ID: 1165797292

View in Genome Browser
Species Human (GRCh38)
Location 19:38526511-38526533
Sequence GCCCTCAAGGACCAAGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165797292_1165797307 28 Left 1165797292 19:38526511-38526533 CCCTCACCTTGGTCCTTGAGGGC No data
Right 1165797307 19:38526562-38526584 CACCCTGCTGATGCCCCCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165797292 Original CRISPR GCCCTCAAGGACCAAGGTGA GGG (reversed) Intronic
No off target data available for this crispr