ID: 1165791869

View in Genome Browser
Species Human (GRCh38)
Location 19:38497283-38497305
Sequence CAACCCGGAAGCGTAGCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165791869_1165791878 10 Left 1165791869 19:38497283-38497305 CCGCACGCTACGCTTCCGGGTTG No data
Right 1165791878 19:38497316-38497338 CACAGTCTAGGCTTCCAGCCAGG No data
1165791869_1165791880 19 Left 1165791869 19:38497283-38497305 CCGCACGCTACGCTTCCGGGTTG No data
Right 1165791880 19:38497325-38497347 GGCTTCCAGCCAGGTGGCCTTGG No data
1165791869_1165791879 13 Left 1165791869 19:38497283-38497305 CCGCACGCTACGCTTCCGGGTTG No data
Right 1165791879 19:38497319-38497341 AGTCTAGGCTTCCAGCCAGGTGG No data
1165791869_1165791875 -2 Left 1165791869 19:38497283-38497305 CCGCACGCTACGCTTCCGGGTTG No data
Right 1165791875 19:38497304-38497326 TGGGGGCCGATCCACAGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165791869 Original CRISPR CAACCCGGAAGCGTAGCGTG CGG (reversed) Intronic