ID: 1165793878

View in Genome Browser
Species Human (GRCh38)
Location 19:38507435-38507457
Sequence GAGGAGAGAAGGGCTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1572
Summary {0: 1, 1: 1, 2: 7, 3: 158, 4: 1405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165793878 Original CRISPR GAGGAGAGAAGGGCTGAGAA GGG Intronic
900830131 1:4959907-4959929 GAGAAGAGAAGGGAAGAGGAGGG + Intergenic
900888025 1:5429285-5429307 GAGCAGGGAGGGGCTGAGCAGGG + Intergenic
900892327 1:5458447-5458469 GAGGAGGGAAGGGAGGAGAGAGG - Intergenic
900900203 1:5510840-5510862 GAGGAAGGAGGGGATGAGAAAGG - Intergenic
900918564 1:5656195-5656217 GAGGAGAGAAGGAGGGAGAGAGG + Intergenic
900925680 1:5704867-5704889 CAGCCGAGACGGGCTGAGAAAGG + Intergenic
901017092 1:6238091-6238113 GGAGGGAGAAAGGCTGAGAAGGG + Intergenic
901206642 1:7501320-7501342 GAGGAAGGGAGGCCTGAGAACGG + Intronic
901238602 1:7680360-7680382 GAGGGGAGGAGGGCTGGGGAAGG + Intronic
902069304 1:13720344-13720366 ATGGAGAGAAGGGCTGGGTAGGG + Intronic
902199399 1:14822539-14822561 CAGGAGGGAGGGGCTGAGAGAGG - Intronic
902502736 1:16921828-16921850 GAGGAGGGAGGGGATGGGAAAGG - Intronic
902576710 1:17382570-17382592 CAGGAGAGGAGGGCTGAAGATGG - Intronic
902774724 1:18667373-18667395 AAGGAGAGAAGGAAGGAGAAAGG + Intronic
902834821 1:19040199-19040221 GAGGAGAGATGGGTTGAGAACGG + Intergenic
903022725 1:20405250-20405272 GAGGAGAGGAGGGTAGAGATGGG + Intergenic
903220609 1:21867481-21867503 GAGGAAAGTAGGGCTCAGAGAGG - Intronic
903331636 1:22599839-22599861 GAGGAGAGGAGGGGAGGGAAGGG + Intronic
903356367 1:22750312-22750334 CAGGAGAGATGGGCTGGGATGGG + Intronic
903575317 1:24336291-24336313 GAGCAGGGAGGTGCTGAGAATGG - Intronic
903816247 1:26066476-26066498 GAAAAGAGAAGGGCTAAGTAGGG - Intronic
903860620 1:26362249-26362271 GAGGAGAGGAAGGCTCAGAGAGG - Intronic
904204263 1:28842584-28842606 GAGGAGTGTAGGGCTCCGAAAGG + Intronic
904381377 1:30113343-30113365 GAGGAGAGGAGGGAAGACAAGGG + Intergenic
904418675 1:30377753-30377775 GAGGAAAGAGGGGCTCAGAGAGG - Intergenic
904677019 1:32205020-32205042 GAAGAGAGAGGGGGTGAGAGAGG + Intronic
904896933 1:33824596-33824618 GAGGAGAGAAGGGCATAGAGTGG - Intronic
904901992 1:33864928-33864950 GAGGAGAGGAGGGAGGGGAAGGG + Intronic
905423205 1:37862301-37862323 GAGGAGAGAGAGGCTCAGAGTGG + Exonic
905589171 1:39147186-39147208 GAGGAGAGGAGAGACGAGAAAGG - Intronic
905890429 1:41515431-41515453 GATGAGAGCAGGGCTGGGGATGG + Intronic
906295642 1:44647433-44647455 GAGGAGGGAAGGGATGGTAAAGG + Intronic
906534852 1:46545733-46545755 GGGGAGAGCATGGCTGAGAGGGG + Intronic
906614674 1:47225964-47225986 AAGGGGAGAAGGGCAGAGAGAGG + Intronic
906782935 1:48588840-48588862 GAGAAGAGAAGAGAAGAGAAGGG + Intronic
906842262 1:49152304-49152326 GAGAAAAGAAGGGAAGAGAAGGG - Intronic
906986247 1:50686569-50686591 GAGGAGGGAAGGGGAGAGGAGGG + Intronic
907275022 1:53312157-53312179 GAGGTGAGCAGGGCAGAGATGGG + Intronic
907294296 1:53439635-53439657 GACGCGAGAAGGGGCGAGAAGGG - Intergenic
907321121 1:53602973-53602995 GAGGATACAAAGGCTCAGAATGG + Intronic
907408487 1:54268587-54268609 GAGCAGAAGAGGGCTAAGAACGG + Intronic
907425364 1:54375946-54375968 GAGGAGAGCAGGGAAGAGGAAGG + Intronic
907438783 1:54465654-54465676 GAGAAGAGTCGGGCTGAGAGAGG + Intergenic
907616523 1:55932304-55932326 GAGGTGAGAGGAGCTGTGAAAGG + Intergenic
907678351 1:56539657-56539679 GAGGAGAGGGGGGCAGGGAAAGG + Intronic
907704881 1:56824337-56824359 GAGAACAGAAGGGCTCAAAAAGG + Intergenic
907848060 1:58227782-58227804 CAGGAGAGGAGGGAAGAGAAGGG - Intronic
907878403 1:58518333-58518355 GAGAAGAGAAGAGAAGAGAAGGG + Intronic
907939837 1:59076995-59077017 GAGGAGAGATGGGCTGGGCAAGG + Intergenic
907947141 1:59146584-59146606 GAGGGGACAAATGCTGAGAATGG + Intergenic
908784569 1:67722293-67722315 GGAGAGAAAAAGGCTGAGAAAGG + Intronic
908921639 1:69201400-69201422 AAGGAAAGAAGGGCAAAGAAAGG + Intergenic
909939116 1:81590261-81590283 AAGGAGCGAAAGGCTGAGATCGG - Intronic
910244768 1:85126834-85126856 GAGAAGGGAAGGGATAAGAAGGG - Intronic
910429983 1:87151068-87151090 GAAGAGGGTAGGACTGAGAAGGG + Intronic
910525714 1:88175733-88175755 AAGAACAGAAGGGCTGAGGAAGG - Intergenic
910599470 1:89015420-89015442 AAGGAGAGATGGGATAAGAAGGG + Intronic
911152832 1:94611418-94611440 GGGGAGAGCTGGTCTGAGAATGG + Intergenic
911877872 1:103192208-103192230 GAAAAGAGAAGAGCTGAGACAGG - Intergenic
911946128 1:104111498-104111520 GAGGAGAGAAGTGCATTGAAGGG - Intergenic
912197745 1:107419189-107419211 GAGGAGACAGGGAGTGAGAAAGG - Intronic
912547313 1:110460169-110460191 GAAGACAAAAGGGCGGAGAAAGG + Intergenic
912746586 1:112250261-112250283 GAGGAAATAATGGCTCAGAAAGG + Intergenic
912841550 1:113043693-113043715 GGGCTGAGAAGGGCTGAGAAGGG - Intergenic
912905912 1:113707017-113707039 GATGAGAGAATGGCTTAGTAAGG - Intronic
912936970 1:114012190-114012212 GAGTAGAGAAGGGGTAAGAGAGG - Intergenic
913320847 1:117587411-117587433 GAGGAGTGAGAGGCTGTGAATGG - Intergenic
914434042 1:147644499-147644521 GAGAATAGATGGGCAGAGAAGGG + Exonic
914958339 1:152184621-152184643 GGGAAGAGAAGAGATGAGAAGGG + Intergenic
915288206 1:154866176-154866198 GAGGGAAGAAGTCCTGAGAAGGG - Intronic
915316951 1:155034135-155034157 GAGGAGAGATGGGATGAGAGTGG - Intronic
915460186 1:156065878-156065900 GGAGAGATAAGGGCTGAGCATGG - Intronic
915473682 1:156140032-156140054 GAGGAGAGAAGGGGTGCAGATGG - Exonic
915482966 1:156199731-156199753 CAGGAGATGAGGGCTGAGAATGG + Intronic
915581482 1:156815656-156815678 CAGGAGAGAAGGACTGAGACGGG + Intronic
915793947 1:158706416-158706438 GAGAAGAGAAGAGCTGGAAAAGG - Intergenic
916014824 1:160740629-160740651 GAGAAGAGCAAGGCTCAGAAGGG - Intronic
916200230 1:162264413-162264435 GAGAAGAGAAGGGAAGAGAAGGG - Intronic
916200232 1:162264423-162264445 GAGAAGAGAAGAGAAGAGAAGGG - Intronic
916422965 1:164653480-164653502 GATGAGTGAGGGGCTGAGCATGG + Intronic
916587458 1:166160964-166160986 GAGGAGATAGCGGCTGAGACCGG + Intronic
916674469 1:167054242-167054264 CAGGAGAACAGGGCTTAGAAAGG + Exonic
916724528 1:167510797-167510819 GTGGGGAGGAGGGCTCAGAATGG - Intronic
916790871 1:168124007-168124029 GAGAAGAGAGGAGCTGAGGAAGG + Intronic
916819579 1:168385354-168385376 GAGGAGAAAAGGGATAAGGAGGG + Intergenic
917648298 1:177049898-177049920 GAGGAAAGAGGGGCTGGGGATGG + Intronic
917660604 1:177173540-177173562 GAGGAGAAAAGGGCTGGGGAAGG + Intronic
917686098 1:177417653-177417675 GTTCAGAGAAGAGCTGAGAATGG - Intergenic
918604172 1:186401567-186401589 GGGGAGGGAAGGGATGAGATGGG - Intronic
918779720 1:188684003-188684025 GAAGAGAAAAAGGTTGAGAATGG + Intergenic
918780775 1:188697244-188697266 GAGAAGAGAAGGGAAGAGAAGGG + Intergenic
918795019 1:188883114-188883136 GAGGAGAGAAGGATCGACAAGGG + Intergenic
919288512 1:195598345-195598367 GAGGAGAGGAGGGAAGAGAAGGG - Intergenic
919565596 1:199181398-199181420 GAGGAGAGAAGGTGAGAGACAGG + Intergenic
919579555 1:199354885-199354907 CAGGAGTGAAGGGCAGAGTAGGG - Intergenic
919913111 1:202123913-202123935 CAGGGGAGAAGGGCTGAGGAAGG - Intronic
920035291 1:203061289-203061311 GAGGAGAGTTGGGCTGGGGAGGG + Intronic
920121476 1:203661905-203661927 CAGGTGAGAAGGGTGGAGAAGGG - Intronic
920122723 1:203670852-203670874 GAGGAGAGAGGGCAGGAGAAGGG - Intronic
920294155 1:204945706-204945728 GAGGAGAGGAGAGTTGTGAAAGG + Intronic
920369013 1:205465713-205465735 GGGGAGAGAGGGTCAGAGAAAGG - Intergenic
920369620 1:205469969-205469991 GAGGAGACAAGGTTTGAGCAGGG + Intergenic
920694849 1:208174421-208174443 GAGGAGGTAAGGGCTGTGGAGGG + Intronic
921553601 1:216569155-216569177 GAGGAGGGAAGGGAAGGGAAGGG + Intronic
921617986 1:217294258-217294280 GGGAAGGGAAGGGCAGAGAAAGG - Intergenic
921640245 1:217544489-217544511 GTGGAGAGAAGAGCTGACAAAGG - Intronic
921678565 1:218005151-218005173 GAGAAGAGAAGAGAAGAGAAAGG + Intergenic
921701715 1:218276041-218276063 GAGGTTAGAAGGGCTATGAAGGG - Intergenic
921762310 1:218930262-218930284 TAGGAGAGAAAGACTGTGAAAGG + Intergenic
921831655 1:219733813-219733835 AAGGAGATAAGGGTGGAGAATGG + Intronic
922049024 1:221972804-221972826 GAGGAGAGGAGAGCAGAGAGGGG + Intergenic
922134399 1:222810694-222810716 CAGGAGAAAAGAGCTGAAAAGGG + Intergenic
922148467 1:222974517-222974539 CATGAGAGAAAGGCTGGGAATGG - Intronic
922243508 1:223773021-223773043 GAGGAGTGAAGTGGTGAGGAGGG + Intronic
922347472 1:224708222-224708244 GAGGAGAGAGGCCCTGAGATGGG - Intronic
922515724 1:226206901-226206923 GAGGAGAGAAGGGCAGGTCATGG + Intergenic
922782467 1:228264034-228264056 GGGGAGAGAAGGCCTGGGCAGGG - Intronic
923051681 1:230394725-230394747 GAGGAGGGTAGGGATGAGAGAGG - Intronic
923142491 1:231172497-231172519 GAGGAGAGAGAGGGTGTGAAAGG + Intronic
923616132 1:235539102-235539124 GAGTGGAGTAGGGCTGAGACTGG + Intergenic
923867059 1:237950800-237950822 GAGTGGAGCAGGGCTGAGACTGG + Intergenic
923935647 1:238757178-238757200 GAGGAGGGAAGGGGAGGGAAGGG + Intergenic
923981427 1:239328362-239328384 GAGGACAGCAGGCTTGAGAAAGG - Intergenic
924421819 1:243917080-243917102 AAGGAGAGAAGGGCGGGGAAGGG + Intergenic
924704952 1:246493216-246493238 GAGGAGAGGGGGGCTGAGGTAGG + Intronic
924933669 1:248750429-248750451 CAGGAAAGAAAGGCAGAGAAGGG - Intronic
1062863503 10:829161-829183 GAGGGGAGACGGGCTGTGCAAGG + Intronic
1063194574 10:3729512-3729534 AAGGAGAAAAGGGCTCAGAATGG - Intergenic
1063385242 10:5612434-5612456 GAGGAGGGAAGGGGACAGAAAGG - Intergenic
1063427094 10:5958977-5958999 GAGGGGAGGAGAGCTGAGAGAGG - Intronic
1063593826 10:7414934-7414956 GAGGAAAGAACGGCTCAGAGAGG - Intergenic
1063760332 10:9067449-9067471 GAGGAGAGGAGGGAAGGGAAGGG + Intergenic
1063870332 10:10409718-10409740 GAAGAGAGAAGGGCTGAACAAGG + Intergenic
1064371893 10:14759382-14759404 CAGGAAAGAATGGCAGAGAAGGG - Intronic
1064529462 10:16292815-16292837 GTGGAGAGAGAGACTGAGAAAGG - Intergenic
1064529863 10:16297151-16297173 GGGGAGAGAAGGGAAGGGAAGGG + Intergenic
1065081891 10:22137308-22137330 GAGGAGGCAGGGTCTGAGAAAGG + Intergenic
1065169102 10:23010161-23010183 CTGGAGAGAAGGGAAGAGAAGGG - Intronic
1065199495 10:23299674-23299696 CAGGAGAGTAAGACTGAGAAGGG + Intronic
1065202904 10:23331227-23331249 GAGGAGGGAAGGGAAGGGAAGGG + Intronic
1065299353 10:24307301-24307323 GAGCAGAGAAGGACTGATAGTGG + Intronic
1065866576 10:29919969-29919991 GAGAAGAGGAGGACAGAGAAAGG - Intergenic
1066303456 10:34117145-34117167 GAGCTGCCAAGGGCTGAGAAAGG - Intronic
1066310474 10:34191209-34191231 AAGGAGAAGAGGGCTGATAATGG + Intronic
1066487038 10:35856144-35856166 GAGGAGAGAGGGGAAGAGGAAGG - Intergenic
1066539803 10:36433741-36433763 GAGTGGAGTAGGTCTGAGAATGG + Intergenic
1067017147 10:42766415-42766437 GAGAAGAGAAGAGAAGAGAAGGG + Intergenic
1067232259 10:44420073-44420095 GAGGAGAGGAAGGCTTAGAGGGG + Intergenic
1067723463 10:48748328-48748350 AAGGAAACAAAGGCTGAGAAAGG + Intronic
1067836235 10:49643568-49643590 GAGGGGAGAAGGGCAGAGCAGGG + Intronic
1067848505 10:49740640-49740662 GACAAGAGATGGGCTGGGAAGGG - Intronic
1068669155 10:59707272-59707294 GAGGAGGGAAGGGAAGGGAAGGG + Intronic
1068801382 10:61144551-61144573 GGGCAGAGAAGGGCTAAAAATGG - Intergenic
1068933913 10:62617809-62617831 GAGCAGAGAAGAGCTTAGAGAGG + Intronic
1068948626 10:62755212-62755234 GAGGAGAGAAGGAGGGAAAAGGG + Intergenic
1069007818 10:63337498-63337520 GAAAAGAGAAGGGAGGAGAAGGG + Intronic
1069615984 10:69806388-69806410 GAGGACAGGAGGCCTGAGAGGGG + Intronic
1069824150 10:71245103-71245125 GGGGAGAGGAGGTCAGAGAAGGG - Intronic
1069841996 10:71345748-71345770 GAGTAGAGGAGGGCAGAGCAGGG + Intronic
1069856412 10:71443464-71443486 GGGGAGAGAAGGGCACAGAGAGG - Intronic
1069942286 10:71964176-71964198 GAGGAGAGGAGGGGAGAGAGGGG - Intergenic
1070103973 10:73414353-73414375 CGGTAGAGAAGGGCTGAGACTGG + Intergenic
1070149706 10:73798198-73798220 AAGGAGAGAAGGGCAGAGTTGGG - Intronic
1070330101 10:75410266-75410288 AAGGAAAGAAGGGATGAGGATGG - Intergenic
1070651411 10:78239800-78239822 GAGGAGAGAAGGGGTGCAGATGG + Intergenic
1070903098 10:80048003-80048025 GAGGAGACAATGTCTGAGACAGG + Intergenic
1071270713 10:84004480-84004502 AGAGAGAGTAGGGCTGAGAAGGG + Intergenic
1071456888 10:85857813-85857835 GAGGAGAGTAGGGGTGAGGCTGG - Intronic
1071916980 10:90303965-90303987 GAGGAGTGAGGGGGTGAGAGGGG - Intergenic
1071962358 10:90819371-90819393 GAGGAGAGAATTTCTAAGAAGGG - Intronic
1071988591 10:91076944-91076966 GAGGGGAGAAAGGGAGAGAAGGG - Intergenic
1072282642 10:93881948-93881970 GAGGAGTGAAGGGGTGGGAGCGG + Intergenic
1072582790 10:96754117-96754139 GAAGAGAGAAAGACAGAGAAGGG + Intergenic
1072729685 10:97837376-97837398 TAGAAGAGAAGTGGTGAGAAGGG + Intergenic
1072745372 10:97935856-97935878 GAGGAGAGGAGGGGTCAGGAGGG + Intronic
1072840434 10:98768329-98768351 CCGGAGAGAAGGGCTGGGATAGG + Intronic
1072855785 10:98944636-98944658 GAGGGGAGAAGGGATTAGAAAGG + Intronic
1072864956 10:99049078-99049100 GAGGAGGGAAGAACGGAGAAGGG + Intronic
1073039159 10:100588057-100588079 AAAGAGAGCAGGGCTGAAAAAGG + Intergenic
1073041727 10:100612469-100612491 GAGGAGGGAAGGAATGAAAATGG - Intergenic
1073047399 10:100647862-100647884 CATGAGAGTAGGGCTGAAAAAGG - Intergenic
1073115404 10:101088865-101088887 GAGTAGAGAAGGGGTGGGGATGG + Intergenic
1073293605 10:102425343-102425365 GAGGTGAGATGGGCGGAGGAGGG - Intronic
1073339623 10:102735154-102735176 GAGGGGAGGAGGGATGAGGAGGG - Intronic
1073371898 10:102997152-102997174 GATGAGAGTTGGGATGAGAATGG + Intronic
1073940421 10:108691630-108691652 GAAGGTGGAAGGGCTGAGAAAGG + Intergenic
1074239736 10:111625729-111625751 GTTGAGAGAAGGGCTGAGTATGG + Intergenic
1074247297 10:111707613-111707635 GAGGAGAGAAGGGAAAAGCATGG + Intergenic
1074436580 10:113439518-113439540 GAGGGGACCAGGGCTGAGAAAGG - Intergenic
1074512810 10:114133284-114133306 AAGGAAAGAAGAGCTGAGGATGG + Intronic
1074859737 10:117501336-117501358 GAGGAGGGAGGGAGTGAGAATGG + Intergenic
1074918949 10:117987785-117987807 CAGGAGAGCAGGGCTGGGGAGGG - Intergenic
1074926705 10:118080523-118080545 CAGGTGACAAGGGGTGAGAATGG + Intergenic
1074945673 10:118278488-118278510 GAGGAGAAAAGGTATGGGAAGGG - Intergenic
1075010729 10:118867591-118867613 AAGGAGAGAAGGAGGGAGAAAGG + Intergenic
1075031800 10:119029308-119029330 GGGGAGAGAAGGGCCGGGAAGGG - Intergenic
1075554310 10:123419151-123419173 GAAGAGAGGAGGGGAGAGAAGGG - Intergenic
1075685877 10:124364787-124364809 GGGGAGGGAGGGCCTGAGAAAGG + Intergenic
1075764108 10:124879268-124879290 GAGTGAAGAGGGGCTGAGAAGGG + Intergenic
1075815588 10:125262181-125262203 GGGGAGTGAGGGGCTGAGAGAGG - Intergenic
1075942782 10:126405688-126405710 GAGGAGGGATGGGCAGAGGAGGG + Intergenic
1076222191 10:128743227-128743249 GAGGAGAGTTGTGCTGAGACAGG + Intergenic
1076846174 10:133070568-133070590 GAGGAGAGAAGTCGTGGGAAGGG - Intergenic
1077075766 11:701289-701311 GAGGAGGGGAGGGCTGAGGCAGG - Intronic
1077231071 11:1458445-1458467 GAGGGGGGCAGGGCTGGGAAGGG - Intronic
1077351790 11:2096552-2096574 GAGGTGTGAGGGGCAGAGAAAGG - Intergenic
1077957633 11:7038132-7038154 GGGGATAGAAGGGATGAGGATGG + Intronic
1078266428 11:9758839-9758861 GGGGAGAGAAGGGAGGAGACGGG - Intergenic
1078321031 11:10334816-10334838 AAGGTGAGAAGGGCAGAGTATGG + Intronic
1078441947 11:11375642-11375664 GAGGAGAGCAAGACTGAGAGAGG - Intronic
1078826539 11:14935515-14935537 GAGGAGAGGAGGGGAGGGAAGGG + Intronic
1078908078 11:15705900-15705922 GAGAAGGGAAGGGGAGAGAAGGG + Intergenic
1079456876 11:20643921-20643943 CAGGAGTGGAGGGCTGTGAAGGG + Intronic
1079564433 11:21864831-21864853 GGGGAGAGAAGGGGAGGGAAGGG - Intergenic
1079564438 11:21864841-21864863 GGGGAGGGAAGGGGAGAGAAGGG - Intergenic
1079564441 11:21864851-21864873 GGGGAGAGAAGGGGAGGGAAGGG - Intergenic
1079564446 11:21864861-21864883 GGGGAGGGAAGGGGAGAGAAGGG - Intergenic
1079564449 11:21864871-21864893 GGGGAGAGAAGGGGAGGGAAGGG - Intergenic
1079564454 11:21864881-21864903 GGGGAGGGAAGGGGAGAGAAGGG - Intergenic
1079564457 11:21864891-21864913 GGGGAGAGAAGGGGAGGGAAGGG - Intergenic
1079564462 11:21864901-21864923 GGGGAGGGAAGGGGAGAGAAGGG - Intergenic
1079564465 11:21864911-21864933 GGGGAGAGAAGGGGAGGGAAGGG - Intergenic
1079564470 11:21864921-21864943 GGGGAGGGAAGGGGAGAGAAGGG - Intergenic
1079564473 11:21864931-21864953 GGGGAGAGAAGGGGAGGGAAGGG - Intergenic
1079564478 11:21864941-21864963 GGGGAGGGAAGGGGAGAGAAGGG - Intergenic
1079564481 11:21864951-21864973 GGGGAGAGAAGGGGAGGGAAGGG - Intergenic
1079564486 11:21864961-21864983 GGGGAGGGAAGGGGAGAGAAGGG - Intergenic
1079597568 11:22269423-22269445 GAGAAGGGAAGGGAAGAGAAGGG + Intronic
1079861748 11:25681151-25681173 GGGGAGAGCAGGGGTGGGAAGGG + Intergenic
1079907985 11:26272889-26272911 TAGCAGATAAGGGCAGAGAAGGG - Intergenic
1079934497 11:26600405-26600427 GAGGAGAGGAGGGCAGGGGAAGG - Intronic
1079968075 11:27003294-27003316 GAGGAGAGAACAGGAGAGAAGGG - Intergenic
1080015936 11:27506785-27506807 GACGACAGAAGGGCTGAGGTGGG + Intergenic
1080384633 11:31803999-31804021 GAGGAGAGGAGAGCTGAACAGGG - Intronic
1080397233 11:31901479-31901501 GAGGAGATAAAGGCTCAGAGAGG - Intronic
1080424738 11:32145308-32145330 TAGGAGAGATGGGCTGAACATGG + Intergenic
1080575706 11:33597371-33597393 GAGGGGAGAAGGGAGGAGGAGGG + Intronic
1080618736 11:33968534-33968556 CAGGAGGGAAGGGCGAAGAAAGG - Intergenic
1080862682 11:36163606-36163628 CAGGAGTGAAGGGGTGGGAAAGG - Intronic
1080920699 11:36706730-36706752 GAGGAATGAGGGTCTGAGAAAGG - Intergenic
1081352018 11:42065975-42065997 GGGAAGGGAAGGGCTGCGAAAGG + Intergenic
1081624772 11:44645933-44645955 GAGGAGAGGAGAGGAGAGAAGGG + Intergenic
1081995646 11:47362010-47362032 GAGGAGAGAAAGGCAGAGCTGGG + Intronic
1082043333 11:47705252-47705274 GGGGAGAGAAGGCATGAGATGGG + Intronic
1083141851 11:60728715-60728737 GAGGAGAGAAGGAGAGAGAGAGG - Intergenic
1083420809 11:62552032-62552054 GTGGAGAGAAGGGAGGGGAAGGG - Intronic
1083573115 11:63770289-63770311 GAAGAGAGCAGAGCTGTGAAAGG - Intergenic
1083703834 11:64499635-64499657 GAAGGGAGAAAGGCTGAGAAGGG + Intergenic
1083778037 11:64903664-64903686 GGGGGGAACAGGGCTGAGAAGGG + Intronic
1084441811 11:69178950-69178972 GAGGAGAGAGGGGAAGGGAAGGG + Intergenic
1084488866 11:69467304-69467326 GTGGAGAGAAGGGAAGAGAGAGG + Intergenic
1084529254 11:69717437-69717459 GAGGAGGGAGGAGGTGAGAAGGG - Intergenic
1084529275 11:69717501-69717523 GAGGAGAGGAGGGAAGAGGAGGG - Intergenic
1084535567 11:69754327-69754349 AAGGAAAGAAGGGCTGGGAGAGG - Intergenic
1084759198 11:71257708-71257730 AAGGAGAGAAGGGAAGGGAAAGG + Intergenic
1085030608 11:73268907-73268929 CATGAGTCAAGGGCTGAGAAGGG - Intronic
1085276107 11:75301410-75301432 TAGGAGGGTAGGGCTGTGAAGGG + Intronic
1085343199 11:75747150-75747172 GGGTGGAGAAGAGCTGAGAAAGG + Intergenic
1085471790 11:76763223-76763245 AAGGAAGGAAGGGCTGAGATTGG - Intergenic
1085659122 11:78346580-78346602 GAGAAGAGAAGAGAAGAGAAAGG + Intronic
1085732295 11:79010299-79010321 GCGGGGAGAAGGGCTGTGAAGGG + Intronic
1085839588 11:79996315-79996337 GAGGAGACAAGAGCAGACAAGGG + Intergenic
1085868734 11:80325604-80325626 GAGAAGAGAAGGCCTTACAAAGG - Intergenic
1086148398 11:83580869-83580891 GGGGAGAGGAGGGGAGAGAAGGG - Intronic
1086243684 11:84725982-84726004 GAGTATGGAAGAGCTGAGAAAGG - Intronic
1086276339 11:85133998-85134020 AAGGAGAGAGGGGGTGGGAAGGG + Intronic
1086400867 11:86460072-86460094 GAGGAAAGAAAGGCCTAGAAGGG - Intronic
1086590565 11:88509507-88509529 GAGGAGAGAAGGGAGAGGAAAGG + Intronic
1086964377 11:93012444-93012466 GAGGTGAAAAGTGCTAAGAACGG + Intergenic
1087174681 11:95085763-95085785 AATGAGTGAAGGGATGAGAATGG + Intergenic
1087373403 11:97314173-97314195 AAGGAGAGGAGGGCAGGGAATGG + Intergenic
1087684345 11:101246127-101246149 GAGGAGAGAGAGGCAGAGAGGGG + Intergenic
1087754080 11:102036840-102036862 GAGAAGAGAAGAGAAGAGAAGGG + Intergenic
1087803376 11:102528623-102528645 GCAGAAAGAAGGGCTGGGAATGG - Intronic
1088000643 11:104876182-104876204 GAGAAGAGAAGGGCTGCAAATGG + Intergenic
1088191039 11:107228427-107228449 GTGAAGAGATAGGCTGAGAAGGG - Intergenic
1088596420 11:111444275-111444297 GAGGAGAGAAGGGGAGGGGAAGG + Intronic
1089061558 11:115630164-115630186 GAGAAGAAAAGAGCCGAGAAAGG - Intergenic
1089128451 11:116193680-116193702 AAGGAGACAAAGGCAGAGAAAGG - Intergenic
1089290268 11:117433397-117433419 GAGGGGAGAAGGGAGGAGAAAGG + Intronic
1089466659 11:118690210-118690232 GAGAAGAGAAGGGCCAGGAAAGG - Intergenic
1089625576 11:119748814-119748836 GTGGTGAGAAGGACAGAGAAGGG + Intergenic
1089703195 11:120258206-120258228 GAGGAAAGTGGGGGTGAGAAGGG - Intronic
1089742803 11:120596685-120596707 GAGGGCAGAGGGTCTGAGAAGGG + Intronic
1089780205 11:120868510-120868532 GAGCAGAGAAGGGGTGGAAATGG + Intronic
1089780997 11:120873201-120873223 AAGGAGAGGAGGGCAGAGGAGGG - Intronic
1090004470 11:122989461-122989483 GAGGACAGCAGGCCTTAGAAAGG - Intergenic
1090264233 11:125344018-125344040 GAGGAGGGAGCGGCTGAGGAGGG + Intronic
1090270162 11:125380428-125380450 GGGGAGAGAAGAGCGAAGAAGGG + Intronic
1090584134 11:128191761-128191783 GAGGAGGGAAGTGATGAGTATGG - Intergenic
1090644804 11:128758751-128758773 GAGTGGAGAAGGGATGAGGAAGG + Intronic
1090845085 11:130523577-130523599 GAGAAGAAAAGGGCCGAGATTGG - Intergenic
1090923856 11:131232552-131232574 GAGGAGAGGAGGGGAGGGAAAGG - Intergenic
1091194875 11:133721995-133722017 GAGGAGAGTAGGGCTGAGTGAGG + Intergenic
1091364344 11:135005202-135005224 GAGGAGGGATGGGGTGGGAAGGG - Intergenic
1091725184 12:2841382-2841404 GGGCAGAGAAGGGCTTAAAAAGG + Intronic
1091964029 12:4722893-4722915 GAGGAGAAAAGAGCTGGGACAGG + Intronic
1092196781 12:6554634-6554656 GTGGAGAGCAGGGCTGACAGGGG - Intronic
1092305805 12:7299542-7299564 GAGGAGAGAAAGGCAGTGCAGGG - Intergenic
1092388632 12:8055329-8055351 GAGGAGAGAAAGGTTGGGATGGG - Exonic
1092413021 12:8268547-8268569 CAGAAGGGAAGGGCTCAGAAGGG - Intergenic
1093195459 12:16125080-16125102 AAGGAGAGAAGGGAGGGGAAAGG - Intergenic
1093715157 12:22373421-22373443 GAGGAGAGACAGGATTAGAAAGG + Intronic
1093797599 12:23331775-23331797 GAGCAGAGAAGGGCTTAGCAGGG - Intergenic
1094025497 12:25957247-25957269 GTGGAGTGAAAGGCTGAGAAGGG + Intergenic
1094135818 12:27124697-27124719 GAGTAAAGAAGGGGTGAGATAGG - Intergenic
1094185356 12:27636428-27636450 GAGTAAAGAAGGGGTGAGATAGG - Intronic
1095508932 12:42928182-42928204 AGACAGAGAAGGGCTGAGAATGG + Intergenic
1095938694 12:47711778-47711800 GTGGAGGGAAGGGCAGAAAAGGG + Intronic
1095960385 12:47830760-47830782 GAGGAGAGAAGGGGAGGGCAGGG + Intronic
1095982460 12:47981174-47981196 GAGGAGAGATGGGAAGGGAAGGG - Intronic
1096394718 12:51257099-51257121 GAGTAGAGAAAGGCTGTGACTGG + Intronic
1096470702 12:51873809-51873831 CAGCAGAGCAGGGCAGAGAATGG - Intergenic
1096657984 12:53103610-53103632 GAGGACAGAAGGGCTGGGAGGGG + Exonic
1096707346 12:53430521-53430543 GAGGAGAGACAGGCTGGGCAAGG - Intronic
1096780283 12:53987707-53987729 GAGGAAAGAAGGGCACAGAGAGG - Intronic
1096835494 12:54348188-54348210 AAGAAGAGAAGGGAAGAGAAAGG - Intronic
1097313078 12:58142366-58142388 GAGGAGAGAAGGAGGGAAAAGGG + Intergenic
1097486264 12:60205657-60205679 CAGGAGAGAAGGCAAGAGAATGG - Intergenic
1097683613 12:62671781-62671803 GAAGAAGGGAGGGCTGAGAAAGG + Intronic
1098016950 12:66115158-66115180 GATGAGTGGAGGGCTGAGGAGGG - Intergenic
1098098575 12:66987802-66987824 GAGAAAAGAGGGGCTGAGAAGGG - Intergenic
1098715485 12:73824324-73824346 GAGCAGAGAAGGGGTTAAAAAGG + Intergenic
1099052810 12:77802230-77802252 AAGGAGAGAATGGCAGAAAAAGG - Intergenic
1099068302 12:78012240-78012262 TAGGAGACAAGGGCTGGAAATGG - Intronic
1099287742 12:80735903-80735925 GAGAAGGGAAGGGAGGAGAAGGG + Intergenic
1099623405 12:85033665-85033687 GAGGAGAGAAAGACTCAGCAAGG + Intronic
1099685011 12:85874134-85874156 GAGGAGAGCAGGGGGGACAAAGG + Intergenic
1099806602 12:87527998-87528020 GAGGAGGGAAGGGTGGAGAGAGG - Intergenic
1100256250 12:92886418-92886440 GAGAGGAGAAGGGAAGAGAAAGG + Intronic
1100612369 12:96202118-96202140 GGGGAGAGAAGGGATCAGAGCGG - Intronic
1100661827 12:96707884-96707906 GAGGAGAGAAGGGCGCAAAATGG + Intronic
1101157358 12:101940514-101940536 GAGGAGGGAAGGGGAGAGGAGGG + Intronic
1101211722 12:102541594-102541616 AATGAGTGAGGGGCTGAGAATGG + Intergenic
1101376349 12:104174450-104174472 GAGGAGAGAACCACTGAAAAAGG - Intergenic
1101433947 12:104649121-104649143 GAGTAGAGAAGGGTGGGGAATGG + Intronic
1101580527 12:106037835-106037857 GAGGAGGGAAAGGAAGAGAAGGG - Intergenic
1101640488 12:106583099-106583121 GAGGAGAGAGAGGGAGAGAAGGG - Intronic
1101673303 12:106896626-106896648 GAGGAGAGGAGGGGAGAGGAGGG + Intergenic
1101693059 12:107098476-107098498 GAGGAGAGGAGGGGAGGGAAGGG + Intergenic
1101858420 12:108463181-108463203 GCAGAGGGAAGGGCTGAGGAGGG - Intergenic
1101877806 12:108607099-108607121 GAGGAGGGAAGGAAGGAGAAGGG - Intergenic
1101894974 12:108749524-108749546 GAGAATAAAAAGGCTGAGAAAGG - Intergenic
1101999774 12:109550047-109550069 GAGGAGGTAAGGGCTGCGAGTGG - Intergenic
1102218530 12:111178939-111178961 GGGGAAAGCAGGGCTGAGAGAGG + Intronic
1102559798 12:113754149-113754171 GGGGAGAGGAGGGGAGAGAAGGG + Intergenic
1102570238 12:113823063-113823085 GAGGAGACAGGGGATGAGGAAGG - Intronic
1102671784 12:114625608-114625630 GAGGAGACAAAGGCTTAGAAAGG - Intergenic
1102902190 12:116647250-116647272 GAAGAGGGAAGGGAAGAGAAGGG - Intergenic
1102902208 12:116647299-116647321 GAAGAGGGAAGGGAAGAGAAGGG - Intergenic
1102902226 12:116647348-116647370 GAAGAGGGAAGGGAAGAGAAGGG - Intergenic
1104301397 12:127568343-127568365 GAGGGGAGAAGGAGAGAGAAAGG + Intergenic
1104457398 12:128926506-128926528 GAAGAGAGAAATGCTGAGATGGG - Intronic
1104569914 12:129916138-129916160 GAGGAATGTAGGGCTCAGAAAGG - Intergenic
1104941122 12:132395845-132395867 GAGCAGAGGAAGCCTGAGAAGGG + Intergenic
1105492668 13:20903148-20903170 GCGGTGTGCAGGGCTGAGAACGG - Intergenic
1105595825 13:21837052-21837074 GAGGAGAGAACAACAGAGAAAGG - Intergenic
1105788479 13:23772833-23772855 GAGCAGGGAAGGGCTGTGATGGG - Intronic
1105983617 13:25544502-25544524 GAGGAGAGATGGGATTAGAAGGG + Intronic
1106102205 13:26704565-26704587 GAGCAGAGCCGGGCTGAGATAGG + Intergenic
1106499001 13:30309118-30309140 GAGGAGAGGAGGGGAGAGATGGG - Intergenic
1106825233 13:33513246-33513268 AAAGAGAGAGGGGCTGAGCAAGG - Intergenic
1106834235 13:33616265-33616287 GAGCAGGGAAGGGAAGAGAAGGG + Intergenic
1107291733 13:38862415-38862437 GAGCTGCAAAGGGCTGAGAAGGG + Intronic
1107712865 13:43167971-43167993 CAGGAAAGAAGGGCAGAGGAAGG + Intergenic
1107820054 13:44277573-44277595 GAGGAAAGAAGGGGAGAGGAGGG + Intergenic
1108000091 13:45897780-45897802 GAGGTTATAAGGGCAGAGAAGGG + Intergenic
1108268119 13:48732536-48732558 GAGAAGAGTGGGGCTCAGAAAGG - Intergenic
1108577242 13:51801052-51801074 GAGGAGATAAGAGCTCAGAAAGG - Intronic
1108760827 13:53562243-53562265 GAGGAGAGATGGGGAGAGGAAGG - Intergenic
1109117816 13:58410938-58410960 AAGGAGAGAAGGGGAGAAAAAGG + Intergenic
1109194987 13:59368841-59368863 GAGCAGAGGAGGGCAGAGAAAGG - Intergenic
1109432151 13:62250167-62250189 GAGGAAAGAAGGGGGGATAAAGG - Intergenic
1109918111 13:69018409-69018431 GTTGAGATAAGGACTGAGAAAGG - Intergenic
1110230601 13:73163545-73163567 GAGGAGAGAAATGCTGGTAATGG + Intergenic
1110617446 13:77556738-77556760 GTGGACAGAAGGGCAGAGAGAGG + Intronic
1110737688 13:78957001-78957023 GGGGAGAGAAGGTCTGAGGAAGG + Intergenic
1110868007 13:80419967-80419989 GGGAAGAGAAGGGAAGAGAAGGG - Intergenic
1110868016 13:80420017-80420039 GGGAAGAGAAGGGAGGAGAAGGG - Intergenic
1110868104 13:80420294-80420316 GAGAAGAGAAGGGGGGAGAAGGG - Intergenic
1110868129 13:80420379-80420401 GAGAAGAGAAAGGGGGAGAAGGG - Intergenic
1110868135 13:80420401-80420423 GAGAAGAGAAAGGGGGAGAAGGG - Intergenic
1110868141 13:80420423-80420445 GAGAAGAGAAGGGGGGAGAAGGG - Intergenic
1110868148 13:80420445-80420467 GAGAAGAGAAGGGGGGAGAAGGG - Intergenic
1110868155 13:80420467-80420489 GTGGGGAGAAGGGGGGAGAAGGG - Intergenic
1110947841 13:81445617-81445639 GAAGAGTGAACGGCTGAGAATGG + Intergenic
1111170704 13:84522827-84522849 GAGTGGAGTAGGGCTGAGATGGG - Intergenic
1111344007 13:86924911-86924933 GATCAGGGAAGGGCTGGGAAGGG - Intergenic
1111437165 13:88225696-88225718 GAGGAGAGGAGGGAAGGGAAGGG - Intergenic
1111504821 13:89174147-89174169 GGGGAGAGAAGGGAAGGGAAGGG - Intergenic
1111707625 13:91770374-91770396 GAGAGGAGAGGGGCTGGGAATGG - Intronic
1111891553 13:94088594-94088616 GAGGAGAGGAGGGGAGGGAAGGG + Intronic
1111904424 13:94238769-94238791 AAGGAGAGATGGGTTGAGAAAGG + Intronic
1111913124 13:94333933-94333955 GAGCAGAGAAGGAGAGAGAAAGG + Intronic
1111991523 13:95121818-95121840 GAGAGGGGAAGGGCAGAGAAGGG - Intronic
1112056401 13:95692550-95692572 GAGTGGAGTAGGGCTGAGATTGG - Intronic
1112156384 13:96822080-96822102 GACGAGAGCATGGCTGAGCACGG + Intronic
1112902364 13:104373941-104373963 AAGGAGAGAAGGGGAGAGAAAGG - Intergenic
1113405169 13:110032107-110032129 GAGGAGGGAAGGGAAGAGGAGGG - Intergenic
1113796384 13:113061101-113061123 GATGAGAGAAGGGCTGGGGAGGG + Intronic
1113877435 13:113603140-113603162 GAGAAGAGCAGGGCAGAGAAGGG + Intronic
1114311585 14:21472465-21472487 CAGGAGATCAGGGCTGACAACGG + Intronic
1114392645 14:22326748-22326770 GAGGAGAGAGGGGCACAGAGAGG + Intergenic
1114674445 14:24431004-24431026 GAGGAGAGCAGGGAAGAGGAGGG + Intronic
1114712917 14:24796349-24796371 GAGAAGAGAAGGGACGAGAAGGG - Intergenic
1115275608 14:31605849-31605871 GAGGAGACAAGGAAGGAGAAGGG - Intronic
1115275619 14:31605896-31605918 GAGGAGAGAAGGAAGGAGAAGGG - Intronic
1115386637 14:32805422-32805444 GAGGAGAGATGGGTGGGGAAGGG + Intronic
1115931949 14:38507495-38507517 AAGTAGAGAAGGGCTGAAACTGG - Intergenic
1116251982 14:42498133-42498155 AAAGAGAGAGAGGCTGAGAAAGG - Intergenic
1116421726 14:44740624-44740646 GAGAAGAGAAGGGGTAGGAAAGG + Intergenic
1116469510 14:45270459-45270481 AGGGAGAGAATGGCAGAGAAAGG + Intergenic
1116475850 14:45338472-45338494 GAGGAGAGAAGTGCTCAGGAAGG + Intergenic
1116714277 14:48408073-48408095 GGAGAGAGAAGTGCCGAGAAAGG + Intergenic
1117097003 14:52309356-52309378 GAAGGGAGAGGGGCTGGGAATGG - Intergenic
1117276668 14:54201019-54201041 GAGTAGTGAAAGTCTGAGAAAGG + Intergenic
1117536462 14:56707604-56707626 GGGCTGAGAAGCGCTGAGAAGGG + Intronic
1117669977 14:58096682-58096704 GAGGGGAGAAGGGAGGAAAAGGG + Intronic
1117805933 14:59490757-59490779 GATGAGAGATGGGGTGAGAAAGG + Intronic
1118137855 14:63047258-63047280 GAGGAGAGAAAGGGAGAGAGAGG - Intronic
1118171654 14:63395295-63395317 GAGGAGAAAAGGGAGGAGAAAGG + Intronic
1118323175 14:64765101-64765123 AGGGTGAGAAGGGCTGAAAAAGG + Intronic
1118379339 14:65204876-65204898 CAGGAGAGCAGAGCTGGGAAGGG + Intergenic
1118394823 14:65327107-65327129 GAGGAGAGAGGGGGAGAGAGAGG + Intergenic
1118399531 14:65366956-65366978 GAAAAGCGAAGAGCTGAGAAAGG + Intergenic
1118499253 14:66342813-66342835 GAGAAGAGAAGGGGAGAGGAAGG + Intergenic
1118779631 14:68998579-68998601 GTGGAGAGAAGGTATGAGAAAGG + Intergenic
1119115333 14:72015220-72015242 GAGGAGAGAAAGAGAGAGAAAGG + Intronic
1119224389 14:72933823-72933845 GTGGAGAGAGGAGTTGAGAAAGG - Intronic
1119341525 14:73883157-73883179 GGGGAGGGAAGGGCAGGGAAGGG - Intronic
1119354699 14:73996267-73996289 GAGGAGGGAAGGATAGAGAAGGG - Intronic
1119470746 14:74896983-74897005 GAAGGGAGAAGGTCTCAGAAAGG - Intronic
1119509228 14:75198080-75198102 GAGGAGAAAAGGGCTGGAAGAGG + Intergenic
1119563254 14:75607513-75607535 GAAGAGAGCAGGGCTGGGAATGG + Intronic
1119621704 14:76136542-76136564 CTGGGGAGAGGGGCTGAGAAGGG + Intergenic
1119673732 14:76538904-76538926 GGGGAGAGAAGGGAAGGGAAAGG - Intergenic
1120212001 14:81642536-81642558 GGGGAGAGAAGGGCTAAAACAGG - Intergenic
1120319709 14:82943958-82943980 AATGAGAGAAGAGGTGAGAAGGG - Intergenic
1120507060 14:85365875-85365897 GGGGAGAGAATGGATGTGAAAGG - Intergenic
1120512874 14:85437030-85437052 GAGGAGATAGAGGCTTAGAAGGG - Intergenic
1120522947 14:85546039-85546061 GATGAGAGATGGGCTCGGAAAGG + Intronic
1120840738 14:89082899-89082921 GGGGTTAGCAGGGCTGAGAAGGG + Intergenic
1120880772 14:89413868-89413890 GAGAAGGGAAGGGCAGGGAAGGG + Intronic
1121464890 14:94109350-94109372 GGGCAGGGAAGGGCAGAGAAGGG + Intronic
1121464894 14:94109360-94109382 GGGCAGAGAAGGGCAGGGAAGGG + Intronic
1121586959 14:95069118-95069140 GAGGAGAGGAGAGCTGAGGACGG + Intergenic
1121777039 14:96598032-96598054 GAGGGGAGGAGGGAGGAGAAGGG - Intergenic
1122227160 14:100286550-100286572 GAGGAGAGCAAGGCTGAGCAAGG + Intergenic
1122316123 14:100827023-100827045 GAGGAGAGAAATGCAGAAAAGGG + Intergenic
1122771984 14:104101623-104101645 GAGCAGAGGAGGGTGGAGAAGGG + Intronic
1122865748 14:104603310-104603332 GAGATGAGAAGGGCTCAGAGGGG - Intronic
1122884031 14:104702645-104702667 CTGGGGAGACGGGCTGAGAATGG - Intronic
1122950475 14:105041921-105041943 GAGGAGAGGAGGGTGGAGGACGG - Intergenic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1202890402 14_KI270722v1_random:151781-151803 GAAGAGAGAAGGAGTAAGAAAGG + Intergenic
1123434975 15:20248005-20248027 GGGGAGAGAAGGGGAGAGGAGGG + Intergenic
1123448332 15:20345220-20345242 GAGCAGGGAGGAGCTGAGAAAGG + Intergenic
1123933402 15:25182676-25182698 GAGGAGAACGGGGCTCAGAAAGG - Intergenic
1124029784 15:25999979-26000001 GAGAAGAGAAGAGAAGAGAAGGG - Intergenic
1124370511 15:29102312-29102334 GGGGACAGAGGGGCTGAGGAAGG + Intronic
1124412871 15:29451334-29451356 GAGGCGAGAAGGGGTGGGGAAGG - Intronic
1124899089 15:33805938-33805960 GTGGAGAGAAGGGAGGGGAAGGG - Intronic
1124916029 15:33975137-33975159 TAGAAGAGATGGGGTGAGAAGGG - Intronic
1125305979 15:38314820-38314842 GAGGAGAGAAGGAAAGAAAATGG - Intronic
1125349076 15:38748748-38748770 AAGGTGAGAAGGACTGAGTAAGG - Intergenic
1125489165 15:40133822-40133844 GAGTGAAGAAGGGCTGAGACTGG + Intergenic
1125527464 15:40386482-40386504 GACGAGAGAATGGGTGAGAACGG + Exonic
1125795226 15:42399432-42399454 CAGGTGAGGAGGGCTGGGAACGG - Intronic
1126167546 15:45666785-45666807 GAGGAGGGGAGGGGAGAGAAGGG - Intronic
1126226789 15:46280168-46280190 GAAGAGTCAAAGGCTGAGAAGGG + Intergenic
1126347915 15:47716438-47716460 GAGAAGAGAGGGGCGCAGAAAGG - Intronic
1126465824 15:48961076-48961098 GAGGAGAGAAAGGAGGTGAATGG - Intronic
1126704835 15:51397393-51397415 GGGGAGAGAGGGACAGAGAAGGG - Intronic
1126721251 15:51582883-51582905 GAGGAGGGGAGGGGTAAGAAGGG - Intronic
1127535518 15:59886549-59886571 GAGGAGAGAAATGCAGACAATGG + Intergenic
1127567626 15:60208079-60208101 GCGAAGAGAAGGGCTGTGGATGG - Intergenic
1127966302 15:63925221-63925243 GAGCAGCGAAAGGCAGAGAACGG - Intronic
1128003393 15:64215500-64215522 TAGTAGAAAAGGGCTGGGAATGG - Intronic
1128256258 15:66199328-66199350 GAGGAGAGGAGGGTGGGGAATGG - Intronic
1128308386 15:66614978-66615000 GAGGAGAGGAAGGGTGAGAGGGG - Intronic
1128350748 15:66886851-66886873 GGGGGCAGAAGGGCTGGGAAGGG + Intergenic
1128532381 15:68463336-68463358 GAGGAGATGAGGGATGAGGAAGG + Intergenic
1128539775 15:68518488-68518510 GAAGGTAGAAGGGCTGAAAATGG - Intergenic
1128544164 15:68556125-68556147 AAGGAGGGAAGAGCAGAGAAGGG + Intergenic
1128557458 15:68641445-68641467 GAGGAAAGAAGGGCAGAGAGTGG + Intronic
1128673948 15:69595240-69595262 AAAGAGAGAAGGGCTGGGAGGGG + Intergenic
1128699932 15:69796751-69796773 GGGTAGAAAGGGGCTGAGAATGG + Intergenic
1128705918 15:69837480-69837502 GAGGACTGAAGAGCTGAGGAGGG + Intergenic
1129255320 15:74330945-74330967 GAGGAGAGAAGGGGAGAGAATGG - Intronic
1129363526 15:75040069-75040091 GAGAAGAGAACGGCTGGGCATGG - Intronic
1129661997 15:77558091-77558113 GTGGACAGAGGGGCTGTGAATGG + Intergenic
1129674180 15:77623432-77623454 GAGGTGTGAATGGCTGATAATGG + Intronic
1130205086 15:81868384-81868406 GAGGAGAGAAGGTTGGAGGAAGG - Intergenic
1130898110 15:88186337-88186359 AAGGACATGAGGGCTGAGAAGGG - Intronic
1130948895 15:88570242-88570264 GAGGAGAGCAAGGCTGGGGAAGG + Intergenic
1131073914 15:89483047-89483069 AAGGTGAGCAGGGCTCAGAATGG - Exonic
1131108424 15:89749967-89749989 ATGGAGGGAGGGGCTGAGAAGGG + Exonic
1131211411 15:90500162-90500184 GAGGAAAGAAGGACCTAGAAAGG - Exonic
1131409298 15:92192890-92192912 GAGGCAAGAAGGACAGAGAAAGG - Intergenic
1131572852 15:93556603-93556625 CAGGAGGGAAGGGCAGAAAAAGG - Intergenic
1132279394 15:100600182-100600204 GAGCAGAGGTGGGCTGAAAACGG + Intronic
1132337413 15:101057146-101057168 GAGCAGAGAAGGGTTGCCAATGG - Intronic
1132470262 16:98589-98611 GCGGAGAGAAGGGCCAAGAGCGG + Intronic
1133051646 16:3120396-3120418 GAGGAGAGAGGGGCTCGGGAAGG + Exonic
1133083353 16:3341831-3341853 GAGGAGAGAGGAGCTGAATACGG - Intergenic
1133202529 16:4212858-4212880 GAGGAGAGAGGGACTGAGCCTGG - Intronic
1133256505 16:4519788-4519810 GGCGAGAGAGGGGGTGAGAAGGG - Intronic
1133458123 16:5960963-5960985 GAAGACAGCAGGGCTGAGATGGG + Intergenic
1133500191 16:6358383-6358405 GATGAGACAAGGCCTGACAATGG - Intronic
1133520695 16:6553722-6553744 GAGGAGAGAAGGACAGCAAAAGG + Intronic
1133723363 16:8515671-8515693 GAGGAGAGAAAGGAAGAGAGAGG - Intergenic
1133731598 16:8582918-8582940 GAGCAGGGAAGGGCAGGGAAGGG + Intronic
1134248082 16:12554905-12554927 CAGGGGAGAGGGGCTGAGGAGGG + Intronic
1134332794 16:13265537-13265559 GTGGAGGGAAGGGCGGGGAAGGG - Intergenic
1134332821 16:13265605-13265627 GAGGAGAGAAAAGGAGAGAAAGG - Intergenic
1134351832 16:13444814-13444836 GAGGAGGGAAGGGAAGGGAAGGG - Intergenic
1134417471 16:14056974-14056996 GATGAGAGGAAGGGTGAGAAGGG - Intergenic
1134634956 16:15785136-15785158 AAGGAGGGAATGGCTGAGCATGG - Intronic
1134746541 16:16593330-16593352 GAGGAGGGAAGGGGAGGGAAGGG - Intergenic
1134751725 16:16630705-16630727 GGGGAGGGAAGGGCAGGGAAGGG - Intergenic
1134799489 16:17071467-17071489 GGGGAGGGAAGGGCAGAGGAGGG - Intergenic
1134993731 16:18722965-18722987 GGGGAGGGAAGGGCAGGGAAGGG + Intergenic
1134998935 16:18760360-18760382 GAGGAGGGAAGGGGAGGGAAGGG + Intergenic
1135122072 16:19774889-19774911 GAAGAGAGAAAGACAGAGAAGGG + Intronic
1135232414 16:20721541-20721563 GAGCAGAGTAGGGCTGAGACTGG + Intronic
1135518595 16:23156157-23156179 GAGAAGAGAAGGGAAGGGAAGGG + Intergenic
1135591453 16:23707906-23707928 GAGTAGAGAAGGGTGGAGGATGG - Intronic
1135656850 16:24257323-24257345 GGGGAGGGAAGGGAGGAGAAGGG + Intronic
1135859674 16:26044361-26044383 GAGGGGAGAAGGGCTGGTAGTGG + Intronic
1135892637 16:26371435-26371457 GAGGAGGGAAGGGAAGGGAAGGG + Intergenic
1135947478 16:26877608-26877630 GCTGAGAGAGGGTCTGAGAAAGG - Intergenic
1136044151 16:27602229-27602251 GAGTTGAGAAGGGCTGAGGGAGG - Intronic
1136055604 16:27687053-27687075 CAGGAGTGAAGGGCACAGAAAGG - Intronic
1136072969 16:27799585-27799607 GAGCAAAGAAGGGCTCAGAGAGG + Intronic
1136143135 16:28299856-28299878 GATGAGAGCAGAGGTGAGAAGGG - Intronic
1136235523 16:28911308-28911330 GGGGAGTGAAGGGAAGAGAATGG - Intronic
1136849661 16:33603029-33603051 GGGGAGAGAAGGGGAGAGGAGGG - Intergenic
1136849665 16:33603039-33603061 GAAGAGAGGAGGGGAGAGAAGGG - Intergenic
1136849718 16:33603189-33603211 GAGGAGAGGAAGGATGGGAAGGG - Intergenic
1137036653 16:35574620-35574642 GAGGTGGGAGGGGCAGAGAAGGG - Intergenic
1137044716 16:35644301-35644323 GGGGAGAGAAGGGCTGAGCTGGG - Intergenic
1137588213 16:49677291-49677313 GAGAAGAGAAGAGAAGAGAAAGG + Intronic
1138186624 16:54982376-54982398 GTGGAGGGCGGGGCTGAGAATGG - Intergenic
1139004221 16:62551387-62551409 AAGGAGAGGAGGGGAGAGAAGGG - Intergenic
1139004283 16:62551586-62551608 GGGGAGAGAAGGGGAGAAAATGG - Intergenic
1139004285 16:62551596-62551618 AAGGAGAGGAGGGGAGAGAAGGG - Intergenic
1139323253 16:66132484-66132506 GAGCAGAGAACGGATGAAAATGG + Intergenic
1139365290 16:66428880-66428902 GAGGAGGGAGCGTCTGAGAAAGG - Intronic
1139372069 16:66475167-66475189 CAGGAGAGAAGGGAAAAGAAGGG + Intronic
1139399698 16:66671534-66671556 GAGAAGATAAGGGATGAGAATGG - Intronic
1140043670 16:71425816-71425838 GAGGGCAGGAGGGCAGAGAAGGG - Intergenic
1140058466 16:71546399-71546421 GAGGAAAGACGGGCTATGAAGGG - Intronic
1140317248 16:73911021-73911043 GAGGAGAGAAGAAATGAGAATGG + Intergenic
1141138781 16:81483713-81483735 GAGGAGGGGATGGCCGAGAAAGG - Intronic
1141258992 16:82433324-82433346 GAGGAGAGCAGGGGAGAGGAGGG - Intergenic
1141289660 16:82706103-82706125 GAGGAGAGAAGGGAGGAGTGAGG - Intronic
1141560699 16:84866049-84866071 GAGGAGAGAAGGGATGGAAGTGG + Intronic
1141725127 16:85782870-85782892 CAGGAAAGGAGGGCAGAGAAAGG - Intronic
1141968583 16:87464177-87464199 GGGGAGAGGAGGGCTGAGCAGGG + Intronic
1142485388 17:244417-244439 AGGGAGAGAAGGGAAGAGAATGG + Intronic
1142890103 17:2937609-2937631 AAGGAGAGAAGGGCTCAGTAGGG + Intronic
1143514474 17:7412984-7413006 GAGGGGAGGAGGGGTCAGAAAGG - Intronic
1143642996 17:8210242-8210264 GAGGAGAGCTGGGCGGAGAAGGG + Exonic
1143722330 17:8821796-8821818 AAAGAGAGAAGAGATGAGAAGGG - Intronic
1143821127 17:9564272-9564294 GAGGAGAAAAGAGGTGAGAAAGG + Intronic
1143889387 17:10091018-10091040 GAGGAGAGAGGCGGTGAGAAGGG - Intronic
1144010392 17:11142849-11142871 GAGGAGGGTAGGAATGAGAATGG + Intergenic
1144290734 17:13823679-13823701 GTGGAGAGGAGGGCTTATAAGGG + Intergenic
1144338197 17:14290927-14290949 AGGGAGAGAAGGGATGAAAAAGG + Intergenic
1144710304 17:17397353-17397375 GAGGAGAGACTGGCTGGGAAAGG + Intergenic
1144724725 17:17496213-17496235 GCCGAGAGAAGGGCAGAGAGCGG + Exonic
1145083186 17:19912827-19912849 AAGGAGAGAAAGGCAGAGGAAGG + Intronic
1145108539 17:20141060-20141082 GAGGAGAGAAGGGGGCAGCAGGG - Intronic
1145271339 17:21406456-21406478 GAGGATGGAATGGCTGAGAGAGG + Intronic
1145309544 17:21693860-21693882 GAGGATGGAATGGCTGAGAGAGG + Intronic
1145812658 17:27773863-27773885 GAGAAGATCAGGGCTCAGAAAGG + Intronic
1145837233 17:27963743-27963765 CAGGAAAGATGGGCTGAGATGGG - Intergenic
1146332230 17:31937112-31937134 GAGGAGAGAGGGGAGGAGAGGGG - Exonic
1146465507 17:33083262-33083284 TAAGAGACAAGGGCTGAGAGAGG + Intronic
1146531309 17:33609853-33609875 AAGGAGAGAGGGGTTGAGGAAGG + Intronic
1146759364 17:35463302-35463324 GAGGAAAGAATGGAGGAGAAAGG - Intergenic
1146927212 17:36753348-36753370 GAGGAGCGAAGGGGTGTGGAGGG + Intergenic
1147343946 17:39774375-39774397 GAGGAGAGGAGGGAAGAGGAGGG + Intronic
1147598426 17:41731628-41731650 GCTGAGAGAAGAGGTGAGAATGG - Exonic
1147668545 17:42163759-42163781 GAGGAGACAAGGGCTGAGAATGG + Exonic
1147995959 17:44360649-44360671 AAGGACAGGAGGGCTGAGAAAGG + Intronic
1148075995 17:44935460-44935482 GAGGAGGGAAGGGCTGAGCTGGG - Intronic
1148079602 17:44960399-44960421 GAGGAGAGAGAGGATGAGAAGGG + Intronic
1148085590 17:44991945-44991967 CAGGAGAGGGGGGCTGAGATGGG + Intergenic
1148203974 17:45768115-45768137 GAGGAGAAAAGTGATGAGACTGG - Intergenic
1148467547 17:47873940-47873962 GAGGAGGGAAGAGGGGAGAAGGG - Intergenic
1148556602 17:48582249-48582271 GAGGAGAGAAAGGCCCAGAGGGG + Intronic
1148574082 17:48695974-48695996 GATAAGAGCAGGGCTGAGCATGG - Intergenic
1148681875 17:49478842-49478864 GAGGAGAGAAAGGCAGAGACAGG + Intergenic
1148763660 17:50023027-50023049 GAAGAGACAGGGGCTGACAAAGG - Intergenic
1148849398 17:50547474-50547496 GAGGAGGGAAGGGATGAGGACGG - Intronic
1148964487 17:51423103-51423125 CAGCAGAGAAGGGCAGAGAATGG + Intergenic
1149651707 17:58280029-58280051 GAGGAGTGAGGGCCAGAGAAGGG + Intronic
1150105730 17:62461314-62461336 GAGTGGAGAGGGGCTTAGAAAGG - Intronic
1150484410 17:65533752-65533774 GGGGAGAGAAGAAATGAGAAGGG + Intronic
1150644299 17:66968554-66968576 GAGGAGGGAAGGGGAGAGGAGGG - Intronic
1150828320 17:68496022-68496044 GAGGAGAGGAGGGGAGAGGAGGG - Intergenic
1150984888 17:70184658-70184680 GAGGAGAGAAGGGAAGCGGAAGG - Intergenic
1151412547 17:73940923-73940945 CAGGAGAGATGGGATGGGAAGGG + Intergenic
1151436221 17:74099482-74099504 GTGGAGAGAAGGACTCAGAGAGG - Intergenic
1151627816 17:75288579-75288601 ACAGGGAGAAGGGCTGAGAAGGG + Intronic
1152013728 17:77736023-77736045 GAGGAGAGAAAGGAAGAGAGAGG + Intergenic
1152106570 17:78332838-78332860 GAGGACAGAAAGGCAGGGAAAGG - Intergenic
1152250056 17:79207816-79207838 GAAGAGAGAAGGGGAGGGAAAGG - Intronic
1152340459 17:79721361-79721383 GAGCAGGGAGGAGCTGAGAAAGG - Intergenic
1152538728 17:80964233-80964255 GGAGAGAGAAGGGGTGAGCAGGG - Intronic
1152662571 17:81549610-81549632 CAGGAGAGAAGGGCTTTGAAGGG - Intronic
1152673661 17:81625037-81625059 CAAGAGAGATGGGCTGAGACAGG + Intronic
1153027659 18:686338-686360 GAGGAGAGCGGGGCTGAAAAGGG + Intronic
1153130141 18:1846430-1846452 GAGGAGAGGAGATCTGAGCATGG + Intergenic
1153158051 18:2171470-2171492 GAGGAGACCACGGCTCAGAAAGG - Intergenic
1153166341 18:2265863-2265885 GAAGAATGAAGGGCTGTGAATGG - Intergenic
1153483299 18:5569509-5569531 GATGAGAGGAAGGATGAGAAAGG + Intronic
1153586330 18:6624363-6624385 CAGGACAGAAGTGCTGAGGAAGG + Intergenic
1153625704 18:7020569-7020591 TGCGAGAGAAGGGATGAGAAAGG + Intronic
1153990550 18:10395127-10395149 GGGCAGAGAAGTGCTGAGAAGGG - Intergenic
1154163182 18:11995049-11995071 GAGGGGAGGGGAGCTGAGAAAGG + Intronic
1155254814 18:23985837-23985859 CAGGAGAGAAAGACTGTGAAGGG - Intergenic
1155457322 18:26031978-26032000 GGGAAGAAAAGGGATGAGAAGGG + Intronic
1155821811 18:30387084-30387106 GAGGGCAGAGGGGCTGAGCAGGG + Intergenic
1156059473 18:33056229-33056251 GGGGAGAGAAGGGATGAGCAGGG + Intronic
1156369634 18:36461095-36461117 AGGGAGGGCAGGGCTGAGAAGGG + Intronic
1156693225 18:39733782-39733804 GAGAAGAGAAGAGAAGAGAAGGG + Intergenic
1156781452 18:40855492-40855514 GAGGAGGGAAAGGGTAAGAAGGG - Intergenic
1156825540 18:41426391-41426413 GAGGAGGGAAGGGAAGGGAAGGG + Intergenic
1156862783 18:41857499-41857521 GAGAACAGAGGGGCTGAGACAGG + Intergenic
1156909490 18:42394037-42394059 GAGGAGAGAAGGGCAGCTAAGGG - Intergenic
1157104062 18:44756659-44756681 GAGGAGGGGAGGGAAGAGAAGGG - Intronic
1157488591 18:48107102-48107124 GAGGAGAGAGGGGAAGAGAGAGG + Intronic
1157497687 18:48167976-48167998 GAAGAGAGAAGGGAGGGGAAAGG + Intronic
1157557373 18:48621639-48621661 CAGGTAAGAGGGGCTGAGAATGG + Intronic
1157611132 18:48956409-48956431 CAGAAGAGAAGGGCAGAGAGAGG + Intergenic
1158132963 18:54173477-54173499 AAGGAGAGAAGAGTAGAGAAAGG + Intronic
1158550386 18:58430906-58430928 GAGAAGAGGAGGGTGGAGAAGGG - Intergenic
1158678699 18:59547062-59547084 GGGGAGAGAGGGGGAGAGAAAGG + Intronic
1158812614 18:61055227-61055249 GATGAGAAAAGAGTTGAGAATGG + Intergenic
1158851057 18:61496090-61496112 GAGGAGAGAAGGAGAGAGGAAGG - Intronic
1158851062 18:61496113-61496135 GAGGAGAGAGGGGGAGAGGAAGG - Intronic
1158933280 18:62341813-62341835 GAGGAGACTCAGGCTGAGAATGG + Intronic
1158963378 18:62604245-62604267 GGGGAGAGATGGGCTGAGGGAGG + Intergenic
1159468237 18:68813420-68813442 GAGGAGAGAAGGGTAGAGGAAGG + Intronic
1159629127 18:70728769-70728791 AAGGAGAGAATGGCAGAGAGTGG - Intergenic
1160691789 19:463744-463766 AAGGCGAGAGGGGCTGGGAAAGG - Exonic
1160699060 19:497533-497555 GAGGAGGCAGGGGCTGAGAGGGG + Intronic
1160854665 19:1211356-1211378 GAGCAGGGAAGGGCTGGAAAGGG + Intronic
1160983257 19:1826387-1826409 GAGGAGGGAGGGGAGGAGAAAGG + Intronic
1161022366 19:2016077-2016099 GAGGGGAGAAGGGAGGTGAATGG + Intronic
1161235166 19:3194022-3194044 TGGGGGAGCAGGGCTGAGAAGGG + Intronic
1161253916 19:3295764-3295786 GAGCAGAGAAGGGCTGAGGCAGG - Intronic
1161267889 19:3373409-3373431 GAGGAGGGGAGGGTTGAGGAGGG - Intronic
1161370553 19:3908696-3908718 GAGGAGAAAAGGGAGGAGGAGGG - Intronic
1161415859 19:4145920-4145942 GAGGACAGAGGAGCTGATAAGGG - Intergenic
1161484068 19:4525318-4525340 GGGGAGGGAAGAGCTGAGGATGG + Intronic
1161527166 19:4763488-4763510 GGGCAGAGAAGGGCTCTGAAGGG - Intergenic
1161644304 19:5443848-5443870 GAGGAGAGAAGGGGAGAGGAGGG + Intergenic
1161803545 19:6429508-6429530 GAGGAGAGGAGGAAGGAGAAAGG + Intronic
1161846936 19:6717079-6717101 GAGGAGGGGAGGGCAGGGAAGGG + Intronic
1161988950 19:7673095-7673117 CAGGAGAGAGGGTCTGGGAAGGG - Intergenic
1161994219 19:7702598-7702620 GAGGAGAGAGAGGCAGAGGAAGG + Intergenic
1162195129 19:8978824-8978846 GAGGAAAGAACGGCTGAGCTGGG + Exonic
1162315830 19:9937308-9937330 GAGGAGTGAGAGGCAGAGAAAGG - Intergenic
1162612681 19:11768191-11768213 GAGGAGAGAAAGCCTGAGGAAGG - Intronic
1162690503 19:12426016-12426038 GAGAAGAGAAGGGAAGGGAAAGG + Intronic
1162813772 19:13180971-13180993 GAGGATAGATGGGCTGAGGCAGG + Intergenic
1163019370 19:14474345-14474367 GAGGAGAGGAGGGCAGAGTGAGG + Intronic
1163351124 19:16777353-16777375 GAGGAGAGAAGGGGAGGGGAGGG + Intronic
1163405404 19:17118982-17119004 GAGGTGAGAGGTGCCGAGAACGG - Intronic
1163516089 19:17764761-17764783 GAGGTGAAAAGTGCTGGGAAGGG + Intronic
1163528361 19:17835043-17835065 GAGGAGGGAGGGGCTGAGCAGGG - Intronic
1163700140 19:18782798-18782820 GAAGTGAGAAGGGCTCAGAGAGG - Exonic
1164500339 19:28814444-28814466 GAGGAGAGAGGGACTGGGCATGG - Intergenic
1164650648 19:29888684-29888706 TGGGAGAGAAGGGCGGGGAAAGG + Intergenic
1164693003 19:30224940-30224962 GAGGAGAGAGAGACGGAGAAGGG - Intergenic
1164730991 19:30504393-30504415 GAGGAGAGAAGGAGGGAGAGAGG - Intronic
1164934766 19:32202017-32202039 GAGGGGAGAAGGGCCGGGATGGG + Intergenic
1165141337 19:33701926-33701948 AAGGAAAGAAGGACAGAGAAGGG - Intronic
1165303760 19:34990408-34990430 CAGGACAGGAGGGATGAGAATGG - Intergenic
1165440696 19:35825212-35825234 GGGGAGAGAAGGGAAGGGAAGGG + Intergenic
1165782127 19:38441022-38441044 GAGGGGTGGAGGTCTGAGAAGGG + Intronic
1165793878 19:38507435-38507457 GAGGAGAGAAGGGCTGAGAAGGG + Intronic
1166022656 19:40046630-40046652 TAGGAGTGATGGGGTGAGAATGG - Intronic
1166066863 19:40365207-40365229 TAGGAGAGGAGGGATGAGAGAGG + Intronic
1166070834 19:40386650-40386672 GGGGAGAGAAATGCTGAGAGAGG - Intronic
1166246973 19:41536360-41536382 CAGAAGAGAAGTGCTGGGAAGGG + Intergenic
1166254483 19:41592491-41592513 AATGAGAGAAGGGCTGTGAGGGG - Intronic
1166459011 19:42969542-42969564 GATGAGAGCAGGGGTAAGAAGGG + Intronic
1166475954 19:43124818-43124840 GATGAGAGCAGGGGTAAGAAGGG + Intronic
1166561927 19:43738194-43738216 TAGGATAGAAGGGCTCAGGATGG + Exonic
1166645605 19:44529595-44529617 GAGGAGAGAAGGGAGGTGGAGGG - Intronic
1166679814 19:44759418-44759440 GCGGAGAGAAGACCTGAGGAAGG - Exonic
1166706007 19:44908471-44908493 GCGGGGAGAAGGGCTGGGATGGG - Intronic
1166752037 19:45168869-45168891 GAGGTGAGGAGCGCTGGGAATGG + Intronic
1166765573 19:45251062-45251084 GAGGAGAGAAGGGGAGAGAGAGG - Intronic
1166794232 19:45416732-45416754 GAGAAGGGAAGGGCTGGGCAGGG + Intronic
1167211913 19:48138966-48138988 GAGGACAGAGGGACTGAGAAAGG - Intronic
1167421054 19:49403561-49403583 CAAGTGAGAAGGGGTGAGAATGG + Intronic
1167454494 19:49591377-49591399 GAGGAGGGAAGGGGGGAGGAGGG - Intergenic
1167555224 19:50190471-50190493 AGGCAGAGAAGGGCGGAGAAGGG + Intronic
1167644154 19:50696617-50696639 GGGGAGGGAAGGGCAGAGGAGGG - Intronic
1167665494 19:50820976-50820998 GAGGAGGGGAGGCCTGAGAGCGG + Intronic
1167718516 19:51160837-51160859 GAGGAGAGAAAGGCAGAGGAGGG + Intergenic
1168294247 19:55370825-55370847 GAGGACGGAAAGGCAGAGAAAGG + Intergenic
1168357677 19:55712744-55712766 GAGGAGAGAAGAGCAGAGGACGG + Intronic
1168389413 19:55993565-55993587 GAGGAGAGGAGGGGAGAGGAGGG - Intergenic
1202665826 1_KI270708v1_random:118614-118636 GAAGAGAGAAGGAGTAAGAAAGG + Intergenic
925033909 2:671959-671981 GTGGAGGGAAAGGCTGAGCAGGG + Intronic
925211420 2:2050723-2050745 GGGGAGGGAAGAGCTGAGAGCGG + Intronic
925212338 2:2060697-2060719 GGGGAGGGAAGGGAAGAGAAGGG - Intronic
925212743 2:2064121-2064143 GAGGGGAGAAGCCCAGAGAAAGG + Intronic
925259987 2:2520682-2520704 GAGGAGAGCTGGGCTGACAGGGG - Intergenic
925436869 2:3846110-3846132 GAGGAGGGAAGGAGGGAGAAAGG - Intronic
925449948 2:3960601-3960623 CAGGAAAGGAGGGCTGAGAAAGG - Intergenic
925581080 2:5411596-5411618 GAGGAAAGCAGGGTTGAGACAGG - Intergenic
925831891 2:7904016-7904038 CAGGAGAAAAGGGATGAGGATGG - Intergenic
925881068 2:8353009-8353031 GAGGAGAGGAGGGGAGGGAAGGG + Intergenic
926058727 2:9792117-9792139 CAGGAGAGAAGCACTGAGAGGGG + Intergenic
926111650 2:10187758-10187780 GAGGACAGCAGAGGTGAGAAGGG - Intronic
926292040 2:11539006-11539028 GAGAAGAGAAGGGAGGAGAAGGG - Intronic
926292043 2:11539016-11539038 GAGAAGAGAAGAGAAGAGAAGGG - Intronic
926355275 2:12035763-12035785 GAGGTGATGAGGGGTGAGAAGGG - Intergenic
926435436 2:12833089-12833111 GAGGAGAAAAGGGCTGTCTAAGG - Intergenic
926440361 2:12882681-12882703 GGGGAGGGAAGGGAAGAGAAGGG - Intergenic
927066968 2:19481338-19481360 GAGGAAAGAAGGGTTCAGAAAGG + Intergenic
927121536 2:19968863-19968885 GGGTAGAGAAGGGCAGAGAATGG - Intronic
927497275 2:23559400-23559422 GGGTAGAGAATGGCTGAGAAGGG + Intronic
927714247 2:25342025-25342047 GCGGAGAGAAGGGGTGGGAGGGG - Intronic
927944806 2:27129262-27129284 AAGGGGAGAGGGGCTAAGAAGGG + Intronic
928168618 2:28988970-28988992 GAGCAGAGATGGGTAGAGAAGGG - Intronic
928305866 2:30169945-30169967 GAGGAAAGAAGGGAAAAGAAAGG - Intergenic
928605563 2:32942519-32942541 CAGGAGAGAGAGGGTGAGAAGGG - Intergenic
929192646 2:39153942-39153964 GACAAGAGAGGGGCTGAGCATGG + Intergenic
929438698 2:41948735-41948757 GAGGAGAGAAGGGGTCAAATAGG - Intronic
929788881 2:45009836-45009858 GGGGAGAGAAGAGGAGAGAAGGG + Intergenic
929849566 2:45571936-45571958 GAGGAGAGAAAGGCGCAGAAAGG + Intronic
930154234 2:48089381-48089403 GAGGAGAGGAAGGGAGAGAAGGG + Intergenic
930492554 2:52093582-52093604 GAGGAGAGAAGAGGGAAGAATGG - Intergenic
930611340 2:53547412-53547434 CAGGAGTGCAGGGATGAGAATGG - Intronic
930713369 2:54570225-54570247 GGAGAGAGAAAGGCTAAGAAGGG - Intronic
930851520 2:55966005-55966027 AAGGAGAGCAGGGCTGTGAAAGG + Intergenic
931052256 2:58428278-58428300 GAGGGGGGAAGGGGAGAGAAGGG + Intergenic
931079653 2:58754403-58754425 CAGGAGAACAGGGCTGAGACAGG + Intergenic
931197253 2:60064351-60064373 GAGGAGAGGAGGGAGGAGAGGGG + Intergenic
931816560 2:65909040-65909062 GAGGAGAGGAGGACTTAGACAGG + Intergenic
931832574 2:66067950-66067972 GAGGAAAGAATGGGTGAGGAAGG - Intergenic
931938061 2:67219775-67219797 GATAAGAGAATGACTGAGAAAGG - Intergenic
932090246 2:68799879-68799901 GAGGAGGGAAGGCCTGAGGCTGG + Intronic
932128812 2:69169085-69169107 GAGGAGACATGTGCTGAGTAGGG + Intronic
932307929 2:70717004-70717026 GAAGAGAGCAGGGCTGAACATGG - Intronic
932907218 2:75767182-75767204 GAGAAGAGAAGGGCAGAGAAAGG + Intergenic
932921326 2:75917809-75917831 GAGGAAATAAGGGTTGACAAAGG + Intergenic
933477918 2:82816445-82816467 GAGTGGAGTAGGGCTGAGACTGG - Intergenic
933617511 2:84497972-84497994 GAGAACGGAAGGGCTGGGAAGGG - Intergenic
933678207 2:85076656-85076678 AAGCAGGGCAGGGCTGAGAAAGG + Intergenic
933785525 2:85838220-85838242 GATGGGAGCAGGCCTGAGAATGG + Intergenic
933810971 2:86032483-86032505 GATGGGAGAAGGGGTTAGAAGGG - Intronic
934046553 2:88177639-88177661 GAGGAGGGCAGAGCAGAGAATGG - Intronic
934066612 2:88347633-88347655 GGGGAGAGAAGAGGTGAGATGGG - Intergenic
934153526 2:89172963-89172985 GAGGAGATGAGGGAGGAGAATGG - Intergenic
934213710 2:90008969-90008991 GAGGAGATGAGGGAGGAGAATGG + Intergenic
934564103 2:95328963-95328985 GAGGAGGGGAGGGCAGAGAATGG + Intronic
934571606 2:95376233-95376255 CAGGAGAGAGGGGCAGGGAAAGG - Intronic
934758033 2:96838454-96838476 GAGCAGGGAAGGGATGGGAAGGG + Exonic
934871645 2:97872004-97872026 AAGGAGAGAAGAGGAGAGAAAGG + Intronic
934935714 2:98463893-98463915 CAGGAGACAAGGGCTGTGCACGG - Intronic
935011552 2:99141194-99141216 GAGGAGAAAGGGGCGGAGGATGG - Intronic
935371771 2:102355622-102355644 GAGGAGGGGAGGGCTGAGGGTGG - Intronic
935443989 2:103137294-103137316 AAGGAAAAGAGGGCTGAGAATGG + Intergenic
935596616 2:104883579-104883601 GAAGAGAAATGGGATGAGAATGG - Intergenic
935684768 2:105673533-105673555 GGCGAGAGACTGGCTGAGAATGG + Intergenic
935691986 2:105740408-105740430 GAGAGCAGAAGGGGTGAGAATGG + Intergenic
936151609 2:110025024-110025046 GATGAGGGAAGGGATGGGAAGGG + Intergenic
936193065 2:110346345-110346367 GATGAGGGAAGGGATGGGAAGGG - Intergenic
936332468 2:111560191-111560213 GAGGAGATAAGGCCTGAATAAGG - Intergenic
936995072 2:118404787-118404809 GAGCAGAGAAAGGATGGGAATGG + Intergenic
937025747 2:118695902-118695924 GAGAAGAGAAGAGAAGAGAAAGG + Intergenic
937025770 2:118696123-118696145 GAGAAGAGAAGAGAAGAGAAAGG + Intergenic
937037261 2:118792555-118792577 GATGAGAGAAGGGGTTAGAAAGG + Intergenic
937043552 2:118838701-118838723 CAGGGGAGCAGGGCAGAGAAGGG - Intergenic
937088376 2:119187252-119187274 GAGGAGAAAGGGGCTGGAAATGG - Intergenic
937092514 2:119215914-119215936 GAGCAGAAAAGGGAAGAGAAGGG + Intergenic
937183044 2:120013146-120013168 GAGCCGAGCAAGGCTGAGAAAGG - Exonic
937344505 2:121116332-121116354 TAAGTGAGAGGGGCTGAGAAGGG + Intergenic
937626307 2:124047736-124047758 AAAGAGAGGAGGGCTGAGTAAGG - Intronic
937872126 2:126793467-126793489 AACATGAGAAGGGCTGAGAATGG + Intergenic
937972999 2:127564670-127564692 GAGCAGGGAAGGGCTTACAATGG + Intronic
938021460 2:127909014-127909036 CAGGAGAGAAGGGCACAGACTGG + Intergenic
938029930 2:127983419-127983441 GAGGAGAAATGGTCTGAAAATGG + Intronic
938030167 2:127985638-127985660 GAGTAGGGAAGTGCTGGGAAGGG + Intronic
938052804 2:128190635-128190657 GATGCGAGAGGGGCTGAGTATGG - Exonic
938309708 2:130281005-130281027 GAGTGGAGTAGGGCTGAGACAGG - Intergenic
938445216 2:131371363-131371385 GAGTGGAGTAGGGCTGAGACAGG + Intergenic
939966004 2:148610868-148610890 GTGCAGAGAAGGGCAGTGAAGGG + Intergenic
940128455 2:150354425-150354447 GTGAAGATGAGGGCTGAGAATGG + Intergenic
940152184 2:150614884-150614906 GAGGAGGGAAGGGCTAGAAATGG - Intergenic
940576015 2:155505287-155505309 GAGCAATGAAGGGCTGGGAATGG + Intergenic
940708828 2:157137243-157137265 GAGGAAACAAAGGCTCAGAAAGG - Intergenic
940946395 2:159623054-159623076 GAAGAGGGAAGGGAAGAGAAGGG + Intergenic
940962667 2:159802320-159802342 GGGGAAAGAAGGGTTGAAAAAGG - Intronic
941158891 2:162012814-162012836 GTGGAGAGATGGGCTGGGGAGGG - Intronic
941165858 2:162082357-162082379 GGGAAGAGAAGGGTGGAGAATGG + Intergenic
941239779 2:163022820-163022842 GAGGAGAGAAAGAATGGGAATGG - Intergenic
941365183 2:164602150-164602172 AAGGAGGGAAGGGAAGAGAAGGG + Intronic
941365185 2:164602160-164602182 GGGAAGAGAAGGGAAGAGAAGGG + Intronic
941377499 2:164750038-164750060 GAAGAGAAAAAGGCAGAGAATGG - Intronic
941705066 2:168649745-168649767 GAGGAGGGGAGGGAAGAGAAAGG - Intronic
941981599 2:171464350-171464372 GAAGCGAGAAGGGGTAAGAAAGG - Intronic
942017745 2:171833590-171833612 GAGAAGAGAAGGGTTGTGATAGG - Intronic
942231754 2:173866881-173866903 GAGGAGAGGAGCGCTGAGGCGGG - Intergenic
942643764 2:178089156-178089178 GAGGAGATAAAGGTCGAGAAAGG + Intronic
944037231 2:195309437-195309459 GAGAAGAGAAGGGGAGCGAAAGG - Intergenic
944330148 2:198456075-198456097 GAGCAGAGAAGGATGGAGAAGGG + Intronic
944395526 2:199262189-199262211 AAGGAGAGGAGGTCAGAGAAGGG + Intergenic
944613635 2:201437325-201437347 GAGGAGAGAAGGAGAGAGAGAGG - Intronic
944821896 2:203440435-203440457 GAGGAGGGAAGTCCGGAGAAGGG + Exonic
944933414 2:204544058-204544080 GAAGAGAGCTGGCCTGAGAATGG + Intergenic
945135576 2:206624195-206624217 GAGGAGACAAGGGCTGAGGGAGG + Intergenic
945393696 2:209296183-209296205 CAGGAGAGAAGGGCAGGGTAAGG - Intergenic
945447568 2:209956032-209956054 GAGGAGAAATAGGCTGAGTATGG - Intronic
946020015 2:216634256-216634278 GAGGAGGGATTTGCTGAGAAGGG + Intronic
946051677 2:216867915-216867937 TACAAGAGAAGGGCTGAGCAGGG + Intergenic
946093190 2:217248706-217248728 GAGGAGCCAAGGGCTATGAAAGG + Intergenic
946143332 2:217710350-217710372 GATGTGAGATGGCCTGAGAAAGG - Intronic
946314136 2:218898269-218898291 GAGGAGGGATGGGCGAAGAAGGG - Intronic
946519116 2:220446683-220446705 GAGGGGAGAAGGGGGGAGGAAGG - Intergenic
946664085 2:222031257-222031279 CAGGTGAGAAAGCCTGAGAAAGG + Intergenic
946685972 2:222270322-222270344 GGGGAGAGAAGCCCTGACAATGG - Intronic
946809845 2:223512204-223512226 GAGGAGTGGAGGGCTGAGAAAGG - Intergenic
947310841 2:228800022-228800044 GAGGACATAAAGCCTGAGAAGGG + Intergenic
947400830 2:229730085-229730107 GAGGAGAGAAGAGCTCATAATGG + Intergenic
947479233 2:230482406-230482428 GAAGAGGGAAAGGATGAGAAGGG - Intronic
947493922 2:230619144-230619166 GAGGAGAGGAGGGGAGAGGACGG + Intergenic
947671098 2:231935968-231935990 GAGGAGAGAAGGAAAGAGAGAGG - Intergenic
947998723 2:234549709-234549731 AAGGAGAGAAGGAGGGAGAAAGG - Intergenic
948011748 2:234654256-234654278 GAGGAGAAAAAGGCTGAGGGAGG + Intergenic
948088239 2:235268132-235268154 GAGGAGAGGAGGGATGGGGAAGG - Intergenic
948098402 2:235354676-235354698 TAGGAGAGGTGGGCAGAGAAAGG - Intergenic
948173943 2:235928590-235928612 GAGGAGAGCAGGGCGGAGAAGGG + Intronic
948358148 2:237397138-237397160 GAGAAGGGAAGGGAAGAGAAGGG + Intronic
948376151 2:237521804-237521826 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376162 2:237521865-237521887 GAGTGGAGCAGGGCTGAGACTGG + Intronic
948376171 2:237521926-237521948 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376192 2:237522048-237522070 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376203 2:237522109-237522131 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376214 2:237522170-237522192 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376235 2:237522292-237522314 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376246 2:237522353-237522375 GAGTGGAGCAGGGCTGAGACTGG + Intronic
948376255 2:237522414-237522436 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376277 2:237522536-237522558 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948376295 2:237522658-237522680 GAGCGGAGCAGGGCTGAGACTGG + Intronic
948689359 2:239692152-239692174 CTGGAGAGAAGCGCTGAGCAGGG + Intergenic
948857673 2:240737599-240737621 GAGGAGGGGAGGGATGGGAAGGG + Intronic
948861517 2:240754958-240754980 GAGGGGAGCAGGGCTGGGGAGGG - Intronic
1168855185 20:1002858-1002880 GAGGGGAGAAGGGGAGAGATGGG - Intergenic
1169650327 20:7859564-7859586 GTAGAGAGAAAGGATGAGAAGGG + Intergenic
1169781419 20:9314519-9314541 GTGGAGAGAATGCCAGAGAAGGG + Intronic
1170041609 20:12045281-12045303 GAGGAGGGAAGGGGTGAGGAGGG - Intergenic
1170041615 20:12045296-12045318 GAGGAGGGAAGGGGTGAGGAGGG - Intergenic
1170041621 20:12045311-12045333 GAGGAGGGAAGGGGTGAGGAGGG - Intergenic
1170041627 20:12045326-12045348 GAGGAGGGGAGGGGTGAGGAGGG - Intergenic
1170041634 20:12045341-12045363 GAGGAGGGGAGGGGTGAGGAGGG - Intergenic
1170155788 20:13268159-13268181 GAGGAGAGGAGAGGAGAGAAGGG - Intronic
1170369438 20:15632778-15632800 GAGGAGGGAAGGAAGGAGAACGG - Intronic
1170957820 20:20997530-20997552 AAGGAAAGAAGGGCTGAGCATGG - Intergenic
1170991384 20:21304551-21304573 GTGGAGAAATGGGATGAGAAGGG - Intronic
1171005618 20:21462713-21462735 GAGCAGAGCAGGGTAGAGAAGGG + Intergenic
1171044818 20:21800167-21800189 GAGCAGGGAAGTGCTGGGAAGGG + Intergenic
1171105029 20:22424861-22424883 CAGGAGAGAGAGGCTGTGAAGGG - Intergenic
1171107226 20:22445821-22445843 GCAGAGAGAATGGCGGAGAAGGG + Intergenic
1171206049 20:23282266-23282288 GAGAAGAGAAGGGAAGGGAAGGG + Intergenic
1171402193 20:24881235-24881257 GAGAAGAGAGGGGGTGAAAAGGG - Intergenic
1171971779 20:31569385-31569407 GAGCAGAGGAGGGCCAAGAAAGG - Exonic
1172055308 20:32150586-32150608 GAGGGAGGAAGGGCAGAGAAAGG - Intronic
1172121504 20:32601634-32601656 GGCAAGAGAAGGGCGGAGAAGGG + Exonic
1172163901 20:32887018-32887040 CAGGAGAGAGGGGCTTAGGAGGG + Intronic
1172510628 20:35498459-35498481 GATGAGTGAACTGCTGAGAAAGG + Intronic
1172569739 20:35960701-35960723 GGGAAGAGAAGGGAAGAGAAGGG - Intronic
1172569741 20:35960711-35960733 GGGAAGAGAAGGGAAGAGAAGGG - Intronic
1172569743 20:35960721-35960743 GGGAAGAGAAGGGAAGAGAAGGG - Intronic
1172569745 20:35960731-35960753 GGGAAGAGAAGGGAAGAGAAGGG - Intronic
1172569747 20:35960741-35960763 GGGAAGAGAAGGGAAGAGAAGGG - Intronic
1172569749 20:35960751-35960773 GGGAAGAGAAGGGAAGAGAAGGG - Intronic
1172569755 20:35960781-35960803 GGGAAGAGAAGGGAAGAGAATGG - Intronic
1172569756 20:35960791-35960813 GGGAAGAGAAGGGAAGAGAAGGG - Intronic
1172569766 20:35960826-35960848 GGGAAGAGAAGGGAAGAGAAGGG - Intronic
1172871947 20:38141599-38141621 GAGGGGAGAGGAGTTGAGAAGGG - Intronic
1173000321 20:39101071-39101093 GAGGAGGGGAGGGAGGAGAAAGG - Intergenic
1173301786 20:41809898-41809920 TAGCTGAGAAGGGCTGGGAAGGG + Intergenic
1173321254 20:41989268-41989290 GAGGAGGGAAGGGGAGAGAAAGG - Intergenic
1173333110 20:42092078-42092100 GAGGGTGGAAGAGCTGAGAAGGG + Intronic
1173427838 20:42958278-42958300 GAGGAGGGAAGGGGAGAGGAGGG + Intronic
1173500224 20:43547952-43547974 GAGGAGAGAAGGGGAGAGAAAGG - Intronic
1173666859 20:44769280-44769302 GAGGAGATGAAGGCTCAGAAAGG - Intronic
1173823888 20:46035240-46035262 GAGGAGAACAGGGGTAAGAATGG - Intronic
1173881183 20:46413525-46413547 GAGAAGAGAAGAGAAGAGAAGGG + Intronic
1173885765 20:46457655-46457677 GAGGTGAGCTGGGCTGAGGATGG - Intergenic
1174544854 20:51317644-51317666 GAGGAGAGGAGAGGAGAGAATGG + Intergenic
1175071120 20:56334731-56334753 GAGTAGAGAAGTGGAGAGAAAGG - Intergenic
1175087688 20:56473942-56473964 CAGGAGAGAATGGCAGGGAATGG + Intronic
1175142775 20:56873191-56873213 GAGAAGAGAAGGGAAGGGAAGGG + Intergenic
1175202461 20:57287437-57287459 GAAGAAAGAAAGGCTAAGAAGGG - Intergenic
1175220347 20:57412981-57413003 GAGGAGAGAGGAGCAGAGATAGG + Intergenic
1175298807 20:57928507-57928529 GAGGAGAAAAGGGAGGAGGAAGG - Intergenic
1175491631 20:59384226-59384248 GAGTAGAGCAGGGATGAGTAGGG + Intergenic
1175596443 20:60238499-60238521 GAGGAGCAATGGGCTGAAAATGG - Intergenic
1175659952 20:60803959-60803981 GAGAGGAGCAGGGATGAGAAGGG - Intergenic
1175877486 20:62237212-62237234 GGGGAGACAAGGCCTGAGGAGGG + Intronic
1175988631 20:62776751-62776773 GAGGAGGGCAGGGCGGAGGAGGG + Intergenic
1175999953 20:62827248-62827270 GAGGCGAGAGGGGCCCAGAAGGG + Exonic
1176102328 20:63370216-63370238 GGGGAGGGCAGGGCTGAGGAGGG - Intronic
1176241824 20:64079039-64079061 TAGGAGCTAAGGACTGAGAATGG - Intronic
1176245872 20:64096359-64096381 AAGCAGAGCAGGGCTCAGAACGG - Intronic
1176923628 21:14719984-14720006 AAGGAAAGAAGGGAGGAGAATGG - Intergenic
1176970853 21:15263874-15263896 CAGGAGAGAAGCAATGAGAAGGG - Intergenic
1177017671 21:15812951-15812973 GTACAGAGAAGGGCTGAGAGGGG - Intronic
1177109180 21:17003293-17003315 GGTGTGAGGAGGGCTGAGAATGG - Intergenic
1177311036 21:19393155-19393177 GAGGAGGGTAGAGATGAGAAGGG + Intergenic
1177434751 21:21036862-21036884 GAGAAGAGAAGGGCCAAGAGAGG + Intronic
1178020381 21:28401497-28401519 GAGGGGAGAGGGGCAAAGAAGGG + Intergenic
1178087849 21:29130675-29130697 AAGGAGAGAGGGGTTGTGAAGGG + Intronic
1178318654 21:31588177-31588199 GAGGAGGGAAGGGGAGGGAAGGG + Intergenic
1178481332 21:32981803-32981825 GGCGAGAGAAGGGGAGAGAAGGG - Intergenic
1178679038 21:34656538-34656560 AAAGAGATAAGGGCTAAGAAGGG - Intergenic
1178818675 21:35955095-35955117 GAGGAAAGCAGGGTGGAGAAGGG - Intronic
1179073156 21:38092047-38092069 GAAGACAGAAGGGCTAGGAAAGG - Intronic
1179084811 21:38207411-38207433 GAAGGGAGAAGGGAGGAGAAGGG - Intronic
1179084881 21:38207680-38207702 GGGGAGAGGAGGGGAGAGAAGGG - Intronic
1179365233 21:40752811-40752833 GAGGAGAGAAGGGGAGAAGAGGG + Intronic
1179677138 21:42990995-42991017 CAGGAGAGAAGGGTTGGGGAAGG + Intronic
1179913012 21:44460172-44460194 GAGGAGGGGACGGCAGAGAAAGG - Exonic
1179937491 21:44614506-44614528 GAGGAGAGAAGGGCAGACCAGGG - Intronic
1180104258 21:45607589-45607611 GAGGGGAGAAGGGAGGTGAAAGG + Intergenic
1180104279 21:45607649-45607671 GAGGGGAGGAGGGATGAGAAAGG + Intergenic
1180175408 21:46084758-46084780 GAGGAGAGAAGTCCTGTGATTGG - Intergenic
1180332536 22:11495544-11495566 GAAGAGAGAAGGAGTAAGAAAGG + Intergenic
1180862988 22:19097898-19097920 AAGACCAGAAGGGCTGAGAAAGG + Intronic
1181020540 22:20099527-20099549 CTGGGGAGAAGGGCTGGGAATGG + Intronic
1181390972 22:22580444-22580466 GAGGGGAGAGGGGCTGAGAGTGG - Intergenic
1181880142 22:25972635-25972657 GAGGAGACTAAGGCTGAGAGAGG + Intronic
1181891534 22:26067697-26067719 GAGGAGAGAAGAGATGAGACAGG - Intergenic
1181918187 22:26297728-26297750 GAGAAGAGAAGGAAGGAGAAAGG - Intronic
1181924701 22:26348829-26348851 GGGGAGGGAAGGGGAGAGAAGGG + Intronic
1182344363 22:29650611-29650633 GGGGAGAGAAGGGAAGGGAAGGG - Intronic
1182477304 22:30583171-30583193 GAGGAGAGGAGGGCTGGGGAAGG + Intronic
1182550883 22:31100197-31100219 GAGGAGAGCAGGACAGAGAAAGG - Intronic
1183094602 22:35544476-35544498 GAGGAGAGAAGGTCCCAGAGTGG + Intronic
1183153055 22:36053410-36053432 GAGAAGGGAAGGGAAGAGAAAGG - Intergenic
1183153093 22:36053533-36053555 GAAGGGAGAAGGGATGGGAAGGG - Intergenic
1183153107 22:36053579-36053601 GAAGGGAGAAGGGATGGGAAGGG - Intergenic
1183153119 22:36053615-36053637 GAAGGGAGAAGGGATGGGAAGGG - Intergenic
1183153203 22:36053864-36053886 GGGGAGGGAAGGGCAGGGAAGGG - Intergenic
1183166140 22:36148696-36148718 GAGGTGCGGAGGGCTGAGAGAGG - Intronic
1183180663 22:36257733-36257755 GAGGAGAGGAGGGCTGGGAGAGG + Intronic
1183302824 22:37066659-37066681 GAGGAGACTGGGGCTTAGAAAGG - Intronic
1183360144 22:37379073-37379095 GAGGAGGTGAGGACTGAGAATGG + Intronic
1183361207 22:37384410-37384432 GGGGAGAGAAGGGGTGAGGGAGG - Intronic
1183413745 22:37671134-37671156 GAGGTGAGAATGGATGAGCAGGG + Intergenic
1183422931 22:37722854-37722876 GTGGAGAGAAGTGTTGACAATGG - Intronic
1183668356 22:39257750-39257772 AGGGAGAGAAGGGCTGAGGCTGG - Intergenic
1183780953 22:39998518-39998540 GAGGGGGGAGGGGCTGAGGATGG + Intronic
1184122487 22:42461260-42461282 GAGCAGAGACGGGCTTGGAAGGG + Intergenic
1184204616 22:42994223-42994245 GTGGTAAGAAGGGCTGAGCAGGG + Intronic
1184263041 22:43330200-43330222 GAGGAAACCAGGGCTCAGAATGG + Intronic
1184373425 22:44097174-44097196 GAGAAGAAAAGGGCTGTGAGAGG - Intronic
1184377202 22:44121290-44121312 AAGGAAAGAAGGGCTGAGCATGG - Intronic
1184437578 22:44488854-44488876 GAGGAGAGGAGGGGAGAGGAGGG + Intergenic
1184697175 22:46146474-46146496 GAGAAGAGAAGAGAAGAGAAGGG + Intergenic
1184717707 22:46291296-46291318 GTGGACAGGAGGGCTGAGGATGG + Intronic
1185426581 22:50775214-50775236 GCCGAGGAAAGGGCTGAGAAAGG - Intronic
949221772 3:1642907-1642929 GGGGAGAGAAGGGAAGGGAAGGG + Intergenic
949897200 3:8776765-8776787 GAGGAGAGATGGGCTGCCTAAGG - Intronic
950011685 3:9728737-9728759 GGGGGGAGAGGGGCTGATAAGGG - Intronic
950078583 3:10205294-10205316 GAGGAGGGGAGGGCTGGGTAGGG + Intronic
950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG + Intergenic
950441531 3:13013614-13013636 AAGGAGAGTAGGGCAGAGGAAGG - Intronic
950836858 3:15928603-15928625 GAGAAGAGAAGGCAGGAGAATGG + Intergenic
951584250 3:24198916-24198938 GAGGATAGAGTGGATGAGAAAGG + Intronic
952054927 3:29432803-29432825 GAGTAGAGTGGGGCTGAGAATGG + Intronic
952120801 3:30241954-30241976 GAGGAGAAAGGGGCTGACATGGG - Intergenic
952206485 3:31185663-31185685 GAGGAGAGAAGTGGAGAGAAAGG - Intergenic
952958443 3:38575231-38575253 GAGGAGGGGAGGGCAGGGAAAGG - Intronic
953077226 3:39581859-39581881 GAGGAGAGGAGAGGTCAGAAGGG + Intergenic
953588345 3:44226420-44226442 GAGGAGAGAAAGGCTGTGATTGG + Intergenic
953687536 3:45089823-45089845 GAGAAGAGAAGAGCAGAGGAGGG + Intronic
953794572 3:45974701-45974723 GAAGAGAGAAGGGAGGAGAGAGG - Intronic
953828097 3:46271617-46271639 GAGGAGAGGAGGAGAGAGAACGG + Intergenic
954171306 3:48804771-48804793 GAGGAGAGGAGGTCAAAGAATGG + Intronic
954293804 3:49663201-49663223 GAGCAGAGCTGGGCTGAGAGTGG - Exonic
954898412 3:53997099-53997121 GGGGAGGGAAGGGCAGGGAAGGG - Intergenic
955012018 3:55026722-55026744 GAGGGGACAAGGGCTGATCAAGG + Intronic
955290678 3:57689770-57689792 GATCAGAGAAGGGCTGGGCATGG + Intronic
955812465 3:62805676-62805698 GAGGGGAAAAGGGAAGAGAATGG - Intronic
955922180 3:63968771-63968793 GAAGACAGAAGGTCTGAGACAGG - Intronic
956109419 3:65855616-65855638 GAGGAGAGAGGGGAGGGGAAGGG + Intronic
956436255 3:69237218-69237240 GAGGAGGGAGGGGCCGGGAAAGG + Intronic
956744659 3:72301827-72301849 TAGGAAAGATGGGCTGAAAAGGG + Intergenic
956778548 3:72586774-72586796 GGGCAGAGAAGTGCTGGGAAGGG + Intergenic
957356189 3:79090416-79090438 GAGGAGGGAAGGGAAGGGAAAGG - Intronic
957469113 3:80635660-80635682 GAGGAGAGGAAGGCAGACAAGGG + Intergenic
957683444 3:83469787-83469809 GAGGAGAGGAGAGATGAGAGAGG + Intergenic
957818289 3:85332126-85332148 GTTGAGACAACGGCTGAGAAGGG + Intronic
957842592 3:85691061-85691083 GGGGAGGGAAGGGCAGAGTAGGG - Intronic
958164493 3:89862283-89862305 GAGGAAAGAAAGCCTGTGAAGGG - Intergenic
958714449 3:97763357-97763379 GAGGATAGAAGCACGGAGAAGGG + Intergenic
958734561 3:97993734-97993756 GGGGAGGGAAGGGAGGAGAAAGG - Intronic
958807652 3:98831339-98831361 GAAGAGAGAAGGGCCAAGAGCGG - Intronic
959117122 3:102191595-102191617 GGTAAGAGAAGGGCTGGGAAAGG - Intronic
959587552 3:108039302-108039324 GAGGAGAGCAGGGCTGTGGTGGG - Intergenic
959874366 3:111364401-111364423 TAGGACAGAAGTGCTAAGAAAGG + Intronic
959962415 3:112313775-112313797 TTGGAGAGAAGGACTGAGAGTGG + Intergenic
960123079 3:113967238-113967260 GAGATGTGAATGGCTGAGAATGG - Intronic
960222371 3:115128754-115128776 GGGGAGGGAAGGGATGGGAAGGG + Intronic
960264831 3:115608923-115608945 GAGGTGAGAAAGGATGAGATGGG - Intergenic
960536116 3:118816132-118816154 GAGAAGAGGAAGGCAGAGAAAGG - Intergenic
960623753 3:119660649-119660671 GAGGAGAGAGGGGGGGAGAGGGG - Intronic
960830062 3:121836317-121836339 GAGAACAGAATGACTGAGAAAGG - Intronic
961009013 3:123423782-123423804 GAGGAAAGAAGGGCAGGGGAGGG + Intronic
961215470 3:125156596-125156618 GATGAGAGGTGGGATGAGAAGGG + Intronic
961425910 3:126847727-126847749 GAGGAGAGAGAGGGAGAGAATGG - Intronic
961635689 3:128331119-128331141 GAGGGGAGATGCACTGAGAAGGG - Intronic
961710452 3:128824220-128824242 AACCAGAGAAGGCCTGAGAAGGG + Intergenic
961756440 3:129129961-129129983 GAGGGAAGGAAGGCTGAGAATGG + Exonic
961890582 3:130127201-130127223 CAGAAGGGAAGGGCTCAGAAGGG - Intergenic
961901144 3:130213114-130213136 GAGGAAAGGAGGCCTGAAAAGGG + Intergenic
962027768 3:131566715-131566737 TAGGAGTAAAAGGCTGAGAATGG - Intronic
962314660 3:134351558-134351580 GAGGAGAAAAGAGATGAGAAAGG + Intergenic
962477762 3:135771594-135771616 GGGCAGAGAGGGGCTGAGAGTGG + Intergenic
962572445 3:136724160-136724182 GAGGGGAGAAAGGCGGGGAAAGG + Intronic
962865894 3:139447889-139447911 GAGGAGAAAAGAGCAGAGGAGGG - Intergenic
962952504 3:140232423-140232445 GGGGAGAGATGGGCAGAGTAGGG - Intronic
963801743 3:149683211-149683233 GAGGAAAGTAAGGCTCAGAAAGG + Intronic
963863025 3:150330392-150330414 GAGGAGAGAAGAGGTGAGGAGGG + Intergenic
963863944 3:150340326-150340348 GAAGAGAGAAGGGCAAGGAAAGG + Intergenic
963938477 3:151077887-151077909 GAGTAGAGACTGGCTGAGTAAGG - Intergenic
964477048 3:157106727-157106749 GTGGAGAGAAGAGGTGAGAGTGG - Intergenic
964517063 3:157523028-157523050 GAGGGGAGAAAGGCAGAGAAAGG - Intronic
964645112 3:158950646-158950668 GAGGAAAGAAGGGCTCCGAGAGG + Intergenic
965034500 3:163421000-163421022 GAGGAGAGAGAGGCTGGAAAGGG - Intergenic
965931524 3:174049403-174049425 AAGGAGAAAAGGGTTGAGCAGGG + Intronic
966165396 3:177010957-177010979 GAGTGGAGTAGGGCTGAGACGGG + Intergenic
966339131 3:178905661-178905683 GAGAAGAGAAGAGAAGAGAAGGG - Intergenic
966659706 3:182400634-182400656 GAGGAGAGAAGGAAAGAGAGGGG + Intergenic
966676913 3:182599572-182599594 GAGGAGAGAAGGCCTGGAGAAGG - Intergenic
967448753 3:189598245-189598267 GAGGAGAGGAGGGGAGAGGAAGG + Intergenic
967458249 3:189715115-189715137 GAGAGGAGAAGGGAGGAGAAAGG - Intronic
968336499 3:197918023-197918045 GAGGAGAAATGGGCTGGGCATGG - Intronic
968596165 4:1486813-1486835 GAGGAGAGCAGGGCTGTGGGAGG - Intergenic
968742223 4:2337045-2337067 GAGGAGTGAGGGGGTGAGGAAGG + Intronic
968844269 4:3031239-3031261 GACGTGAGCAGGGCTGTGAACGG + Intronic
968937502 4:3619814-3619836 GGGGCCAGAAGGGCTGAGACTGG + Intergenic
969031999 4:4222987-4223009 GAGGAAAGCAGGACTCAGAAAGG + Intronic
969226258 4:5800501-5800523 GAGGAGAGAAGGGGTGGCCAAGG + Intronic
969356330 4:6628848-6628870 GAGCAGGGAGGGGCTGAGAAGGG + Intergenic
969495262 4:7522866-7522888 GAGGAGGGAAGAGGGGAGAAAGG - Intronic
969517266 4:7654668-7654690 CAGGAGAGCAGGGCTGAGGCAGG - Intronic
969563388 4:7963436-7963458 CTGGGGAGAAGGGCTGAGGATGG + Intergenic
969639300 4:8387467-8387489 CAGAAGAGAAGGGCCGAGAGGGG - Intronic
969664386 4:8548724-8548746 GAGGAGAGGAGAGCGGAGAGAGG - Intergenic
969832565 4:9809483-9809505 GTGGAGAGAAGGGAGCAGAATGG + Intronic
969922853 4:10557270-10557292 GCGGAGAGCAGGGTAGAGAAGGG - Intronic
970446238 4:16125371-16125393 GAGGATAGAATGGGTGAAAATGG + Intergenic
970499111 4:16658842-16658864 GAGGACAGTAAGGCTCAGAAGGG + Intronic
970540178 4:17069880-17069902 GAGGAGAGAAGGGAAGGGAAGGG + Intergenic
970590419 4:17555284-17555306 GAGGAGAGAAGGTGAGTGAAAGG - Intergenic
970667939 4:18359309-18359331 CAGGAGATAAGGGCTGAGTTGGG + Intergenic
970689996 4:18611683-18611705 GAGGAAGGAAGGGGGGAGAAAGG + Intergenic
970690074 4:18611905-18611927 GAGGAAGGAAGGGGGGAGAAAGG + Intergenic
970690160 4:18612143-18612165 GAGGAAGGAAGGGGGGAGAAAGG + Intergenic
970690246 4:18612381-18612403 GAGGAAGGAAGGGGGGAGAAAGG + Intergenic
971425286 4:26509539-26509561 GAGGAAAGAAGGGAAGAGAGCGG - Intergenic
971658389 4:29379868-29379890 GAGAAGAGGAGAGATGAGAAAGG - Intergenic
971694488 4:29881706-29881728 GAAGAGAGAATTGCAGAGAAAGG - Intergenic
972147294 4:36043788-36043810 GAGAAGAGAAGGGAAGGGAAGGG + Intronic
972301996 4:37793155-37793177 GGGGATTGAAGGGCAGAGAAGGG + Intergenic
972301998 4:37793165-37793187 GGGCAGAGAAGGGCAGAGAAGGG + Intergenic
972345791 4:38191205-38191227 GAGGAAAGAAGGGAGGAGAGAGG + Intergenic
972604715 4:40603572-40603594 GAGGAGAGAAGAGGAGAGGAGGG - Intronic
972771585 4:42202448-42202470 GAGAAGAGAAGAGCAGAGCAAGG + Intergenic
972810855 4:42584272-42584294 GAGGAGAAAAGAGGGGAGAAGGG + Intronic
972947758 4:44278754-44278776 GAGGTCAGAAAGGATGAGAACGG - Intronic
972956744 4:44401619-44401641 GAGGAGACCAAGGCTCAGAAAGG - Intronic
973262717 4:48181027-48181049 GAGTAGAGAAGGACTGAGGGGGG + Intronic
973340603 4:48999645-48999667 GAGGAGATGAGGGCTGTGCATGG + Intronic
973739090 4:53901911-53901933 GAGGAAAGAAGGAAGGAGAAGGG + Intronic
973746096 4:53964964-53964986 GAGGAGAGAATGAGAGAGAAAGG - Intronic
973849251 4:54945183-54945205 GAGGACAGAAGGGAAGAGGAGGG + Intergenic
974019522 4:56680389-56680411 GAGGTGGGAAGGGAGGAGAAGGG - Intronic
974237775 4:59204485-59204507 GAGGAGGGGAGGGGAGAGAATGG - Intergenic
974283392 4:59830171-59830193 CAAGACAGAAGGGCAGAGAAAGG + Intergenic
974375373 4:61069828-61069850 GAGGACAGAGGAGCAGAGAAGGG - Intergenic
974375568 4:61071802-61071824 GAGGACAGAGGTGCAGAGAAGGG - Intergenic
974392699 4:61293071-61293093 TAGCAGAGCAGGGCTGAGCAGGG + Intronic
974703345 4:65480132-65480154 GAAGAGAGAAAGGATGAGAGAGG + Intronic
974753782 4:66176820-66176842 GAGGAGAGAAGGGAGAACAAGGG + Intergenic
975372818 4:73607927-73607949 GAGGAGAGGAGAGGAGAGAAGGG - Intronic
975372837 4:73607995-73608017 GAGGAGAGGAGAGGAGAGAAGGG - Intronic
975373392 4:73613861-73613883 GAAGAAAGGATGGCTGAGAATGG - Intronic
975630989 4:76402177-76402199 GAGGAGAGAGGGGCAAGGAAGGG + Intronic
975672654 4:76797534-76797556 TAGGAGGGAATGGGTGAGAATGG - Intergenic
976040567 4:80880125-80880147 GAGGAGGGAAGCGGGGAGAAAGG + Intronic
976205525 4:82619934-82619956 GAGGAGAGGAGGGGAGAGGAGGG + Intergenic
976258624 4:83124824-83124846 GAGGAGAGGAGGGCAGGGGAGGG + Intronic
976290083 4:83408968-83408990 GGGGAGAGAATGGGTGAAAAGGG + Intronic
976350720 4:84056896-84056918 GAGTAGAGAAGGGAGGAGAGGGG - Intergenic
976789131 4:88857745-88857767 GAAGAGAGAGGAGCTGAGAGGGG - Intronic
976896074 4:90113442-90113464 GAGAACAAAAAGGCTGAGAAAGG + Intergenic
977654933 4:99509946-99509968 GGGGAGGTAAGGGCTGACAAGGG - Intergenic
978072435 4:104490696-104490718 GAGGAGGGAAGGGGGGAGACTGG + Intronic
978143441 4:105343818-105343840 GATGAGAGAAGCGCAGAGAAGGG - Intergenic
978170057 4:105659084-105659106 AAGGACAGCAGGGCTGACAAGGG - Exonic
978350144 4:107812729-107812751 GTAGAGAACAGGGCTGAGAAGGG - Intergenic
978624323 4:110667216-110667238 GAGGAGAGAAGGGTTGAGGCAGG + Intergenic
978902598 4:113970662-113970684 GAGGAGAGAGGGGCTGGGCAAGG + Intronic
978964532 4:114725394-114725416 GAGAAGAAAAGGGCAGAGAGAGG - Intergenic
979305527 4:119138682-119138704 AAGGAGAGAAGGCAGGAGAAGGG - Intronic
979766469 4:124470299-124470321 GAAGAGAGAAGAGCAAAGAAAGG - Intergenic
979831550 4:125311620-125311642 GAGGAGGGAAGGGGAGAGAAGGG + Intergenic
980630891 4:135431693-135431715 GAAGAGAGAAAGCCAGAGAATGG + Intergenic
980638079 4:135535879-135535901 GAGGAGAGGAGGGGAGGGAAGGG + Intergenic
980823558 4:138047055-138047077 GGGCAGGGAAGTGCTGAGAAGGG + Intergenic
980844909 4:138312805-138312827 GAGGAGAAAGGGGCAGGGAAGGG - Intergenic
981396149 4:144252331-144252353 GAGGGAAGAAAGGCTGAAAATGG + Intergenic
981601068 4:146489282-146489304 TAACAGAGAAGGGCAGAGAAGGG + Intronic
981636474 4:146886565-146886587 GAGGAGAGAAGGCCTGATAAAGG + Intronic
982137302 4:152283910-152283932 GAGGAGAGCAGTGCTGAGCAAGG + Intergenic
982400832 4:154966128-154966150 GAGGGGAGAATGACTCAGAAGGG - Intergenic
982442573 4:155454109-155454131 GAGTGGAGTAGGGCTGAGACTGG + Intergenic
982689793 4:158535119-158535141 GAGGAGAGAAGGGCACTGCAAGG + Intronic
982829757 4:160044610-160044632 GAGTGGAGTAGGGCTGAGACTGG + Intergenic
983139738 4:164135518-164135540 AATGAGAGAAGTGCAGAGAAGGG + Intronic
983453362 4:167933480-167933502 GAAAAGAGAAAGGATGAGAATGG - Intergenic
983484896 4:168321957-168321979 GAAAAGAGAAGGGCTGAAATCGG - Intergenic
984301611 4:177926930-177926952 GAAGAGAGAAAGGGTGAGGAGGG + Intronic
984349071 4:178568745-178568767 GAGGAGAAAAGGGGAGAGTAGGG - Intergenic
984762082 4:183371087-183371109 AAGTACAGAAGGGCTGACAAGGG + Intergenic
984778216 4:183502986-183503008 GATGAGAGGAGGGATGAGCATGG - Intergenic
984817380 4:183851147-183851169 GATGAGAGAAACGATGAGAAAGG + Intergenic
984859126 4:184220479-184220501 GAGAAGAGAAGGGAAGGGAAAGG + Intronic
984911478 4:184677029-184677051 GAGGGGAGAAGGGAAGGGAAGGG - Intronic
985265302 4:188151076-188151098 AATGAGAGTGGGGCTGAGAAGGG + Intergenic
985265960 4:188153475-188153497 GGGGAGAGTGGGGGTGAGAAGGG + Intergenic
985550032 5:528284-528306 GAGGGGCGAAGGGCTGGGGACGG + Intergenic
986035092 5:3929751-3929773 GAGAAGTGAAGGGAGGAGAAGGG + Intergenic
986266003 5:6190965-6190987 GAGTGGAGAAGGGTAGAGAATGG - Intergenic
986434937 5:7720161-7720183 GGGGAGAGAAGAGGAGAGAAGGG - Intronic
986622686 5:9692008-9692030 GATGAGAGGACAGCTGAGAATGG - Intronic
986760408 5:10875154-10875176 GAGGAGAGAAAGATTGATAAGGG - Intergenic
986808524 5:11331780-11331802 GAGGAGGGATGGGCAGAGATTGG + Intronic
987136350 5:14903051-14903073 GAGCACAGATGGTCTGAGAAAGG - Intergenic
988358879 5:30210490-30210512 GAGGGGAGGAGGGGAGAGAAAGG - Intergenic
988874615 5:35430229-35430251 GAGGAGGCATGGGCAGAGAACGG - Intergenic
989069688 5:37497348-37497370 GAAGAGGGAAGGGAAGAGAAGGG - Intronic
989356804 5:40552564-40552586 GAGCAAAGTAGGGCAGAGAAAGG + Intergenic
989487977 5:42013903-42013925 GAGGAGACAAGATCTGAGAATGG + Intergenic
989697863 5:44224864-44224886 GAGCAGAAAAGGGCAGAAAATGG - Intergenic
990301944 5:54458326-54458348 GGGCTGAGAAGGGCAGAGAATGG - Intergenic
990461827 5:56037793-56037815 GAGAGGAGCAGAGCTGAGAAGGG - Intergenic
990493363 5:56322821-56322843 GAGGAGAGAAGAGCAGCGAGGGG - Intergenic
990510755 5:56487317-56487339 GAGGAGACTAAGGCTGAGAGAGG + Intergenic
990528536 5:56651983-56652005 GAGTAGAGAAGGAGGGAGAAGGG + Intergenic
990671007 5:58130252-58130274 GGGGAGAGAAGGGAAGGGAAAGG - Intergenic
990837068 5:60034073-60034095 GAGTAGAGAAGTTGTGAGAAAGG + Intronic
991436738 5:66603995-66604017 GATGAGAGAAGGGTGAAGAAAGG - Intronic
991594326 5:68287674-68287696 AAGGATAGAAGGGCAGAGAAGGG - Intronic
991660155 5:68943006-68943028 GAGAAGAGAAGGGAGGAGAGAGG - Intergenic
992071060 5:73149750-73149772 GAGGAGAGATAGGCTGCAAAGGG + Intergenic
992201850 5:74392689-74392711 GACCAGACAAGGGGTGAGAAGGG - Intergenic
992558560 5:77927818-77927840 GAGAAGGGAAGGGAAGAGAAGGG + Intergenic
992684054 5:79181992-79182014 GAGGAAAGAGAGGCTGAGGAGGG - Intronic
992952119 5:81869789-81869811 GAGGAGAAAAGTGATTAGAAAGG + Intergenic
993201262 5:84818199-84818221 AAGGAGAGAAGGGGAGGGAAGGG - Intergenic
993926409 5:93871918-93871940 GAGGAAGGGAGGGATGAGAAAGG + Intronic
994078602 5:95681251-95681273 TAGGATAGAAGGGTTGAGATAGG - Intronic
994458738 5:100048040-100048062 GAGTGGAGTAGGGCTGAGACAGG + Intergenic
994682169 5:102901852-102901874 GAGGGAGGAAGGGATGAGAAGGG + Intronic
994721808 5:103389249-103389271 GAGGAAAGCAGGGCTGATCAGGG + Intergenic
994722934 5:103401464-103401486 GAAGAGAGAAGGGCTGGAAATGG + Intergenic
994999998 5:107115650-107115672 GAGAAGGGAATGACTGAGAAGGG - Intergenic
995054369 5:107743071-107743093 GAGGACAGAAAGAATGAGAATGG + Intergenic
995157313 5:108930578-108930600 GAGGAGGGGAGGGCAGAGGAGGG - Intronic
995755879 5:115503343-115503365 ATGGAGAGAAGGGCTGGTAATGG + Intergenic
996585892 5:125088196-125088218 GATGACAGAAGAGATGAGAAAGG + Intergenic
996603467 5:125293234-125293256 GCTGAGAGCAGGGTTGAGAAGGG + Intergenic
996603468 5:125293244-125293266 GGGTTGAGAAGGGCTGAGAGTGG + Intergenic
996872239 5:128204138-128204160 GAGGCAAGAAGAGCTGAGAGTGG + Intergenic
997348201 5:133209364-133209386 AAGGTGAGAAGGGCTGCAAATGG - Intronic
997464008 5:134074634-134074656 GAGGAGAAGAGGCCTGGGAAGGG - Intergenic
997528896 5:134570299-134570321 CAGGAGGGAAGGGAAGAGAATGG - Intronic
997570784 5:134925714-134925736 GAGTGGAGTAGGGCTGAGACAGG + Intronic
997759143 5:136428174-136428196 GGGGAGAGGAGGGGAGAGAAGGG - Intergenic
997885812 5:137629047-137629069 GAGGAGAGAAGTGGGCAGAAAGG - Intronic
998671238 5:144356718-144356740 GTGGGGAGAAAGGCTGGGAAAGG + Intronic
998934071 5:147215871-147215893 TGGGAGAGAAGGGCTAGGAAGGG + Intergenic
999274861 5:150323472-150323494 TAGGAGAGAAGGGGTGAGTTGGG + Intronic
999321552 5:150618479-150618501 GAGGAGAGCAGCGGTGAGGAGGG + Exonic
999748379 5:154608939-154608961 GAGGAGGGAAGGGGTCTGAAAGG - Intergenic
999939487 5:156526117-156526139 GAGTAGAGAATGGCTGTAAAGGG - Intronic
999973719 5:156890252-156890274 GTGCAGAGATGGGCTGAGAGGGG - Intergenic
1000010900 5:157231572-157231594 GAGGAGAGAAGTTCTGGGTAGGG - Intronic
1000057051 5:157616333-157616355 AAGGACAAAAGGGCAGAGAAGGG + Intergenic
1000166627 5:158655970-158655992 GAGTGGGGAAGGGCTGAGTAAGG - Intergenic
1000296585 5:159917506-159917528 GAGGAGAAGAGGGCATAGAAGGG - Exonic
1001295622 5:170496824-170496846 GAGCAGAGCAGGGCTGAGGTGGG - Intronic
1001328644 5:170746859-170746881 GAGGAGACAGGGGCTCAGAGAGG - Intergenic
1001477837 5:172063748-172063770 GAGGAAACAAAGGCTGAGAGAGG - Intronic
1001681864 5:173563814-173563836 GAGGGGACCAAGGCTGAGAAGGG - Intergenic
1001913317 5:175539056-175539078 GAGGACAGAGGGCCAGAGAAAGG - Intergenic
1002191712 5:177481731-177481753 GAGACGAGAAGGGCTGGGCACGG - Intergenic
1002594581 5:180313673-180313695 GCGGAGAGAAGGGGTGAGGCGGG + Intronic
1002660975 5:180791058-180791080 AAGGAGAGAAGGGCTAAGTGGGG + Exonic
1003480301 6:6525111-6525133 GCGGGGAGCAGGGCTGGGAAGGG + Intergenic
1003567094 6:7230852-7230874 CAGGGAAGAAGGGCTCAGAAAGG - Exonic
1003777287 6:9382214-9382236 GAGGAGAGAGAAACTGAGAAAGG - Intergenic
1003868372 6:10383009-10383031 GCAGAGAGAGGGGCGGAGAAAGG + Intergenic
1004114262 6:12750424-12750446 AAGGAGAGAAGAAATGAGAAGGG + Intronic
1004288578 6:14345955-14345977 GAGGAGAGAGGGGAGGAGGAAGG + Intergenic
1004601034 6:17150186-17150208 GAGGGGAGAAGGGCTGGAAATGG - Intergenic
1005262020 6:24071437-24071459 GAGGAGACATGGGCAGTGAATGG + Intergenic
1005310686 6:24556178-24556200 GGGGAGAGGAGGGCAGAGGAGGG - Intronic
1005688240 6:28276197-28276219 GAGGAGACAAGGATTGAGAATGG + Exonic
1005950506 6:30627768-30627790 GATGGGGGAAGGGCTGAGGAAGG - Intronic
1006337706 6:33429013-33429035 TAGGAGAGAAGGAATGAGAGAGG + Intronic
1006340151 6:33442508-33442530 GAGGAGAGGAGGGCGGGGGAGGG - Intronic
1006797111 6:36738826-36738848 GAGAAGAAAAGGGCTCTGAAAGG - Intergenic
1006806827 6:36794197-36794219 GAGGAAAGAGGGGGAGAGAAGGG + Intronic
1006813990 6:36838854-36838876 GAAGAGAGGAGGGCACAGAAGGG + Intronic
1006822906 6:36912694-36912716 GAGTTGAGACTGGCTGAGAAAGG + Intronic
1006965329 6:37977883-37977905 GAGGAGAGGAGAGGAGAGAAAGG - Intronic
1007106882 6:39289519-39289541 GAAGAAAGAAGGGCTGAAATGGG + Intergenic
1007162890 6:39806628-39806650 GAGGAAAGAAGGGTTGAGGATGG - Intronic
1007254806 6:40521169-40521191 GAGGAGAGAAGAGAGGAGGAGGG + Intronic
1007369224 6:41415242-41415264 GAAGAGAGAAAGGCTCAGAGAGG - Intergenic
1007472251 6:42098623-42098645 GAGCAGAGCAGGGCTGGGGAAGG + Intergenic
1007520956 6:42451741-42451763 AAGGGGAGCAGGGCTGGGAAAGG - Intronic
1007726078 6:43916425-43916447 GAGAAGAGGAGGGCTGTGAGGGG - Intergenic
1007729730 6:43938686-43938708 GAGGAGAGGATGGATGGGAAAGG - Intergenic
1007736728 6:43986657-43986679 GAGGAGGGACGTGCTGATAAAGG + Intergenic
1007878111 6:45130176-45130198 GCTGAGAGAGGGGGTGAGAATGG - Intronic
1007905142 6:45452374-45452396 GAGCAGAGCAAGTCTGAGAAAGG + Intronic
1007926740 6:45655861-45655883 GGGGAGGGAGGGGGTGAGAAGGG - Intronic
1007950269 6:45866017-45866039 AAGGAGAGAAGGGAAGGGAAGGG - Intergenic
1008286190 6:49654071-49654093 GAGGGGAGAAGGGAAGGGAAGGG - Intergenic
1008286210 6:49654114-49654136 GAGAAGAGAAGGGAAGGGAAGGG - Intergenic
1008385105 6:50880318-50880340 GAGGAGGGAAGGGAAGAGGACGG - Intergenic
1008503927 6:52210757-52210779 GAGGAGAGAAGGGGGAAGAAGGG - Intergenic
1008667415 6:53729679-53729701 GGGGAGATCAGGGCTGAGTAAGG + Intergenic
1009245912 6:61237410-61237432 AAGGACAGAAGGGCAGAGCAAGG - Intergenic
1009302848 6:62048970-62048992 GAGAAGAGAAGAGAAGAGAAGGG - Intronic
1009390689 6:63140070-63140092 GAGGAGAGAAGAGGTAAAAATGG + Intergenic
1010062853 6:71645373-71645395 AAGGAGAGAGGGAGTGAGAAAGG + Intergenic
1010062868 6:71645429-71645451 GGGGAGAGAGGGAGTGAGAAAGG + Intergenic
1010062874 6:71645457-71645479 GGGGAGAGAAGGAGCGAGAAAGG + Intergenic
1010062881 6:71645483-71645505 GGGGAGAGAGGGAGTGAGAAAGG + Intergenic
1010153830 6:72768349-72768371 GAGGAGAGAAAAGGTGAGGAAGG + Intronic
1010248966 6:73688664-73688686 GAGGGGAGAAGGGCTGGAAATGG + Intergenic
1011200938 6:84835454-84835476 GGGCAGAGCAGGGCAGAGAATGG - Intergenic
1011824092 6:91286364-91286386 CAGGAGAGAGAGGCTGAGTATGG + Intergenic
1012520738 6:100118341-100118363 GAAGAGAGAAGGGATGTTAAGGG - Intergenic
1012682079 6:102195042-102195064 GGGGAGAGAAGGGTGGAGAGAGG + Intergenic
1012827361 6:104163038-104163060 CAGGAGAGAAGGCCTGAAACTGG - Intergenic
1013274998 6:108576113-108576135 GGAGAGAGAAGGGCTGATCAAGG - Intronic
1013358167 6:109365385-109365407 GAGGAGAAAAGGGCTGGGGATGG + Intergenic
1013445895 6:110226539-110226561 GAGGAGAGGAGGGGAGAGGAGGG - Intronic
1013588391 6:111599363-111599385 GAGTAGAGAAGCCCAGAGAAAGG - Intronic
1014099585 6:117496441-117496463 TAAGAGAGTAAGGCTGAGAATGG + Intronic
1014213956 6:118735454-118735476 GAGGAAAGGAACGCTGAGAAGGG - Intergenic
1014252356 6:119127754-119127776 GGGGAGAGAAAGGTTGAGAAGGG + Intronic
1014348079 6:120300971-120300993 CTGGAGAGAAAGGCTGAAAATGG - Intergenic
1014511004 6:122322243-122322265 GAAGGGAGAAAGACTGAGAAAGG + Intergenic
1014605567 6:123469756-123469778 CAAGAGAGAAAGGCAGAGAATGG + Intronic
1014677025 6:124379262-124379284 GAGGAGAGAAAGGAGGAGAGAGG + Intronic
1014704854 6:124733159-124733181 GAGGAGAGGAAGGTTGAGTAGGG + Intronic
1014736019 6:125097115-125097137 GCAGAGACAAGGGCTCAGAAAGG + Intergenic
1015071906 6:129104765-129104787 GTGGAGTGGAGGGCAGAGAAGGG - Intronic
1015131309 6:129813272-129813294 AAGGTGAGAATGGCTGGGAATGG - Intergenic
1015489788 6:133812457-133812479 GAGGAGGGAAGGGGAGGGAAGGG + Intergenic
1015489801 6:133812487-133812509 GAGGAGGGAAGGGGAGGGAAGGG + Intergenic
1015489814 6:133812517-133812539 GAGGAGGGAAGGGGAGGGAAGGG + Intergenic
1015528198 6:134193786-134193808 GAGGGGAGAAGGGAGGAGAGGGG + Intronic
1015528207 6:134193808-134193830 GAGGGGAGAAGGGAGGAGAGGGG + Intronic
1015771191 6:136769872-136769894 GTGGAGAGAAGGGAAGGGAAAGG + Intronic
1015855605 6:137621552-137621574 GAAGAGAGGAGGGCTTAGATTGG - Intergenic
1016500954 6:144720046-144720068 TAGGAGAGAAGGGTTTAGCAGGG + Intronic
1016706288 6:147111886-147111908 TAGGAGTGAAGGGCTGTGGAGGG + Intergenic
1016936832 6:149454152-149454174 GAGGAGAGAAGGGCAGATCAGGG - Intronic
1017235238 6:152111695-152111717 GAGGGGAGAAGGGCAGAGAGAGG + Intronic
1017505443 6:155064879-155064901 GAGGAGAGAGGAGGGGAGAAAGG - Intronic
1017621826 6:156307018-156307040 GAGCAGAAAAGGGCAGGGAAGGG + Intergenic
1017637329 6:156456132-156456154 GGGGGGAGAAGGGGGGAGAAGGG - Intergenic
1018160558 6:161038055-161038077 GAGGAGAGAAAGCGTGAGAAAGG - Intronic
1018284355 6:162221007-162221029 GATGAGTGAAGAGCGGAGAATGG + Intronic
1018441556 6:163818530-163818552 GAGGGGAGAAGGGATTGGAAAGG - Intergenic
1018844714 6:167547524-167547546 GAGGAGAGATGGGGTGAAGAAGG - Intergenic
1018930807 6:168239287-168239309 AAGGAGAGAGGGGCTGGGCAGGG + Intergenic
1019072819 6:169363524-169363546 GAGGAGAGTGAGGCTAAGAAAGG + Intergenic
1019075769 6:169387116-169387138 AAGGAGCCAGGGGCTGAGAACGG + Intergenic
1019222487 6:170485007-170485029 GAAGGCAGATGGGCTGAGAAGGG + Intergenic
1019376962 7:697882-697904 GAAAAGAGAAGGGAAGAGAAGGG + Intronic
1019444992 7:1066560-1066582 GAGGAGAGAAGGGGGGACGAGGG + Intronic
1019730720 7:2627919-2627941 AAGGAGAGAAGGCCAGAGAGAGG - Intergenic
1019805036 7:3117509-3117531 GGGGAGAGGAGAGATGAGAAAGG + Intergenic
1019988899 7:4678897-4678919 GAGGGAAGAAGGGCTGAGGTGGG - Intergenic
1020515822 7:9117691-9117713 GAGGAGACAAAGGATAAGAAAGG + Intergenic
1020611466 7:10402559-10402581 TAGGAGAGAAGGGGTGTCAAGGG + Intergenic
1020945010 7:14593207-14593229 AAGGAGAGAGGGACAGAGAAAGG + Intronic
1022029036 7:26475262-26475284 TTGGAGAGAAGGGATAAGAATGG + Intergenic
1022171960 7:27839481-27839503 GAGGAGGGAAGGGCTGCTCAGGG - Intronic
1022211996 7:28220008-28220030 GAGAAGGGAAAGGCTGAAAAGGG + Intergenic
1022298443 7:29080012-29080034 GAGGAGAGGATGGCTGAGGTGGG + Intronic
1022852880 7:34283188-34283210 AGAGAGAGAAGAGCTGAGAAGGG + Intergenic
1022967028 7:35483399-35483421 CAGGAAAGAAGGGAGGAGAAAGG - Intergenic
1023473977 7:40556421-40556443 AAGGAAAGCAGGACTGAGAAGGG - Intronic
1023541582 7:41272000-41272022 GAGCAAAGAAAGGCTGAGGAGGG - Intergenic
1023625515 7:42111594-42111616 CAGGAGAGCAGGCCTGAGGAAGG + Intronic
1023856076 7:44185237-44185259 GAGAAGGGAAGGGAAGAGAAAGG + Intronic
1023910091 7:44547727-44547749 GAGGAGAAAAGGGAAGGGAAGGG + Intergenic
1024177877 7:46860202-46860224 GATGAGAGAGGAGCTGGGAAAGG - Intergenic
1024263665 7:47590264-47590286 AGGGAGAGAAGGATTGAGAAAGG - Intergenic
1024270162 7:47635858-47635880 GAGGAGTGAAGGAGGGAGAAAGG + Intergenic
1025198696 7:56949400-56949422 GAGGAGGGAAGGGGGGAGGAAGG - Intergenic
1025226714 7:57171686-57171708 GAGTGGAGTAGGGCTGAGACTGG - Intergenic
1025231693 7:57207057-57207079 GAGGAGGGGAGGGCAGGGAAGGG - Intergenic
1025673252 7:63627531-63627553 GAGGAGGGAAGGGGGGAGGAAGG + Intergenic
1026104160 7:67407877-67407899 GAGGGGAGGAGGGATGAGGAAGG - Intergenic
1026349679 7:69504705-69504727 GAGGAGAGAAGAGAAGGGAAGGG + Intergenic
1026349681 7:69504710-69504732 GAGAAGAGAAGGGAAGGGAAGGG + Intergenic
1026364325 7:69632520-69632542 GAAGAGAGAAGGGAGGAGAGGGG - Intronic
1026442469 7:70456527-70456549 CAGGACAGAAGAGCTGGGAAGGG + Intronic
1026493204 7:70880979-70881001 GAGGACAGAAGGTCTGACAGAGG + Intergenic
1026536266 7:71241202-71241224 GAGGAGAGAAAGAGTGAGAAAGG - Intronic
1026643811 7:72150650-72150672 AACGTGAGAGGGGCTGAGAAAGG + Intronic
1026938087 7:74270374-74270396 GAGGAGAGGAGGGGAGAGGAAGG - Intergenic
1026967435 7:74449177-74449199 GAGAAGAGAAGAGATGAGAGGGG - Intergenic
1026981851 7:74531570-74531592 CAGGAGAGGAGGGCTTAAAAAGG + Intronic
1027224914 7:76237758-76237780 GAAGGGAGAGGGGCTGAGGATGG - Intronic
1027712183 7:81618534-81618556 GAGGAGAGAAGGGGAGGGAAAGG + Intergenic
1028117017 7:87009695-87009717 GAGGTGAGAAAGCCAGAGAAAGG - Intronic
1028233145 7:88329793-88329815 GGTCAGAGAAGTGCTGAGAATGG + Intergenic
1028618893 7:92801962-92801984 GAGAAGGGAAGGGGAGAGAACGG - Intronic
1028913847 7:96237304-96237326 GAGGAGGGAAGGGTAGAGAGAGG + Intronic
1028923293 7:96330186-96330208 AAGGGGAGGAGGGCAGAGAAAGG + Intergenic
1028943179 7:96548279-96548301 TAGGAAAGATGGGCTCAGAATGG - Intronic
1029516383 7:101026078-101026100 TAGGAGACAAGGGGAGAGAAGGG - Intronic
1030132791 7:106217300-106217322 GGGGAGAGAAGAGATCAGAAAGG + Intergenic
1030458815 7:109806074-109806096 GGGGAGGGAAGGGAAGAGAAGGG + Intergenic
1030634288 7:111931093-111931115 TAAGAGAGAAGGGTAGAGAAGGG + Intronic
1031534418 7:122915876-122915898 GAGGGGAGAATGAATGAGAATGG - Intergenic
1031806599 7:126315357-126315379 GGGGTGAGAAGGGTGGAGAATGG + Intergenic
1031868546 7:127066944-127066966 GAGGACAGCAGGGCTCAGAGAGG + Intronic
1032123801 7:129176113-129176135 GAGGAGAGGAGGGGAGGGAAGGG + Intergenic
1032390516 7:131552600-131552622 GTCCAGAGAAGGGCTGAGGAGGG - Intronic
1032490272 7:132319093-132319115 GAGGAGAGGAGGTTTCAGAAGGG - Intronic
1032675937 7:134129458-134129480 GAGGAGAGAAGAGGAGAGGAGGG - Intronic
1033232873 7:139615180-139615202 GCGGAGAGCAGGGCCGAGGAGGG + Intronic
1033562165 7:142543023-142543045 GAGAAGAGAAGAGAAGAGAAGGG + Intergenic
1033920515 7:146386220-146386242 GAGGGGAGGAGGGATGAGCATGG - Intronic
1034010905 7:147528399-147528421 GGCCAGAGAAGGGCTCAGAAAGG + Intronic
1034435651 7:151061669-151061691 GAGGAGAGAGGAGGTGGGAAAGG - Intronic
1034441716 7:151089009-151089031 GGGAACAGCAGGGCTGAGAACGG - Intronic
1034816363 7:154175396-154175418 GGGAGGAGAAGGCCTGAGAAGGG + Intronic
1034850316 7:154487350-154487372 GAGGATGGAGGGGCTGAGTACGG - Intronic
1034867002 7:154650343-154650365 GTGGAGAGGAGGGCAGAGGAGGG + Intronic
1034895952 7:154876443-154876465 GAGGAGAGAAGAGATCAGGAAGG + Intronic
1034988148 7:155530409-155530431 GAGGGGAGAGGGGCTGAGGGAGG - Intronic
1035168235 7:157003955-157003977 GAGGGGAGGAGGGAGGAGAAGGG + Intronic
1035183498 7:157108027-157108049 GGAGAGTGAAGGGCTGAGCAGGG + Intergenic
1035692603 8:1569999-1570021 GAGGAGAGAAAGGAAGAAAACGG + Intronic
1035763010 8:2083702-2083724 GAGGAGAAAAGGGTTCAAAAGGG - Intronic
1035776250 8:2191137-2191159 GAGGAGAGAAGGAGGGAGAGAGG - Intergenic
1035902526 8:3472717-3472739 GAAGAAATAAGGGCTGGGAATGG - Intronic
1036062717 8:5342279-5342301 GAGGAGAGAAGGACTGGAGAGGG - Intergenic
1036510812 8:9398413-9398435 GAGTGGAGATGGGCAGAGAATGG + Intergenic
1036516964 8:9453191-9453213 CAGTAGAGAAGAGCTGAGTACGG + Intergenic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1036659095 8:10696245-10696267 GAGGAGAGAAGTGGGGAGATGGG + Intronic
1037071541 8:14656392-14656414 GAGGAGAGGAGGAAAGAGAAAGG - Intronic
1037598444 8:20373782-20373804 GAGGAGGGAAAGGAGGAGAAGGG + Intergenic
1037757322 8:21719382-21719404 GGGGAGAGAAGTGGAGAGAAGGG - Intronic
1037839209 8:22232071-22232093 GAGGAGAGAGAGGCAGAGAAGGG + Exonic
1037857722 8:22383710-22383732 CAGGAGAGAAGGGCGGAGGCAGG - Intronic
1038190777 8:25318452-25318474 GAGGAGAGAAGGGAAGGGAGCGG - Intronic
1038208281 8:25490379-25490401 GAGGAGGAAAGGGATGAGGAGGG + Intronic
1038454956 8:27667075-27667097 GAGGAGAGAAGGGCTAGAGAAGG - Intronic
1038659184 8:29482044-29482066 GGGCAGTGAAGGGCAGAGAAGGG + Intergenic
1038862306 8:31401217-31401239 GGGGAGGGAAGTGCTGGGAAGGG + Intergenic
1038884969 8:31653023-31653045 GAGGAGGGGAGGGGAGAGAAGGG - Intronic
1038930077 8:32183887-32183909 GAAGAGAGATGGGCTGAGTTAGG - Intronic
1038942382 8:32319444-32319466 GAGGAGAAGAAGGCTGAGAGAGG + Intronic
1039172957 8:34769498-34769520 GAGAGGAGAAGGGGGGAGAAAGG - Intergenic
1039564686 8:38542535-38542557 GAGGAGAGAAGGGGAGGGGAGGG - Intergenic
1040475842 8:47776693-47776715 GAGGAAAGCAGGGCTTAGAGAGG - Intronic
1040643512 8:49369754-49369776 AGGGAGAGAAGTGCTGAGGATGG - Intergenic
1040860982 8:51999151-51999173 CAGGAGAGAAACCCTGAGAAGGG + Intergenic
1041192800 8:55370284-55370306 AAGGTGACAAAGGCTGAGAATGG + Intronic
1041859160 8:62491815-62491837 GGGGAAAGGAGGACTGAGAATGG + Intronic
1042084606 8:65093824-65093846 GGAGAGAGAAATGCTGAGAAAGG + Intergenic
1042127920 8:65557625-65557647 GAGGACAGAAAGGCTGAGGGAGG - Intergenic
1042331439 8:67584666-67584688 GAGTGGAGTAGGGCTGAGAATGG + Intronic
1042477560 8:69266272-69266294 GGTGAGAGAAGGCCTGAGGAGGG + Intergenic
1043485808 8:80698309-80698331 CAGGAGAACAGGGCTGAGACTGG + Intronic
1043960887 8:86417081-86417103 GAGGAGAGAAGGGCACACACAGG + Intronic
1044014096 8:87029654-87029676 GACGAGAGGAGGAGTGAGAAAGG + Intronic
1044630383 8:94272591-94272613 GAGGAGAGAAGGGGTGTGGGAGG - Intergenic
1044748787 8:95396684-95396706 GAGGAGGGAAAGGTTGAGAATGG + Intergenic
1044937813 8:97309875-97309897 GAGGACAGCTGGGGTGAGAAAGG - Intergenic
1045509016 8:102799060-102799082 GATGGGAGAAGGGCTGGAAATGG + Intergenic
1045547342 8:103140698-103140720 GAGGAGGGACGGGCTGGGAGAGG + Exonic
1045550854 8:103171134-103171156 AAGGAGAGAAGGGAAGAGAAGGG + Intronic
1045695796 8:104807467-104807489 AGGGAGAGAAGGTCTGACAATGG - Intronic
1045944894 8:107784397-107784419 AAGGAGAGAAGGGAAGGGAAAGG + Intergenic
1045979168 8:108163861-108163883 GGGAAGAGAAGGGAAGAGAAGGG - Intergenic
1046580456 8:116086303-116086325 GAGCCGAAAAGGGCTCAGAATGG - Intergenic
1046625231 8:116569549-116569571 GAGGAGAGAAGAGAAGAGGAGGG + Intergenic
1046682288 8:117183730-117183752 GAGAAGAGAAAGGAAGAGAAGGG - Intergenic
1047347031 8:124038605-124038627 GAGAACTGAAGGGCTCAGAATGG - Intronic
1047461517 8:125070120-125070142 GAGGAAATAAGGGATGAGAAAGG - Intronic
1047681490 8:127258372-127258394 GAGGTGAGGAGGTCTGAGAAGGG + Intergenic
1047826549 8:128582216-128582238 GAGGAGAGAAGGGGAGAAAAGGG - Intergenic
1047826567 8:128582264-128582286 GAGGAGAGAAGGGGAAAAAAGGG - Intergenic
1047994192 8:130317896-130317918 GTGGAGAGGAGAGCTGAGGAAGG + Intronic
1048282003 8:133112555-133112577 GGAGAGAGAAGGGGAGAGAAGGG + Intronic
1048308518 8:133300205-133300227 GAAGAGAAAAGAGCAGAGAAGGG + Intronic
1048580501 8:135726247-135726269 GAGAAAAGAAAGGATGAGAAGGG + Intergenic
1048618418 8:136104876-136104898 GAGGACAGGATGCCTGAGAAGGG + Intergenic
1049428379 8:142547849-142547871 GAGAACTGCAGGGCTGAGAATGG + Intergenic
1049519277 8:143080024-143080046 GAGGGGAGAAGGGAGGAGAAGGG - Intergenic
1050180332 9:2916168-2916190 GAGGATAGAAGAGTAGAGAAGGG - Intergenic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1050770227 9:9189515-9189537 AAGGAGAGAAGGGATCAGAGAGG - Intronic
1051163635 9:14237343-14237365 GATGAGAAGAGGGCTAAGAATGG - Intronic
1051274507 9:15386198-15386220 AGGAAGAGAAGGGATGAGAAGGG + Intergenic
1051379872 9:16445618-16445640 GAGGAGAGTAGGGATGTGATTGG - Intronic
1051679881 9:19596121-19596143 GAGTGGAGAGGGGCTGGGAAGGG + Intronic
1051730831 9:20140998-20141020 GAGGAGAGGAGAGATGATAAAGG - Intergenic
1051985699 9:23084134-23084156 GAGGGGAGCAGGGATGAAAAGGG - Intergenic
1052055801 9:23906094-23906116 GAGAAGAGAAGGGGAGAGGAAGG + Intergenic
1052829609 9:33204121-33204143 GAGGAGAGAATTTCTGAAAATGG - Intergenic
1052976275 9:34412939-34412961 GAGAAGGGAAGGAATGAGAATGG + Intronic
1052998842 9:34566166-34566188 GAGCAAAGCAGGGCTGAGGAGGG - Intronic
1053054738 9:34987885-34987907 AAGGAAAGAAGGGCTGGGGAGGG - Intergenic
1053054756 9:34987930-34987952 GAGGAAAGGAGGGCTGGGGAGGG - Intergenic
1053131386 9:35617627-35617649 GGGGAGATAAGGGCTGCGGAGGG - Intronic
1053197959 9:36134963-36134985 GAGGTGAGAGGGGCTGAGAGTGG - Intergenic
1053470568 9:38343384-38343406 AAGGAGAGGAGGGGTCAGAAAGG - Intergenic
1053617917 9:39788580-39788602 CAGGTGTGAAGGCCTGAGAAGGG - Intergenic
1054266242 9:62918849-62918871 CAGGTGTGAAGGCCTGAGAAGGG + Intergenic
1054789462 9:69242122-69242144 GAGGAGAGCAGGGCAGAAGAAGG + Intronic
1054915747 9:70493991-70494013 GGCCAGAGAAGGGCCGAGAATGG - Intergenic
1054946822 9:70804698-70804720 GAGAAGAGAAGGGAAGGGAAGGG - Intronic
1055121909 9:72669975-72669997 GCAGAGAGAAGGGTTGCGAATGG + Intronic
1055124743 9:72706197-72706219 CAGGAGAGAAAGGGTGAGAATGG - Intronic
1055429481 9:76229037-76229059 GAGGAAAGAAGGAAGGAGAAAGG + Intronic
1055963606 9:81843976-81843998 GAGCAGAGAAGGGCTCAGCCAGG + Intergenic
1056024878 9:82483498-82483520 CAGGATAGAAAGGGTGAGAATGG + Intergenic
1056185181 9:84127483-84127505 GAGCAGAAAAGGACTGGGAAGGG - Intergenic
1056212012 9:84373576-84373598 GAGAAGAGAAGGGAAGGGAAGGG - Intergenic
1056420962 9:86425778-86425800 GAGGAAATAAAGGCTCAGAAAGG + Intergenic
1056451077 9:86717330-86717352 GGGCAGAGAACGTCTGAGAAGGG - Intergenic
1056676511 9:88680929-88680951 GATGAGGGAAGGGGTGGGAAAGG - Intergenic
1056747920 9:89320448-89320470 GTGGAGGGAAGGGCAAAGAAAGG + Intronic
1057031840 9:91782040-91782062 GAAGAGAGAAGGTCTGTGAAAGG - Intronic
1057053253 9:91941776-91941798 GAGAAGAGAAGAGAAGAGAAAGG - Intronic
1057339276 9:94184913-94184935 GGGGAAAGAAGGGCAGAGTATGG + Intergenic
1057500382 9:95593056-95593078 GAGGTGAGAGGGGCTGGGATGGG + Intergenic
1057502032 9:95603589-95603611 GAAGAGAGAAGAGCAGAGAGCGG - Intergenic
1057557484 9:96099442-96099464 GAGGAGAGAAGGACAGAAATTGG + Intergenic
1057695519 9:97320363-97320385 GAGGAGGGGAGGCCTTAGAAGGG - Intronic
1057724988 9:97562119-97562141 GATGAAAGAATGGCTGAGCACGG + Intronic
1057820912 9:98329821-98329843 GAGGAGAGATGGGGAGGGAAGGG - Intronic
1058550653 9:106111189-106111211 GAGAAGAGAAGGGAAGAAAAGGG + Intergenic
1058753582 9:108063542-108063564 GGGGAGAGAAGGGCAGAAATGGG + Intergenic
1058774250 9:108268294-108268316 GTGAAGAGAAAGGCTGAGGATGG + Intergenic
1059027965 9:110657587-110657609 GAGGAGAGAAGTGCTTGGCAAGG - Intergenic
1059073232 9:111162091-111162113 GAGAAGAGAAGTGCTAATAAGGG - Intergenic
1059291310 9:113226572-113226594 GAGAAGGAAAGGGTTGAGAAGGG + Intronic
1059375669 9:113879149-113879171 AAGGAGAGATGGGCTGGGGAGGG + Intronic
1059450201 9:114366743-114366765 GAGGAGAGGAGGGAAGGGAAGGG + Intronic
1059542495 9:115144303-115144325 GAGGGGAGAAGGGAAGGGAAGGG - Intronic
1059556100 9:115282002-115282024 GAGGTGAGCTGGGCAGAGAAAGG + Intronic
1059700659 9:116772689-116772711 GAGGAGGGAAGTCCTGGGAATGG - Intronic
1060006836 9:120007962-120007984 GCACAGAGAAGGGCTGAAAATGG - Intergenic
1060108692 9:120891244-120891266 GGGGAGAGGAGGGGAGAGAAGGG - Intronic
1060743250 9:126113344-126113366 GGAGAGAGAAGGGGTGAGAAAGG + Intergenic
1060941185 9:127543775-127543797 GAGGAGAGGATGGGTGAGCAGGG - Intronic
1061205534 9:129160973-129160995 AAGAAGAGAAGGGGAGAGAAGGG - Intergenic
1061367376 9:130178919-130178941 GAGGAGGGAAGGGGAGGGAAGGG - Intronic
1061481299 9:130898855-130898877 GAGGAGGGAAGGGCAGAGGTGGG - Intergenic
1061662455 9:132139256-132139278 GGGGAGAGAAGGGGAGAGGAGGG + Intergenic
1061662473 9:132139296-132139318 GGGGAGAGAAGGGGAGAGGAGGG + Intergenic
1061718668 9:132537751-132537773 GAAGAGAGAAGGGCTGGCCAGGG + Intronic
1062152746 9:135030323-135030345 GAGGAGAGAAAGGCTAGGACTGG + Intergenic
1062242659 9:135548504-135548526 GGGGAGAGGAGGCCTGAGAATGG - Intronic
1062321118 9:135990912-135990934 GAGGAGAGATGGGGAGAGAGGGG - Intergenic
1062610127 9:137369814-137369836 GTGAAGAGAAGGGCTGAGCTGGG - Intronic
1062683420 9:137797348-137797370 GAGGAGGGCAGGGCTGGGAGCGG - Intronic
1202630558 M:13060-13082 GAGTGGAGTAGGGCTGAGACTGG - Intergenic
1185502454 X:608373-608395 GGGGAGAGAAGGGAAGGGAAGGG - Intergenic
1185535426 X:857827-857849 GAGAAGAGAAGGGAGGGGAAGGG + Intergenic
1185537259 X:872682-872704 GAGGAGGGAAGGGGAGAGGAGGG - Intergenic
1185640678 X:1588202-1588224 GAGGAAAGAAGGGAAGGGAAGGG - Intergenic
1185640841 X:1588538-1588560 GAGGAAAGAAGGGAAGGGAAGGG - Intergenic
1185641023 X:1588921-1588943 GAGGAAAGAAGGGAAGGGAAGGG - Intergenic
1185641074 X:1589032-1589054 GAGGAAAGAAGGGAAGGGAAGGG - Intergenic
1185962278 X:4557594-4557616 CAGGAGAGAAAGGGTGGGAATGG + Intergenic
1186047480 X:5552167-5552189 GAGCAGAGAATGGCAGAGAGTGG + Intergenic
1186065019 X:5754030-5754052 GAGGAAGGAAGGGAAGAGAAAGG - Intergenic
1186081924 X:5942694-5942716 GGGGAGAGAAGGGGAGGGAAGGG + Intronic
1186093857 X:6078970-6078992 AAGGAGAGAAGTGCTGAGCAAGG - Intronic
1186381774 X:9068225-9068247 CAGGAAACAAGAGCTGAGAAGGG + Intronic
1186433726 X:9526133-9526155 GAGGAGAGACGGGCGGGGGAGGG + Intronic
1186730122 X:12401275-12401297 AAGGAGGGAAGGGGAGAGAAAGG - Intronic
1187105946 X:16241948-16241970 TGGGAGAGAAGGACTGGGAAAGG - Intergenic
1187131250 X:16505302-16505324 GAAGAGAGAAGGGAGGAGGAAGG - Intergenic
1187145562 X:16633828-16633850 TTGGAAAGAAGGGCTGAGCAAGG - Intronic
1187251330 X:17600812-17600834 AAGGAGAGAAGGAGAGAGAAAGG + Intronic
1187275588 X:17814101-17814123 GAGGAGTGAAGTGGTGAGACAGG + Intronic
1187278184 X:17834893-17834915 GAGGAGAGTTGTGATGAGAAAGG + Intronic
1187882852 X:23862784-23862806 GAGAAGAGAAGAGAAGAGAAAGG + Intronic
1188415481 X:29927907-29927929 AGGGAGAGAAGGGAAGAGAAGGG + Intronic
1188525776 X:31086266-31086288 GAGGAGAGATGGGATGCAAATGG + Intergenic
1188786342 X:34351436-34351458 GGGGAGAGAAGGGGAGGGAAGGG + Intergenic
1188966922 X:36565416-36565438 CAGGTGAGAAGGGATGATAAGGG - Intergenic
1189177444 X:38971998-38972020 GAGGAGAGAATGGGTGATAAGGG + Intergenic
1189615072 X:42774751-42774773 GAGGAAAGAAAGGCTATGAAAGG - Intergenic
1190151536 X:47954096-47954118 GAGGAGACACAGGCTGAGGATGG + Intronic
1190161196 X:48032628-48032650 GAGGAGACACAGGCTGAGGATGG - Intronic
1190215584 X:48477630-48477652 GAGCAGAGAAGGGTTGATAGTGG + Intronic
1190452908 X:50598553-50598575 GAGAAGACAAAGGATGAGAATGG + Intronic
1190477202 X:50840031-50840053 GGAGAGAGAAGGGCTGACCAAGG - Intergenic
1191162433 X:57345172-57345194 GAGGAGGGAAGGGAAGGGAAGGG - Intronic
1191716856 X:64199774-64199796 GAGGAGTGAAGTGCTGAAACAGG - Intronic
1191964813 X:66746423-66746445 GAGCAGAGAGGGGCTCAGTAGGG - Intergenic
1192032284 X:67526353-67526375 GAGGAGTGGAGGGGTGAGATAGG + Intergenic
1192103185 X:68287267-68287289 GAGAAGAGAAGGGAAGGGAAGGG + Intronic
1192229561 X:69255802-69255824 GGCCAGAGAAGGGCTGGGAAAGG + Intergenic
1192264460 X:69529410-69529432 CAGGAAAGAAGGGCTCAGAAAGG + Intronic
1192317700 X:70065712-70065734 GTGGAGAGAAGGGCAGGAAAGGG + Intergenic
1192899191 X:75476737-75476759 GAGGAGAGAAGGGAAGGGAGGGG - Intronic
1193268897 X:79506641-79506663 GAGGAGAAAAAGGCTTAGAAAGG - Intergenic
1193557634 X:82975497-82975519 AAAGAGAGAAGGAGTGAGAAGGG - Intergenic
1194358564 X:92918733-92918755 GAGGAGAGAAGAGGGGAGAATGG - Intergenic
1195291262 X:103433627-103433649 GAGGAGAGGAGGGGTCAGATGGG + Intergenic
1195308441 X:103608121-103608143 GAGTAGGGAGGGGCGGAGAAAGG + Intronic
1195673191 X:107485962-107485984 GAGAAGACAAAGGCAGAGAATGG - Intergenic
1196840208 X:119852772-119852794 GAAGAAAGAAGCGCTGAGCAAGG - Exonic
1197028750 X:121788337-121788359 GGGGAGAGAAGGGAAGGGAAGGG - Intergenic
1197354444 X:125419594-125419616 GAAGAGAGTAGGGCTAAAAAAGG + Intergenic
1197603267 X:128556119-128556141 GAAGAGAGAAGTGCTGAACAAGG + Intergenic
1197727475 X:129785968-129785990 GAGGAGAGAAGGGGAAAGAAAGG + Intronic
1197827241 X:130602809-130602831 GAGGAGAGAAGGAGGGAGAAAGG + Intergenic
1198320265 X:135513150-135513172 GATGAGAGAAGGGCTGATGAGGG - Intergenic
1198550792 X:137743074-137743096 GGTGAGAGAAAGGGTGAGAAGGG + Intergenic
1198550794 X:137743084-137743106 AGGGTGAGAAGGGTTGAGAAGGG + Intergenic
1198672894 X:139100363-139100385 GAGGAGGGAAGGATGGAGAAAGG + Intronic
1199160995 X:144611666-144611688 GAGGAGAGAGGGTGAGAGAAAGG - Intergenic
1199448901 X:147957858-147957880 GAAGAAAGAAGGACTGAGTAAGG + Intergenic
1199527930 X:148812733-148812755 GAGGATTGAGGGGCTGAGAGTGG - Intronic
1199599866 X:149535491-149535513 GAGGAGAGGAGGGGGGAGGACGG - Intergenic
1199802855 X:151268566-151268588 ATGAAGAGAGGGGCTGAGAATGG + Intergenic
1200136219 X:153875951-153875973 GAGGGGAGAAGGGAAGGGAAGGG + Intronic
1200286670 X:154829484-154829506 GAGGAGAGAGGGAATGTGAAGGG - Intronic
1200666743 Y:6034423-6034445 GAAGAGAGAAGAGGGGAGAATGG - Intergenic
1200758974 Y:7018712-7018734 TAGGTGAGAAGAGCTGGGAAAGG - Intronic
1200884832 Y:8257063-8257085 GAGAAGAGAAGAGAAGAGAAGGG + Intergenic
1201109716 Y:10790388-10790410 GGGGAGAGAAGGGATTGGAAGGG - Intergenic
1201256358 Y:12112034-12112056 GAGAAGAGAAGGGAAGTGAAGGG - Intergenic
1201717102 Y:17057265-17057287 GAGGAGAGCAGAGCAGATAAAGG + Intergenic
1201965984 Y:19736252-19736274 GAAGAGACAAGTGCTGAAAATGG - Intronic