ID: 1165795606

View in Genome Browser
Species Human (GRCh38)
Location 19:38517414-38517436
Sequence GCGGCTCATGGCAGACATTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165795598_1165795606 -3 Left 1165795598 19:38517394-38517416 CCCGACATCCCGGTGCTGGAGCG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1165795606 19:38517414-38517436 GCGGCTCATGGCAGACATTGGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1165795593_1165795606 22 Left 1165795593 19:38517369-38517391 CCCCAACAGTGTGGAGGAGATGT 0: 1
1: 0
2: 2
3: 6
4: 133
Right 1165795606 19:38517414-38517436 GCGGCTCATGGCAGACATTGGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1165795599_1165795606 -4 Left 1165795599 19:38517395-38517417 CCGACATCCCGGTGCTGGAGCGG 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1165795606 19:38517414-38517436 GCGGCTCATGGCAGACATTGGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1165795595_1165795606 20 Left 1165795595 19:38517371-38517393 CCAACAGTGTGGAGGAGATGTGT 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1165795606 19:38517414-38517436 GCGGCTCATGGCAGACATTGGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1165795594_1165795606 21 Left 1165795594 19:38517370-38517392 CCCAACAGTGTGGAGGAGATGTG 0: 1
1: 0
2: 0
3: 6
4: 155
Right 1165795606 19:38517414-38517436 GCGGCTCATGGCAGACATTGGGG 0: 1
1: 0
2: 0
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165795606 Original CRISPR GCGGCTCATGGCAGACATTG GGG Exonic
902205502 1:14865466-14865488 GCAGCAGATGGCAGACATGGGGG - Intronic
911660138 1:100491963-100491985 GAGGCTCATCACAGACAATGCGG + Intronic
916607076 1:166353680-166353702 CAGGCTCATGCCACACATTGGGG - Intergenic
1063382701 10:5596200-5596222 GCTGCTCAGGACAGACAATGTGG + Intergenic
1064029295 10:11873641-11873663 GTGGCTCATGCCAGAAATTTGGG + Intergenic
1067878769 10:50025947-50025969 TCAGCTCATGGAAGACATTGAGG + Intergenic
1067892967 10:50151995-50152017 TCAGCTCATCGAAGACATTGAGG - Intergenic
1071830940 10:89371417-89371439 GAGGCTCATAGAAGACATTTTGG - Intronic
1075746527 10:124731996-124732018 GCTGATCCTGGCAGACATGGAGG - Intronic
1075925011 10:126244502-126244524 GGGGATCATGGTAGACATGGTGG + Intronic
1076805742 10:132858120-132858142 ACGGCTCAGGTCAGACCTTGTGG + Intronic
1085732926 11:79014509-79014531 GCTGCTGAAGGCAGACATTAAGG - Intronic
1086731951 11:90261360-90261382 AAGGCTTATAGCAGACATTGTGG - Intergenic
1092668600 12:10836132-10836154 GCGGCTCATGGAAGTGAATGGGG + Intronic
1096599893 12:52721802-52721824 GCGACTCATGGCAGACAGCAAGG + Intergenic
1100187800 12:92156537-92156559 GAGGCTGAAGGCAGACATTATGG - Intergenic
1115869004 14:37778919-37778941 GGGGAGCATGGCAGACCTTGGGG + Intronic
1116981635 14:51176980-51177002 GCAGCTCTTGGCAGGCACTGAGG + Intergenic
1129691117 15:77714162-77714184 GCGGCTCAAGCCAGGAATTGAGG + Intronic
1133286537 16:4693416-4693438 GTGGCTCAAGGTTGACATTGTGG - Intergenic
1136697439 16:32097431-32097453 GTGGCTCATGGCAGTGGTTGAGG - Intergenic
1140035359 16:71367599-71367621 GCAGCTGATGGCAGACAGTGAGG - Intronic
1140771133 16:78205210-78205232 GGGGGTCATGGAAGACTTTGTGG + Intronic
1141674345 16:85509744-85509766 GTGGCTCATGGCACACAGTCAGG - Intergenic
1141987459 16:87589184-87589206 GTGGCTGATGGCAGAGATTCAGG + Intergenic
1143406110 17:6678121-6678143 GGGGCTCATGTCAGCCATTGCGG - Intergenic
1144754302 17:17669877-17669899 GCTGCTCATGGCTGACAGGGAGG + Intergenic
1144762377 17:17714652-17714674 GAGCCTCCTGGCACACATTGTGG + Intronic
1146603303 17:34236637-34236659 GTGGCTCTTGGCAGAACTTGGGG - Intergenic
1147132014 17:38415221-38415243 GCTGCTCATGGGAGAGACTGGGG + Intergenic
1151257088 17:72886269-72886291 GGAGTTCATGGAAGACATTGGGG - Intronic
1155238928 18:23847282-23847304 AATGCTCATGGCAGACAGTGTGG - Intronic
1157869293 18:51215058-51215080 GTGGCTCAGGGCAGAGAATGGGG + Intronic
1161779195 19:6279868-6279890 GCGGCGCTTGACAGACAATGAGG - Exonic
1165795606 19:38517414-38517436 GCGGCTCATGGCAGACATTGGGG + Exonic
927467946 2:23351038-23351060 GCCTCTCATGTCAGAAATTGGGG + Intergenic
928143319 2:28749843-28749865 GAGGCTCATGGAAGAGATTTGGG + Intergenic
929542843 2:42835465-42835487 GAGGCAGAGGGCAGACATTGTGG + Intergenic
929543220 2:42838270-42838292 GAGGCAGAGGGCAGACATTGTGG + Intergenic
936499313 2:113053225-113053247 GAGTCTCATGGAACACATTGTGG + Intergenic
937375530 2:121333455-121333477 GAGGCTCCTGGCAGACGTTGGGG + Intergenic
945046401 2:205785697-205785719 GGGGCTCATTGGAGACATTCTGG + Intronic
947005374 2:225505380-225505402 GTGGCTCAGGGAAGACATTAAGG + Intronic
948404021 2:237704056-237704078 ACGGCAGATGGCAGACATTGGGG - Intronic
948406171 2:237721305-237721327 GCGGCTGAAGGCAGACCTTACGG - Intronic
948759627 2:240182725-240182747 TAGGCTCATGGCAGAGTTTGGGG - Intergenic
1169264763 20:4161113-4161135 GCGGCTCCTGGCAGGGATAGGGG + Intronic
1172173685 20:32959925-32959947 GCGCCCCCTGGAAGACATTGAGG + Intronic
1175167104 20:57052165-57052187 GTGGCTCATGGCAGCCATATTGG - Intergenic
1178694797 21:34783491-34783513 GCGGATGAAGGCAGAAATTGGGG - Intergenic
1184021912 22:41826689-41826711 GCAGCTTAGGGCAGCCATTGCGG - Intergenic
951994875 3:28716125-28716147 GTGGTTCATGGCAGACATGTTGG + Intergenic
960734913 3:120768361-120768383 GTGCCTGATGGGAGACATTGAGG + Intronic
967634555 3:191785753-191785775 AGGGATCATGGAAGACATTGTGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
970975088 4:22034379-22034401 GCAGCTCCTGGCAGACACAGGGG - Intergenic
974229503 4:59091742-59091764 GCAGCTCATCCCAGACATGGAGG + Intergenic
984726555 4:183027595-183027617 GTGCCTCATGCCAGACATGGTGG + Intergenic
986805572 5:11305595-11305617 CTGGCTCATAGCAGACACTGAGG - Intronic
987209484 5:15665224-15665246 GGGGCTCATGGTAAAAATTGGGG - Intronic
994770288 5:103973231-103973253 GAGGGTCATGGCGGACATGGGGG + Intergenic
998054592 5:139063456-139063478 GAGGAACATGGGAGACATTGAGG - Intronic
1001936802 5:175711268-175711290 ACGGCTCACGGCTGACATTGCGG - Intergenic
1002078725 5:176725381-176725403 GCAGCTAATGGCTGACTTTGGGG + Intergenic
1006055555 6:31381901-31381923 GGGGGTCATGGTAGACATGGGGG + Intergenic
1015891927 6:137978068-137978090 GGGGCTCTTAGGAGACATTGCGG + Intergenic
1019006146 6:168798411-168798433 GCAGCTCATGGCAGTCACTAAGG - Intergenic
1019613980 7:1950625-1950647 GCAGCTGGGGGCAGACATTGAGG - Intronic
1023133832 7:37031178-37031200 GCTCCTCATGGAAGACAGTGAGG - Intronic
1025031187 7:55558257-55558279 GAGGCTTATGGCATAAATTGTGG + Intronic
1030222207 7:107108987-107109009 GTGGCTCATAGCAGCCCTTGTGG + Intronic
1032730738 7:134640575-134640597 GCACCTAATGCCAGACATTGTGG + Intergenic
1038403084 8:27300264-27300286 GCCCCTCATGACAGACCTTGAGG + Intronic
1041712368 8:60906176-60906198 GTGGATCATGGCGGACGTTGAGG - Intergenic
1048151428 8:131899026-131899048 GCGGTACATAGCAGATATTGGGG - Intergenic
1049561875 8:143316173-143316195 CCGGCTCAGGGCAGACAGGGAGG - Intronic
1049865760 8:144934454-144934476 GAAGCTCATGGGGGACATTGGGG - Intronic
1052526701 9:29628085-29628107 CCAGTTCATGGCAGACAGTGTGG - Intergenic
1056992707 9:91425260-91425282 GCTGCTCATGGCAGACACTAGGG - Intergenic
1058848296 9:108984685-108984707 GCTGCACATGGCTGACATTCTGG + Intronic
1061540427 9:131275437-131275459 CGGGCCCATGGCAGACATTCAGG - Intronic
1062586590 9:137252449-137252471 GCAGGGCATGGCAGACTTTGTGG + Exonic
1198731715 X:139737851-139737873 TTAGCTCATGGCAGATATTGAGG + Intronic
1200053938 X:153448891-153448913 GCAGCACATGGCACACAGTGAGG + Intronic
1201567876 Y:15385411-15385433 GGGGTTCATGGGAGGCATTGTGG + Intergenic