ID: 1165789481

View in Genome Browser
Species Human (GRCh38)
Location 19:38483051-38483073
Sequence GTGGGCAGGACGAAGACGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165789481_1165789489 6 Left 1165789481 19:38483051-38483073 CCTGCCGTCTTCGTCCTGCCCAC 0: 1
1: 0
2: 0
3: 7
4: 174
Right 1165789489 19:38483080-38483102 GAACGTCATCCAGTTTGAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 60
1165789481_1165789490 7 Left 1165789481 19:38483051-38483073 CCTGCCGTCTTCGTCCTGCCCAC 0: 1
1: 0
2: 0
3: 7
4: 174
Right 1165789490 19:38483081-38483103 AACGTCATCCAGTTTGAGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1165789481_1165789493 18 Left 1165789481 19:38483051-38483073 CCTGCCGTCTTCGTCCTGCCCAC 0: 1
1: 0
2: 0
3: 7
4: 174
Right 1165789493 19:38483092-38483114 GTTTGAGCTGGGGAAGCAGAAGG 0: 1
1: 1
2: 5
3: 56
4: 456
1165789481_1165789491 8 Left 1165789481 19:38483051-38483073 CCTGCCGTCTTCGTCCTGCCCAC 0: 1
1: 0
2: 0
3: 7
4: 174
Right 1165789491 19:38483082-38483104 ACGTCATCCAGTTTGAGCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165789481 Original CRISPR GTGGGCAGGACGAAGACGGC AGG (reversed) Exonic
900243058 1:1625934-1625956 GTGGGCGGGAGGGAGGCGGCTGG + Intronic
900750080 1:4390173-4390195 GTGGGCAGGATGGAGCAGGCGGG + Intergenic
900991236 1:6099340-6099362 GTGTGTAGGAGGAAGACGGTGGG - Exonic
902330617 1:15729518-15729540 GTGGGCAGGACGTCAACGGGTGG - Intronic
902777845 1:18685967-18685989 GTGGGCAGGAGCAAGTTGGCCGG - Intronic
906109412 1:43312995-43313017 GTGGGGAGGAGGAAGTTGGCAGG + Intronic
906148624 1:43575021-43575043 GTGGGCAGGAAGCAGGCAGCAGG + Intronic
906316817 1:44791765-44791787 GTGGGCAGGACCAATAGGGAGGG - Intergenic
908271210 1:62424435-62424457 GTGGGCAGGAAGAACACGTGTGG - Intergenic
909476205 1:76083469-76083491 GTGGGCAGTAAGAAGACTGTGGG + Intronic
910277534 1:85465005-85465027 GTGGCCCGGCCGAAGGCGGCGGG + Exonic
911716385 1:101138442-101138464 CTGGACAGTACGAACACGGCAGG - Intergenic
912251287 1:108014985-108015007 GTGGGCAGGAAGCAGTAGGCTGG - Intergenic
912549534 1:110476008-110476030 GTGGGGAGGAAGAAGAAGGGTGG + Intergenic
914317007 1:146522974-146522996 GTGGGCAGGGAGCAGACAGCAGG - Intergenic
914497348 1:148210386-148210408 GTGGGCAGGGAGCAGACAGCAGG + Intergenic
915281983 1:154829149-154829171 GTGGGCAGGACAGAGAGGCCAGG - Intronic
915352050 1:155232979-155233001 GTGGGCAGGAAGAAACAGGCAGG - Intergenic
916028400 1:160855379-160855401 GTGGGAAGGAGGAAGATGGTTGG + Intronic
916579626 1:166095674-166095696 GGGGGCAGGAGGAAAAGGGCAGG + Intronic
920922548 1:210310325-210310347 GTGGGCAGGCTGAAGACCACAGG - Intergenic
921847643 1:219900988-219901010 GTGGGAAGGACGGAGAGGGGAGG + Intronic
924953529 1:248906669-248906691 GTGGGCGGGACGAAGGAGGCGGG + Intronic
1063040638 10:2333831-2333853 GTGGTCAGGAGGCAGAGGGCAGG - Intergenic
1063121743 10:3109502-3109524 AAGGGCAGGGCGGAGACGGCTGG + Intronic
1070172139 10:73940869-73940891 GTGGGCAGCACGAAGACGTTGGG + Intergenic
1071573636 10:86711240-86711262 GCGGGCTGGGCGAAGACAGCCGG - Intronic
1072800363 10:98388513-98388535 GCGGGCAGGGAGGAGACGGCAGG + Intronic
1077076852 11:705989-706011 TTGGGGAGGACGCAGAGGGCTGG + Intronic
1080365836 11:31573035-31573057 GGGGGCAGGAGGAGGAAGGCAGG + Intronic
1083253912 11:61485036-61485058 GTGAGCAGGAGGAGGAAGGCTGG - Intronic
1084665346 11:70573333-70573355 GGGGGCAGGAGCAAGCCGGCTGG + Intronic
1085120045 11:73961606-73961628 GGAGGCAGGAAGAAGGCGGCAGG - Intronic
1091407235 12:216720-216742 GTGTGCAGGGTGAAGACGACAGG + Intergenic
1092211076 12:6646858-6646880 GTGGGTTGCACGGAGACGGCAGG + Exonic
1092264251 12:6969056-6969078 GTGGGGAGGAGGAAGAGGTCTGG + Intronic
1096750480 12:53755839-53755861 TTGGGCAAGATGAAGACAGCTGG - Intergenic
1101001376 12:100361501-100361523 GAGGGCAGGAGGAGGAGGGCAGG - Intronic
1102214470 12:111150627-111150649 CCGGGCAGGAGGCAGACGGCTGG + Intronic
1102465668 12:113129740-113129762 CTGGGCTGGAGGAAGAAGGCGGG - Intronic
1103927458 12:124430835-124430857 GTGGGCAGGGGGGAGGCGGCGGG - Intronic
1104921831 12:132294617-132294639 GGGGTCAGGACTAAGAGGGCAGG + Intronic
1105713317 13:23034253-23034275 AAGGGCAGGACCAAGAGGGCCGG + Intergenic
1107557817 13:41533290-41533312 GTGGGCAAGAGGAACACGGTAGG - Intergenic
1108549019 13:51524543-51524565 CTGGGCAGGACGGAGAAGGATGG + Intergenic
1111955928 13:94758471-94758493 GTGGGGAGGACGAAGGCTGCTGG - Intergenic
1112610806 13:100952931-100952953 GAGGGCAGCAGGAAGACTGCTGG - Intergenic
1118088759 14:62448529-62448551 GTGGGCAGGAAGAATACGTTAGG + Intergenic
1118768880 14:68928704-68928726 GTGGGGAGGAGGAAGATGACAGG + Intronic
1119286794 14:73461707-73461729 TTGGGCACGACCAAGATGGCAGG + Intronic
1121824512 14:96999644-96999666 GTGGGCAGAATGAACACAGCGGG - Intergenic
1122037250 14:98957716-98957738 GTGGACAGGAAGAAGCTGGCCGG + Intergenic
1125345417 15:38714284-38714306 GTGGGCAGGGCCAAAATGGCTGG - Intergenic
1126546172 15:49877011-49877033 GTGAGCAGGAAGAAGAGAGCAGG + Intronic
1126705178 15:51399385-51399407 GTGGCCAGGATGAAGAGGACAGG - Intronic
1127260615 15:57323993-57324015 GAGGGCAGGAAGAAGAGGGGAGG + Intergenic
1128441028 15:67708675-67708697 ATGGGCAGGAGGAAGAAGGCAGG - Intronic
1132593963 16:739877-739899 TGGGGCAGGAAGAAGACGGTGGG - Intronic
1132666446 16:1083237-1083259 CCGGGCAGGACGAGGAGGGCGGG + Intergenic
1132688119 16:1170744-1170766 GTGTGCAGGAGGAAGAGGCCAGG + Intronic
1133982032 16:10640105-10640127 GGGGGGAGGAGGAAGACGGGAGG - Intronic
1135240844 16:20806270-20806292 GAGGGCAGGTCGCAGACGCCGGG + Intronic
1136152165 16:28358126-28358148 GTGGGCAGGACGCAGGGGTCTGG + Intronic
1136210915 16:28757156-28757178 GTGGGCAGGACGCAGGGGTCTGG - Intronic
1136240293 16:28939087-28939109 GTGGGCAGGGGGAGGACTGCTGG + Intronic
1137680119 16:50334782-50334804 GTGGGGAGGACGGAGGCTGCTGG - Exonic
1138008657 16:53358825-53358847 GTGGGCAGGGCGGAGGAGGCAGG + Intergenic
1139444002 16:66985545-66985567 GTGGGCAGGACCAGGAAAGCAGG - Intergenic
1141153647 16:81582035-81582057 TTGAGCAGGACGAAGAGAGCTGG + Intronic
1141434924 16:83994552-83994574 GTGGGCAGGACGAGGGCTTCGGG - Intronic
1141875322 16:86820075-86820097 CTGGGCAGAATGAACACGGCTGG + Intergenic
1142048121 16:87939126-87939148 CTGGGCAGGCTGAAGAGGGCAGG - Intergenic
1142065179 16:88058311-88058333 GTGGGCCCGAGGAGGACGGCAGG + Intronic
1142176103 16:88646165-88646187 GTGGCCAGCAGGAAGCCGGCGGG + Exonic
1142677283 17:1521697-1521719 ATGGGCAGGACTGAGAAGGCAGG - Intronic
1144624271 17:16836807-16836829 ATGGGCAGGACGAAGGAGGGAGG - Intergenic
1144764490 17:17725141-17725163 GTGGGCGCGGCGAAGGCGGCAGG + Intronic
1144882158 17:18435912-18435934 ATGGGCAGGACGAAGGAGGGAGG + Intergenic
1145150075 17:20508474-20508496 ATGGGCAGGACGAAGGAGGGAGG - Intergenic
1146495558 17:33318960-33318982 GTGGGAAGGACTAAAATGGCAGG + Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148845524 17:50527681-50527703 GAGGGCAGGAAGAAGACGGGGGG + Intronic
1149647190 17:58249334-58249356 GTGGGCTGGAGGGAGAGGGCTGG - Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1150952953 17:69822735-69822757 GTGGGCAGAACGAACCCAGCAGG + Intergenic
1151214270 17:72567198-72567220 AGGGGCAGGAGGAAGATGGCAGG - Intergenic
1152032351 17:77851772-77851794 GTGGGCAGGAGGATGGCGGGAGG - Intergenic
1152846100 17:82600691-82600713 GTGGGCAGAACAGAGACTGCTGG - Intronic
1153024212 18:658400-658422 GTGGGCGGGGCAAAGGCGGCGGG + Intronic
1154132721 18:11750771-11750793 GTGGGCAGGAGGAAAACTGGTGG + Intronic
1158866657 18:61644113-61644135 GTGGGCAGGAGGAAAACCACTGG - Intergenic
1160143752 18:76347977-76347999 GGGGGCAGGAAGAGGACAGCCGG - Intergenic
1160454610 18:78992089-78992111 GTGCGGAGGACGCAGACAGCGGG + Exonic
1160507672 18:79436556-79436578 ATGGGGAGGACGGAGACAGCGGG - Intronic
1160811482 19:1014797-1014819 GTGAGCCGGACGAAGCCAGCAGG + Intronic
1161058145 19:2200794-2200816 GTGGGGAGGACGAGGAATGCGGG - Intronic
1162730396 19:12715201-12715223 GTGGGCAGGGCGAGGACTGAGGG - Intronic
1163044171 19:14626936-14626958 GTGGGCAGTACGAAGCCTTCAGG + Intronic
1163370136 19:16897064-16897086 GTGGTCAGGACGGAGGGGGCGGG - Intronic
1164513902 19:28918151-28918173 GTGGGCAGGAGGAACAGCGCTGG + Intergenic
1165789481 19:38483051-38483073 GTGGGCAGGACGAAGACGGCAGG - Exonic
925206201 2:2008370-2008392 GTGGGCAGGAAGAACAGGCCAGG + Intronic
926803396 2:16682623-16682645 GTGGGCAGGTTGAGGAGGGCTGG + Intergenic
928340566 2:30439788-30439810 GTGGGGAGGAGGAAAACGGAGGG - Intergenic
930113316 2:47697404-47697426 GTGGGCAGGACGAACCCATCAGG + Intronic
931764069 2:65439037-65439059 GTGGGGAGTAGGAAGAAGGCTGG + Intergenic
934476145 2:94594882-94594904 GTGGGCAGCACGAAGTGGGTGGG + Intronic
940692012 2:156930075-156930097 CTAGGCAGGAAGAAGAGGGCAGG - Intergenic
941733832 2:168949947-168949969 GAGGGCAGGAAGAATACAGCAGG - Intronic
944770805 2:202912471-202912493 GGAGGCAGGAGGAAGACGGGGGG - Intronic
947591571 2:231388897-231388919 GTGGGCAGCACGCAGAAGGGCGG - Intergenic
947625178 2:231614389-231614411 GCGGGCAGGCCGGGGACGGCGGG - Intergenic
947856691 2:233328894-233328916 GTGGACAGGACAAGGACAGCTGG - Intronic
948425997 2:237886868-237886890 GTGGGCAGGTGGAACACGTCTGG + Intronic
1171374475 20:24682756-24682778 CTGGGCCGGACGATGACAGCGGG - Intergenic
1172296564 20:33815430-33815452 GTGGGCAGGACGAAGGAGAGAGG + Intronic
1175911871 20:62408831-62408853 GAGGGCAGGACGCAGGAGGCAGG + Intergenic
1179436611 21:41366671-41366693 ATGGGGCGGAGGAAGACGGCTGG - Intronic
1183427791 22:37748755-37748777 GAGGGCAGGACGGGGGCGGCTGG + Intronic
1183751489 22:39723587-39723609 GAGGGCAGGAGGCAGAAGGCGGG - Intergenic
1184249034 22:43249809-43249831 GTGGCCAGGACATAGATGGCGGG + Intronic
950618042 3:14178281-14178303 GTGCGCAGGACAAAGACGCGGGG + Intronic
953168156 3:40483516-40483538 GTGGGGCGGACCAAGAGGGCAGG - Intronic
953810674 3:46109720-46109742 GTGGGCAGCAAGAAGCCTGCTGG - Intergenic
954214240 3:49115687-49115709 GTGGGAAGGACGAAGAATGGAGG - Intronic
955873931 3:63470691-63470713 GTGGGCAAGAGGAAGAGGGTTGG - Intronic
961658705 3:128457172-128457194 GTGGGCGGGACGGGGAGGGCAGG - Intergenic
964757481 3:160101641-160101663 GTGGGGAGGACGGAGGCTGCTGG + Intergenic
969375749 4:6762078-6762100 GTGGGCAGGAGGAGGCGGGCAGG + Intergenic
969596005 4:8149608-8149630 GGGGGCAGGCAGAAGGCGGCAGG + Intronic
977607206 4:98995512-98995534 GGGGGCGGGGCGAAGCCGGCGGG + Intergenic
979456476 4:120931082-120931104 GTGGTCAGGACAAAGTAGGCAGG - Intergenic
981898652 4:149835472-149835494 GTGGGCGGGAGGAAGGCGGGAGG - Intergenic
986731575 5:10638417-10638439 GTGGGCAGGAGGAAAACAGCAGG - Intronic
989162928 5:38409035-38409057 GTGGGGAGAACGAACACGGGAGG + Exonic
993537273 5:89102534-89102556 GTGGTCATGAGGAAGACTGCTGG + Intergenic
993540037 5:89137944-89137966 GTGGGCAGGAGGATTACAGCTGG + Intergenic
998651444 5:144125662-144125684 ATGGTCAGGAGGCAGACGGCAGG - Intergenic
998894037 5:146778990-146779012 TGGGGCAGGACGAACACAGCTGG + Intronic
1001882252 5:175254648-175254670 GTGGGCAGTTCCAAGAGGGCAGG - Intergenic
1002180148 5:177427043-177427065 GTGCGGAGGAGGAAGACGACGGG - Intronic
1004427123 6:15514041-15514063 GTGGGCACGAGGAAGCCAGCAGG - Intronic
1007756354 6:44102160-44102182 GTGGGCAGGAAGAAGCTGGGTGG - Intergenic
1007775903 6:44224112-44224134 GTGCGCAGGAAGGAGACGCCAGG - Intronic
1007902281 6:45423007-45423029 GTGGGCAGGAAGACACCGGCGGG - Intronic
1013419069 6:109949800-109949822 ATGGGCAGGAGGAGGACTGCAGG + Intergenic
1014634095 6:123823627-123823649 GTGGGAAGCAAGAAGAGGGCTGG + Intronic
1016741145 6:147530381-147530403 GTGCGCAGCACAAAGGCGGCAGG + Intronic
1016993997 6:149948109-149948131 GTGTGCAGGAGGATGATGGCAGG - Intronic
1018906623 6:168079548-168079570 CAGGGCAGGACGAGGAGGGCGGG + Intronic
1019313459 7:373950-373972 GTGGGCAGGAGGGAGAGGGAGGG + Intergenic
1019652026 7:2165040-2165062 GTGGGCAATACAAATACGGCTGG + Intronic
1019804725 7:3115171-3115193 GTGGGCAGGTGGAAGACGATGGG - Intergenic
1020002612 7:4764410-4764432 GGGGGCAGGATGAACACAGCCGG + Exonic
1021199057 7:17706969-17706991 GTGGGCAAGGAGAAGAAGGCTGG + Intergenic
1021638926 7:22719288-22719310 GTGAGCAGGAAGAAGACCCCAGG - Intergenic
1024035512 7:45504712-45504734 GTGGGCAGGAAGAAGCTGCCAGG + Intergenic
1026735639 7:72946842-72946864 CTTGGCAGGAAGAAAACGGCAGG - Intronic
1026897987 7:74021621-74021643 GTGGGCAGGAGGACAAAGGCTGG + Intergenic
1027108082 7:75418169-75418191 CTTGGCAGGAAGAAAACGGCAGG + Exonic
1031094829 7:117405129-117405151 GTGGGAAGGAGGAAGAGGACTGG - Intronic
1032000340 7:128261076-128261098 GTGGGCAAGCAGAAAACGGCTGG - Intergenic
1032884014 7:136117913-136117935 GTGTGCAGGACAGAGAGGGCTGG - Intergenic
1033817039 7:145085488-145085510 AAGGGCAGGAAGAAGAGGGCAGG + Intergenic
1035360700 7:158311697-158311719 GTGGCCTGGATGAAGACGACAGG + Intronic
1035602002 8:902574-902596 CTGGGAAGGAAGAAGAGGGCTGG + Intergenic
1040950802 8:52937708-52937730 GTGGGAAGGAGTAAGATGGCTGG - Intergenic
1042537082 8:69869996-69870018 GAGGGCAGGAGGAAGATGGAAGG - Intergenic
1045782787 8:105886990-105887012 GTGGGCAGAACGAGCCCGGCAGG + Intergenic
1047461453 8:125069486-125069508 GGGGGCAGGACTAGGAAGGCAGG - Intronic
1049603449 8:143518593-143518615 GTGGGCAGGCCGCAGAGGGGAGG + Intronic
1052853896 9:33395047-33395069 GTGGGCAGCACGAAGTGGGTGGG - Intronic
1059978918 9:119747678-119747700 GTGGTCAAGACGAAGATGGAAGG - Intergenic
1060358408 9:122931660-122931682 GTGGGCGGGGCGCAGACGGAGGG + Intergenic
1060738769 9:126083886-126083908 GTGGCCAGAAAGAAGAAGGCAGG - Intergenic
1061204137 9:129153241-129153263 GTGGGGAGGAAGAAGGAGGCAGG + Intergenic
1061507249 9:131038300-131038322 GTGGGCAGCACGAGGGCGGCAGG + Intronic
1185529899 X:809306-809328 GTGGCCACGTCGAAGATGGCTGG - Intergenic
1190286679 X:48966170-48966192 GAGGGCAGCAAGAAGACAGCAGG + Exonic
1192458509 X:71297832-71297854 GTAGGCAGGAGGAAGAGCGCAGG + Exonic
1200061738 X:153486816-153486838 GTGTGCTGGAGGAAGGCGGCAGG - Exonic