ID: 1165792401

View in Genome Browser
Species Human (GRCh38)
Location 19:38500125-38500147
Sequence GTCCCCAACATTGCTAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165792401_1165792402 3 Left 1165792401 19:38500125-38500147 CCTGGACTAGCAATGTTGGGGAC 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1165792402 19:38500151-38500173 ACAGTGACCAAGACAGCCCCAGG 0: 1
1: 1
2: 0
3: 27
4: 245
1165792401_1165792404 9 Left 1165792401 19:38500125-38500147 CCTGGACTAGCAATGTTGGGGAC 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1165792404 19:38500157-38500179 ACCAAGACAGCCCCAGGGCCTGG 0: 1
1: 0
2: 3
3: 50
4: 352
1165792401_1165792403 4 Left 1165792401 19:38500125-38500147 CCTGGACTAGCAATGTTGGGGAC 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1165792403 19:38500152-38500174 CAGTGACCAAGACAGCCCCAGGG 0: 1
1: 0
2: 3
3: 31
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165792401 Original CRISPR GTCCCCAACATTGCTAGTCC AGG (reversed) Intronic
900563414 1:3319887-3319909 TTGCCCAACATGGCTGGTCCTGG - Intronic
902465122 1:16612938-16612960 GACCCCAACTTTGCAAGTCAGGG + Intronic
903155684 1:21440733-21440755 GACCCCAACTTTGCAAGTCAGGG - Intronic
906523324 1:46479787-46479809 GTGCCCAACAGTCCTAGGCCAGG + Intergenic
909001404 1:70221655-70221677 GTCCCCAGCACTGCAGGTCCGGG + Exonic
909221562 1:72969042-72969064 GTCCCCAACATTTTTGGACCAGG + Intergenic
913600340 1:120415664-120415686 GACCCCAACTTTGCAAGTCAGGG - Intergenic
914086719 1:144461003-144461025 GACCCCAACTTTGCAAGTCAGGG + Intronic
914361490 1:146939363-146939385 GACCCCAACTTTGCAAGTCAGGG - Intronic
914464663 1:147915955-147915977 GTCCCCAATATGGAGAGTCCTGG + Intergenic
914491116 1:148151344-148151366 GACCCCAACTTTGCAAGTCAGGG + Intronic
914590526 1:149102889-149102911 GACCCCAACTTTGCAAGTCAGGG + Intronic
917128681 1:171716726-171716748 GTACCCAAAATTGCTAGCACTGG - Intronic
1064276611 10:13912218-13912240 GTCCCCAACACTGCTACTGTAGG - Intronic
1066656405 10:37702522-37702544 GTCCCCAACTGTCCTAGTCCTGG + Intergenic
1078929240 11:15900871-15900893 CTCGCCCACATTGCTAGTCGGGG + Intergenic
1092067784 12:5606115-5606137 GCCCCCATCATTGCTAGGCCTGG - Intronic
1093807825 12:23456305-23456327 TTCCCCAACAATGCCACTCCAGG + Intergenic
1094345605 12:29465180-29465202 GTCCCCAGCAATAATAGTCCAGG + Exonic
1101498049 12:105274703-105274725 GCCTCCAACATTCCAAGTCCTGG + Intronic
1102054978 12:109889772-109889794 ATCCCCACAATTGCCAGTCCTGG - Intergenic
1103812633 12:123627908-123627930 GGCCCCAAGATTGCCAGACCAGG + Intronic
1104146603 12:126040110-126040132 GACCACTACATTGCTGGTCCTGG + Intergenic
1104285499 12:127420776-127420798 GTCCCCATCATTCCTGGTCCTGG - Intergenic
1112545213 13:100361652-100361674 GTCCTCAGCATTACTAGTCATGG + Intronic
1117830698 14:59746715-59746737 GTCCCCAACTTATCTGGTCCTGG - Intronic
1118763253 14:68893524-68893546 GATCCCAATACTGCTAGTCCAGG - Intronic
1141244037 16:82290074-82290096 CTTCCCACCATTGCTAGCCCCGG + Intergenic
1147885242 17:43679828-43679850 TTCCTCAACATTGCTGGCCCCGG + Intergenic
1158322968 18:56283441-56283463 TTCCCAAACATTTCTAATCCTGG + Intergenic
1159105660 18:64000187-64000209 GCCCCCAACAATGCCAATCCAGG - Intronic
1165792401 19:38500125-38500147 GTCCCCAACATTGCTAGTCCAGG - Intronic
1174794976 20:53514353-53514375 GTCCGAACCTTTGCTAGTCCAGG + Intergenic
1185212059 22:49575892-49575914 GTCCCCAACAGGCCTGGTCCTGG - Intronic
952299460 3:32091706-32091728 CTCCCCAACATTGCCAGATCTGG + Intergenic
958894474 3:99814495-99814517 CTCCCCACCATTACTAGTCCTGG - Intergenic
959105895 3:102063856-102063878 GTCCCCCACCTTCCTAGCCCCGG + Intergenic
964237785 3:154554178-154554200 TTCCCCAACCTGTCTAGTCCTGG - Intergenic
966821697 3:183929916-183929938 GTCCTAAACATTTCTAGTCCTGG - Intronic
977397206 4:96485816-96485838 GTCCCCAACATGTGTAGTTCAGG + Intergenic
978010417 4:103675547-103675569 CTCCCTGGCATTGCTAGTCCTGG - Intronic
984329840 4:178300229-178300251 GTCCCAAACATTGTATGTCCCGG + Intergenic
986329266 5:6705394-6705416 GTCCCCACAATTGCTAATCCAGG - Intergenic
988526274 5:31989875-31989897 GGCCCCAAGAATACTAGTCCTGG + Intronic
990622894 5:57579349-57579371 GTGCCCAGCATTGCCAGTTCTGG + Intergenic
995429959 5:112063445-112063467 GATGCTAACATTGCTAGTCCGGG + Intergenic
1002415691 5:179119769-179119791 AGCCCAGACATTGCTAGTCCAGG - Intronic
1002899217 6:1396530-1396552 GTCCCCAACATGGCTCGTGATGG - Intergenic
1002921549 6:1576803-1576825 GTCGCCACCATTGAAAGTCCCGG + Intergenic
1004764112 6:18705227-18705249 GTGCCCAACATTACTAATCAGGG - Intergenic
1009627008 6:66146952-66146974 GTGCCCAAAATCACTAGTCCTGG - Intergenic
1010203698 6:73304801-73304823 GTCACCAACATAGCTGGTCTGGG + Intronic
1013865928 6:114695926-114695948 GTCCCCAACCTTACCAGTCTTGG - Intergenic
1019120863 6:169802265-169802287 GTCACCAACATGGCTGGGCCTGG + Intergenic
1019319031 7:406794-406816 GTCCCCAACAGTGCAATTCCTGG - Intergenic
1022582521 7:31570270-31570292 GTCCCCCACAATGCTAATGCTGG - Intronic
1022639721 7:32170681-32170703 GTGCCCAACACAGCTAGTTCTGG + Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1030665666 7:112275272-112275294 AGCCCCAGCATTCCTAGTCCTGG + Intronic
1031672200 7:124563603-124563625 TTCCTCAACATTGCTAAACCTGG + Intergenic
1045582640 8:103498744-103498766 GTCACCCACATTGCTTGCCCAGG + Intergenic
1048143223 8:131816188-131816210 GTCCCCAACATCAATAGTACAGG + Intergenic
1060523836 9:124309376-124309398 GTTCCCAACACTGCCCGTCCTGG - Intronic
1189947351 X:46192805-46192827 GTCCCCAGCATTGCTATTGTAGG - Intergenic
1190412487 X:50150925-50150947 GTCCCCAATATTCCTGTTCCTGG + Intergenic
1196335532 X:114527940-114527962 ATCCCAAACATGGTTAGTCCTGG + Intergenic
1197695847 X:129549074-129549096 GTCCCTTAAATTGCTTGTCCAGG + Intronic
1197888337 X:131241016-131241038 GTCCCCCACATTCCTTCTCCAGG + Intergenic
1200428287 Y:3046260-3046282 GTTCCCAAGGTTGCTAGTACAGG - Intergenic