATTGAAGG + Intergenic
959648949 3:108733203-108733225 AACCATTTTTAGAAGACAAAAGG - Intergenic
960857139 3:122113725-122113747 AACCAGATTTATAAAGCATCTGG + Intronic
961062275 3:123840159-123840181 AACCAAATTTCTCAGAAAGAAGG + Intronic
961421926 3:126812968-126812990 AATCAGGTTTATAATACATAAGG - Intronic
963613409 3:147502579-147502601 AACTAGATTGTTTAGACAGAAGG + Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
963842826 3:150125242-150125264 AACAATATTTATACCACAGAGGG - Intergenic
965051235 3:163651055-163651077 GATCAGATTTATTAGACAAATGG - Intergenic
965095475 3:164219523-164219545 AACAGGATTAATAGGACAGATGG - Intergenic
965163613 3:165167355-165167377 AGACAGATCAATAAGACAGAAGG - Intergenic
965847170 3:172977085-172977107 AAACAAATGTATAGGACAGAAGG + Intronic
966618840 3:181942013-181942035 AAACAGATTTTTACAACAGAGGG - Intergenic
967327752 3:188259042-188259064 CACCAGATTTTCAACACAGAAGG + Intronic
967506968 3:190263465-190263487 AACCAGTTTTACAAGAGCGAGGG - Intergenic
970665402 4:18330801-18330823 AAACAGAATTTTAAAACAGATGG + Intergenic
970930168 4:21501830-21501852 AACCAGATATATAAAAAAGGAGG - Intronic
973732470 4:53835924-53835946 AGACAGATTAATGAGACAGAAGG + Intronic
973875008 4:55208749-55208771 AAACAGATCAATAAGACAGAAGG + Intergenic
974348074 4:60707924-60707946 AAACAGATTTATCAAACATATGG + Intergenic
975044376 4:69783543-69783565 AACCAGATTGGTGGGACAGAGGG + Intronic
975555122 4:75655385-75655407 AAAAAGAGCTATAAGACAGAAGG + Intronic
976640068 4:87328706-87328728 AAACAGACTTAAAAGAAAGAAGG + Intergenic
977610707 4:99027208-99027230 AACCAGATTAATAGGAGAAATGG + Intronic
978905903 4:114005111-114005133 AACCAGAGATATAAGATATAAGG - Intergenic
978999913 4:115203654-115203676 AATCATATTTATTAAACAGAGGG - Intergenic
979834460 4:125346058-125346080 AATCAGAGTTAAAAGACACAAGG - Intronic
980776544 4:137444470-137444492 AACATTATTTATAAGACAGGTGG - Intergenic
981796057 4:148596836-148596858 AGACAGATTAACAAGACAGAAGG - Intergenic
981962980 4:150564180-150564202 AAACAGATATATAAGACCAATGG + Intronic
981972943 4:150688097-150688119 AAACAGATATATAAAACAAATGG + Intronic
983651073 4:170037289-170037311 AACCATATTCATAAGATAAAAGG - Intergenic
983754210 4:171313714-171313736 AGACAGATTAATGAGACAGAAGG - Intergenic
983931333 4:173455996-173456018 AAACAGATTTATAACAGAGAGGG + Intergenic
984154698 4:176180958-176180980 CACAAGATTTATAATATAGATGG + Intronic
986012510 5:3728769-3728791 AACCAGTTTAATAAAACACAAGG + Intergenic
986764490 5:10912322-10912344 AATCATAGTTATAAGAAAGAAGG - Intergenic
987944874 5:24593159-24593181 AATCAGATTTATAAAAATGATGG + Intronic
988070468 5:26281957-26281979 AACAGGAAGTATAAGACAGAAGG + Intergenic
988249553 5:28738501-28738523 TACCATATTTAAAATACAGAAGG + Intergenic
989349680 5:40472298-40472320 AGACAGATCAATAAGACAGAAGG - Intergenic
991413497 5:66368259-66368281 AAACAGATTCATAAGGCAGGTGG - Intergenic
991449559 5:66737592-66737614 ATCCAGAAGTAGAAGACAGAAGG - Intronic
992294136 5:75310327-75310349 AACCACATTTGTAAGAAAGCAGG - Intergenic
992656480 5:78915120-78915142 AACCAGATTTGTTTGACAAAAGG - Intronic
993146999 5:84107065-84107087 AACCAGAATCATAATGCAGAAGG - Intronic
994896625 5:105712624-105712646 AACCAAGTATATAAGACAAATGG - Intergenic
995260787 5:110102153-110102175 AACCTAATTTCTCAGACAGAAGG - Intergenic
996051009 5:118933461-118933483 AACCAGATTTATTACAGGGATGG + Intronic
996611689 5:125388933-125388955 AAACAGATTTTCAAGACTGACGG + Intergenic
997125814 5:131225762-131225784 AACCAGATTTAAATCACAGCAGG + Intergenic
998802098 5:145879632-145879654 AGACAGATTAATGAGACAGAAGG + Intergenic
999353424 5:150900428-150900450 AACCAGATTTCTAAGGAAGTAGG - Intronic
1000771604 5:165361784-165361806 AACCAGATTTATATTTCAAATGG - Intergenic
1001098229 5:168792723-168792745 AACCAAATTTGCAAGACCGAGGG + Intronic
1001484825 5:172111950-172111972 AACCAGATCTATAATATATATGG + Intronic
1003252826 6:4446660-4446682 AAGTAGAGTTAGAAGACAGAAGG - Intergenic
1003647746 6:7928264-7928286 AAACAGATCAATAAGACAGAAGG + Intronic
1004520207 6:16354550-16354572 ACCCAGCTTTATAAAATAGAAGG - Intronic
1004688050 6:17966753-17966775 AATAAGAATCATAAGACAGAAGG - Intronic
1005629166 6:27691401-27691423 TACCAGATTTACCAGACAGGAGG + Intergenic
1007990486 6:46250267-46250289 AACCAGACAGATCAGACAGATGG - Intronic
1008094991 6:47330418-47330440 AGACAGATCAATAAGACAGAAGG + Intergenic
1009904809 6:69857652-69857674 AACCAGATTTTTCCCACAGAAGG - Intergenic
1010262689 6:73834289-73834311 AGTCAGATTTATTAGATAGATGG - Intergenic
1010625992 6:78136750-78136772 AACAGGATTAATAAGACAGATGG + Intergenic
1012188370 6:96249938-96249960 AACCAGATTGATAAGACATGTGG - Intergenic
1012532558 6:100255604-100255626 AACCAGATTTAAAAGAATAATGG + Intergenic
1012657250 6:101839721-101839743 AATCAGATTTGTAAGATATATGG + Intronic
1012903966 6:105042463-105042485 AACCAGATTTCCAGGAGAGAAGG - Intronic
1013833878 6:114309087-114309109 ATCCAGATTTAGAAGAGATAGGG + Intronic
1015010881 6:128345763-128345785 AACCAGATGTATCAGTGAGAAGG - Intronic
1015808465 6:137136878-137136900 AACCAAATTTAGCAGAAAGAAGG + Intergenic
1016257994 6:142132295-142132317 AAGCAGATATGTAAGTCAGAAGG + Intergenic
1017231829 6:152081055-152081077 AAACAGATCAACAAGACAGAAGG + Intronic
1020686652 7:11304458-11304480 AACATGATTTAAAAGACAAATGG + Intergenic
1021144445 7:17067516-17067538 AACCAGAGTTATAAGTCCCAAGG + Intergenic
1021433684 7:20589860-20589882 AATCAGATTTAGAAGATAAAAGG + Intergenic
1021940467 7:25673969-25673991 AACCAGAGAGAGAAGACAGAAGG + Intergenic
1022891197 7:34701565-34701587 AGGCAGATTAATAAGAGAGAAGG - Intronic
1023151861 7:37209111-37209133 AACAAGAATGTTAAGACAGATGG + Intronic
1023775096 7:43598164-43598186 AACCATATTTATAAAAGAAATGG + Intronic
1024817249 7:53285887-53285909 AGACAGATTAATAAGACAGAAGG - Intergenic
1025245675 7:57315063-57315085 AGCCAGGTTTATAAGAATGAGGG - Intergenic
1025867393 7:65397086-65397108 AAACAAAATTATAACACAGAAGG - Intronic
1026398280 7:69981983-69982005 AACAAGATTAATAAGACAGTAGG - Intronic
1026669306 7:72374115-72374137 AACGAGGTTTTTCAGACAGAAGG + Intronic
1029062092 7:97808966-97808988 AACCAGATATATAAATCATACGG + Intergenic
1029963027 7:104708717-104708739 AACCAGATCTAAGAGTCAGAAGG - Intronic
1030499099 7:110336615-110336637 AACTAGACTTGTCAGACAGATGG - Intergenic
1035446394 7:158945814-158945836 ACCCAGATTTAAAAGACATAAGG + Exonic
1035679573 8:1478132-1478154 ACCCAGATTTAAAAAACAGAGGG - Intergenic
1037173685 8:15923196-15923218 AATCAGATTTACGTGACAGAAGG - Intergenic
1037451939 8:19024422-19024444 AATCAGAGTCAGAAGACAGAAGG + Intronic
1038284745 8:26196752-26196774 ATCCAGATTTTAAAGACAGATGG + Intergenic
1039600448 8:38832175-38832197 AACCACTTTGATAAGGCAGATGG - Intronic
1039673224 8:39627475-39627497 AAACAGTTTTAAAAGACAAAAGG - Intronic
1039909483 8:41813088-41813110 AACCAAATTTCTAAGTCTGAAGG + Intronic
1042963434 8:74326330-74326352 AAACATATTTAAAAGAGAGAAGG - Intronic
1043192827 8:77248318-77248340 AGGCAGATTTATAGGAGAGAAGG + Intergenic
1044216323 8:89615245-89615267 AACCAGGTTTAGAAGAGAAAAGG - Intergenic
1044448954 8:92311744-92311766 AGACAGATCAATAAGACAGAAGG - Intergenic
1046430308 8:114115819-114115841 AATCAAATTTCTAAAACAGAAGG - Intergenic
1046580376 8:116085356-116085378 AATCAGCTTTCTAAGACAAAGGG + Intergenic
1047789073 8:128183992-128184014 AAACATATTTATTAGACAGTAGG - Intergenic
1050071100 9:1815113-1815135 AAACAGATTCAAAAGAAAGATGG + Intergenic
1050844691 9:10200235-10200257 AAACAGATTTAAAAAATAGATGG - Intronic
1050964269 9:11778243-11778265 AACCTGATGTATAATACATAAGG - Intergenic
1051740818 9:20250252-20250274 AACCAGAATTAGAACTCAGATGG + Intergenic
1052344590 9:27396449-27396471 AACAGGATTTATTAGAAAGAAGG - Intronic
1053512316 9:38698821-38698843 AACAAGATTTAAAAGACATTTGG - Intergenic
1054989098 9:71300819-71300841 AATCAGATGTATAAGATATATGG + Intronic
1056220238 9:84444772-84444794 AACCATTTTTAAAAGTCAGAAGG - Intergenic
1057768846 9:97948910-97948932 AAACAGATCAACAAGACAGAAGG - Intergenic
1058202753 9:102064739-102064761 AGACAGATTAATGAGACAGAAGG - Intergenic
1058622570 9:106898864-106898886 AGCCAGATGTAGAAGACTGAAGG + Intronic
1060660412 9:125402085-125402107 ATCCAGATTTATAAGCCTGCAGG + Intergenic
1062007473 9:134248090-134248112 AAACAGATGTATAAGAAAAACGG + Intergenic
1187261991 X:17693400-17693422 AACCAGAATGACAAGACAGCAGG - Intronic
1188621326 X:32228259-32228281 AAAGAGATTTATAAAAGAGAAGG - Intronic
1192600633 X:72460016-72460038 AACCAGAAGGATATGACAGAAGG + Intronic
1193159828 X:78215868-78215890 AACAGGATTAATAGGACAGATGG - Intergenic
1193274863 X:79573607-79573629 AATCAGATTAAATAGACAGAAGG - Intergenic
1193402846 X:81066231-81066253 AGACAGATCAATAAGACAGAAGG + Intergenic
1195590050 X:106613974-106613996 AACCATATTTATAATACAAAAGG + Intronic
1196369497 X:114961030-114961052 AACCACATTCACAAGACAGCTGG + Intergenic
1196459044 X:115911213-115911235 TCACAGATTTATAAGACAGTTGG - Intergenic
1196974565 X:121144353-121144375 AACCCAAGTTATAAAACAGAGGG - Intergenic
1198178468 X:134180610-134180632 AAACAGAATTATAACACAGATGG - Intergenic
1198232354 X:134703275-134703297 AACCAGAGAGAAAAGACAGATGG + Intronic
1201401618 Y:13609829-13609851 AACAGGATTAATAGGACAGAGGG + Intergenic
1202034994 Y:20623789-20623811 ACCAAGATTTATAAGACAAAAGG - Intergenic
1202086229 Y:21139713-21139735 AACCAGAGTTTTTAGACAAAGGG - Intergenic