ID: 1165803516

View in Genome Browser
Species Human (GRCh38)
Location 19:38566904-38566926
Sequence TCCCTAGGTGGATGGAGTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165803508_1165803516 -6 Left 1165803508 19:38566887-38566909 CCCTGATGCTTGCCCTGTCCCTA 0: 1
1: 0
2: 4
3: 58
4: 208
Right 1165803516 19:38566904-38566926 TCCCTAGGTGGATGGAGTGGAGG 0: 1
1: 0
2: 4
3: 13
4: 233
1165803509_1165803516 -7 Left 1165803509 19:38566888-38566910 CCTGATGCTTGCCCTGTCCCTAG 0: 1
1: 0
2: 2
3: 16
4: 198
Right 1165803516 19:38566904-38566926 TCCCTAGGTGGATGGAGTGGAGG 0: 1
1: 0
2: 4
3: 13
4: 233
1165803506_1165803516 23 Left 1165803506 19:38566858-38566880 CCTGAGAAGCGCTTAGGGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1165803516 19:38566904-38566926 TCCCTAGGTGGATGGAGTGGAGG 0: 1
1: 0
2: 4
3: 13
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165803516 Original CRISPR TCCCTAGGTGGATGGAGTGG AGG Exonic
900797158 1:4715071-4715093 TCCCCAGATGGAAGGAGTGCTGG + Intronic
902165905 1:14571626-14571648 TTTATAGGGGGATGGAGTGGGGG - Intergenic
902364581 1:15963505-15963527 TCCCTCTGGGGATGGGGTGGAGG - Intronic
902404215 1:16174231-16174253 GCTCTGGGTGGATGGAGAGGAGG - Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903163748 1:21507173-21507195 TCCCGAGGTGGAGGGACTTGAGG + Intergenic
905067034 1:35192630-35192652 CCCCGAGGTTGGTGGAGTGGCGG + Exonic
906692202 1:47799883-47799905 TTGCTATGAGGATGGAGTGGAGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914386223 1:147172413-147172435 GCCCGAGGTGACTGGAGTGGGGG - Exonic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916321700 1:163512155-163512177 ACCACAGGTGGATGGGGTGGTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
918075266 1:181166210-181166232 TTGCTAGGTGTTTGGAGTGGTGG + Intergenic
918963536 1:191309947-191309969 TCACTAGGTGGAAGTAGTTGTGG - Intergenic
920246571 1:204592288-204592310 TCCCTAGCTCCATGGAGGGGTGG - Intergenic
924064601 1:240208479-240208501 GTCCCAGGTGGAGGGAGTGGGGG - Exonic
924425208 1:243944262-243944284 GGCCTAGGGGGATGGGGTGGAGG - Intergenic
1063138487 10:3236973-3236995 CCTGGAGGTGGATGGAGTGGGGG + Intergenic
1066260768 10:33727780-33727802 TCCCTGGGTGGCTGGATTTGGGG - Intergenic
1068865454 10:61890155-61890177 TTCCCTGGTGGATGGGGTGGAGG + Intergenic
1070878529 10:79839126-79839148 TACCTAGGTGCATGGACTGCAGG - Intergenic
1070973163 10:80584258-80584280 TTTGTAGGTGGATGGAGAGGAGG + Intronic
1071505293 10:86228234-86228256 TACATGGGTGGATGGAGGGGTGG + Intronic
1071580959 10:86769872-86769894 TCCCAGTGTGGATGGAGGGGTGG + Intronic
1073559322 10:104483297-104483319 TCCAGAGATAGATGGAGTGGAGG + Intergenic
1074815745 10:117139910-117139932 CCCCTAAGTGGCTGGAGGGGTGG - Intergenic
1076841700 10:133049099-133049121 TCCCTGCGTGGGTGGGGTGGGGG - Intergenic
1080183602 11:29452819-29452841 TTCTAAGGTGGATGGAATGGTGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081680713 11:45000460-45000482 TGCCTCGGTGGATGGATGGGTGG - Intergenic
1081861619 11:46336264-46336286 TCTTTAGGTGGATGGAGAGATGG + Intronic
1083255109 11:61490856-61490878 TCCCCTGGGGGATGGAGTGGGGG - Exonic
1084962151 11:72722517-72722539 TCCTTATGCGGGTGGAGTGGTGG - Intronic
1085269282 11:75260724-75260746 TCCCTGGGGGGTGGGAGTGGGGG + Intergenic
1086067107 11:82757176-82757198 TCACTGAGTGGCTGGAGTGGGGG - Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1087906597 11:103704691-103704713 TACCTGGATGGATGGAGTGGAGG - Intergenic
1089808730 11:121114677-121114699 TGGCTAGGTGGATGGATGGGTGG - Intronic
1091322933 11:134664590-134664612 GCCCTTGGTGGATGGTGTGTGGG - Intergenic
1091599991 12:1912277-1912299 TTCTTGGCTGGATGGAGTGGAGG + Intronic
1091634429 12:2186370-2186392 CCCCTAGGAGGATGCAGAGGTGG - Intronic
1092237371 12:6818768-6818790 CCCCTTGGTGGGGGGAGTGGGGG - Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1095947764 12:47763576-47763598 GCCCTTGGGGGATGGAGCGGGGG - Intronic
1095998101 12:48106131-48106153 TCGCTAGGTGGCTGAAGAGGAGG + Exonic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097156634 12:57016610-57016632 TCCCAGGGTGGCTGGAGGGGAGG + Intronic
1097250598 12:57630516-57630538 GCCCTAGGAGAAAGGAGTGGGGG + Exonic
1098405580 12:70122983-70123005 TCCCTCTGTGGATGGGGTGCTGG - Intergenic
1100367582 12:93935799-93935821 TCACTGTGGGGATGGAGTGGAGG + Intergenic
1102349149 12:112179394-112179416 TCCCCTGTTGGATGGAGAGGGGG + Exonic
1102526406 12:113515298-113515320 TCCCTCGGGGGATGGATTTGGGG + Intergenic
1103276922 12:119719665-119719687 TACCTAGGAGGAAGGAGTGGAGG - Intronic
1103447124 12:121001685-121001707 TCACTAGCTGGAAGGAGTTGGGG - Exonic
1104174323 12:126315062-126315084 GCCCTAGCTGGAAGGAGTGCTGG - Intergenic
1104766174 12:131331501-131331523 TCCATGGGTGGATGGACTGAAGG - Intergenic
1105960620 13:25332759-25332781 TCTCTAGCTGGCTGGAGTGTAGG + Intronic
1106340848 13:28825100-28825122 GCCTCAGGTGGCTGGAGTGGGGG - Intronic
1107632227 13:42354320-42354342 TCCCAAGGTGGACTGACTGGTGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1107935386 13:45341454-45341476 GCCCTGGGTGGGTGGAGCGGGGG + Intergenic
1108482842 13:50892290-50892312 TTCCTATGTGGCTGGAGGGGTGG - Intergenic
1108592400 13:51923378-51923400 TCCCCAGGTGGCTGTGGTGGTGG - Intergenic
1109270018 13:60245510-60245532 TCCCTATGTGAAGGGAGTAGTGG + Intergenic
1110433607 13:75455264-75455286 TATCTAGGTGTACGGAGTGGGGG - Intronic
1110596692 13:77327173-77327195 CCCCGAGGCGGAGGGAGTGGTGG - Intergenic
1111200660 13:84931971-84931993 TACCTATGTGGATTAAGTGGAGG + Intergenic
1112836070 13:103515695-103515717 TCCACAGGTGGTGGGAGTGGGGG - Intergenic
1114995286 14:28342941-28342963 TCCCAAGGTGGATGGTCAGGAGG + Intergenic
1115768980 14:36651069-36651091 TCCCTAGATGCCTGGAGTGGTGG + Intergenic
1118388719 14:65279230-65279252 ACCCGTGGGGGATGGAGTGGAGG - Intergenic
1118824229 14:69366023-69366045 TCACTAGGAAGATGGTGTGGAGG + Intergenic
1119383975 14:74245783-74245805 GCCTTAGGTGGATGGAGTGGTGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120789301 14:88564059-88564081 TCCCTAGGTGCTGGGAGTGCGGG + Intronic
1121284125 14:92721374-92721396 TTCCTTGGTGGCTGTAGTGGAGG - Intronic
1123153640 14:106204816-106204838 TCCCTGGGGGGCTGGAGTGTCGG + Intergenic
1124954001 15:34348061-34348083 TCCCTGGGTGGGTGGTCTGGTGG - Exonic
1127248186 15:57201571-57201593 TCCAGAGGTAGATTGAGTGGGGG + Intronic
1127447883 15:59084145-59084167 ATCCTATGTGGATGGGGTGGGGG - Exonic
1127999825 15:64180355-64180377 TGCCGAGGTGGAGGTAGTGGAGG - Exonic
1129138177 15:73572994-73573016 GTCCTAGGTGGCTGGAGAGGAGG - Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1131392187 15:92058565-92058587 TCCCTACGTGAATGGGGTGATGG - Intronic
1132689975 16:1178010-1178032 TCCCCAGGGAGAGGGAGTGGGGG - Intronic
1133469319 16:6058729-6058751 TGGATAGGTGGATGGATTGGTGG - Intronic
1134187548 16:12096700-12096722 CCCATGGGTGGATCGAGTGGCGG - Intronic
1134490757 16:14693937-14693959 TCCCTGGGAGGAGTGAGTGGGGG + Intronic
1134496138 16:14733055-14733077 TCCCTGGGAGGAGTGAGTGGGGG + Intronic
1136060631 16:27723870-27723892 TCACTAGGTGGATGGACAGCTGG - Intronic
1136154666 16:28374775-28374797 TCCCTGGGAGGAGTGAGTGGGGG - Intergenic
1136264514 16:29107159-29107181 TCCCTGGGAGGAGTGAGTGGGGG + Intergenic
1137792811 16:51189034-51189056 CCCATAGGTGGATGGGGTGGTGG + Intergenic
1141485983 16:84340705-84340727 TCCCCAGGTGGTTAGAGAGGTGG - Intergenic
1142797684 17:2321544-2321566 TCCTTTGGTGGATGCACTGGTGG + Exonic
1144253570 17:13443544-13443566 TCACGTGGTGGAAGGAGTGGAGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145909203 17:28532960-28532982 TCCCTAGTTGGCTGGTCTGGTGG + Intronic
1146505990 17:33405878-33405900 CCCCTGGGTGATTGGAGTGGAGG - Intronic
1147833650 17:43314896-43314918 TTCACAGGTGGATGGAGTGATGG + Intergenic
1147867047 17:43559966-43559988 TCCCTTCTGGGATGGAGTGGAGG + Intronic
1148160887 17:45449594-45449616 TGGCTAGGTGGATGGGTTGGTGG - Intronic
1149568936 17:57658679-57658701 TCCTAAAGTGAATGGAGTGGGGG + Intronic
1150392161 17:64796400-64796422 TGGCTAGGTGGATGGGTTGGTGG - Intergenic
1151632508 17:75320496-75320518 TCCCCAGGAGGATGGAGAGCTGG - Exonic
1151988347 17:77558169-77558191 TCCCCAGGTGGAAGGTGAGGGGG + Intergenic
1152559457 17:81070726-81070748 ACCCGGGGTGGCTGGAGTGGAGG - Intronic
1155437703 18:25830423-25830445 TTGTTAGCTGGATGGAGTGGGGG + Intergenic
1157734326 18:50033271-50033293 CCTCTAGGTGGGTGGAGTAGTGG - Intronic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1160469110 18:79111399-79111421 TCACTAGGTGGATGGGGATGAGG - Intronic
1161033473 19:2071089-2071111 CTCCGAGGTGGATGGAGTGAGGG + Exonic
1161484748 19:4529269-4529291 TCCCACGGTGCCTGGAGTGGGGG - Exonic
1162194233 19:8971986-8972008 TCTGGAGGTGGATGCAGTGGGGG + Exonic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164667520 19:30051374-30051396 TGCTTAGGTGGATGGATTCGAGG + Intergenic
1165340679 19:35209625-35209647 TGCCTTTGGGGATGGAGTGGAGG + Intergenic
1165382718 19:35492470-35492492 ACCCTATGCGGATGGAATGGTGG - Intronic
1165803516 19:38566904-38566926 TCCCTAGGTGGATGGAGTGGAGG + Exonic
1166753028 19:45173775-45173797 TCCCCAGGAGGAAGGAGTGAGGG + Intronic
1167349009 19:48963468-48963490 CCCATAGGTGGAGGGAGAGGAGG - Intergenic
1168277223 19:55284727-55284749 TCCCTGGATGGAGGGGGTGGGGG + Intronic
1168326920 19:55543224-55543246 TCCATGGGTGGATGGATGGGTGG - Intronic
1168694710 19:58397694-58397716 TCCACAGATGGGTGGAGTGGTGG - Intergenic
926151784 2:10429493-10429515 TCCCTAGGTGGATCGGTTGATGG + Intergenic
927111216 2:19864917-19864939 TCTCTAGGCGGCTGGAGGGGTGG - Intergenic
927602618 2:24457331-24457353 TCACTAGGTGGTTGGTTTGGTGG + Intergenic
931245571 2:60489945-60489967 TCCCAACATGGATGGACTGGAGG + Intronic
931777983 2:65556380-65556402 AACATGGGTGGATGGAGTGGAGG + Intergenic
932003669 2:67907025-67907047 GCCCTGGGTGGGGGGAGTGGAGG + Intergenic
933970832 2:87468649-87468671 TCCCTAGGTGGATGGATGGGTGG + Intergenic
935262259 2:101365407-101365429 TCCCTAGGAGGATGGAGTAGAGG - Intronic
935951272 2:108331122-108331144 TCCCCAGGGGGATGTGGTGGTGG + Intergenic
936581791 2:113706411-113706433 TCCCTAGGATGGTGGGGTGGAGG - Intronic
937597229 2:123686732-123686754 TCCCTGGGGGGCTGGAGTGTCGG - Intergenic
940259439 2:151765032-151765054 TCCCTAGAAGCCTGGAGTGGAGG - Intergenic
940276695 2:151947433-151947455 TCCCTAGGCAGGGGGAGTGGGGG + Intronic
941110532 2:161415557-161415579 TCCTGAGGTGGGTGGATTGGTGG + Intergenic
944285955 2:197949994-197950016 TCCCTAGGTACATGCAATGGTGG - Intronic
947151844 2:227123585-227123607 GCCCTAGGGGAAGGGAGTGGGGG + Intronic
947530944 2:230908295-230908317 CTCCTAGGTGGATGGAGGGAAGG - Exonic
947698630 2:232214263-232214285 TCCATAAGTGGATGCAGTGGAGG - Intronic
948371220 2:237490164-237490186 GCCCTAGCTGGGTGGGGTGGGGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948768712 2:240236475-240236497 TCCCTAGGGAGATGGGGTGAGGG - Intergenic
1171944910 20:31367977-31367999 TCCCTAGCTGGGTGTGGTGGTGG - Intergenic
1173507455 20:43599214-43599236 TCGCTAGGTGGATGGGGAGATGG - Intronic
1173789038 20:45815764-45815786 TCCCAAGTTGCATGGAGGGGAGG - Intronic
1174277881 20:49416964-49416986 GCCCAAGGTGGCTGAAGTGGTGG + Intronic
1174451653 20:50624422-50624444 TCCCCAGGTGGATGGAAGCGGGG - Intronic
1175064693 20:56274861-56274883 TACCTAGGTGGAAGGCTTGGTGG - Intergenic
1175732400 20:61362710-61362732 CCCCTGGCTGGATGGGGTGGGGG + Intronic
1179038655 21:37782565-37782587 CCCCTGGGTGGAGGGAGTTGTGG - Intronic
1180140871 21:45892808-45892830 GACCCAGGTGGATGGAGTGAAGG - Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181537523 22:23554251-23554273 GCCCTTGGGGGATGGAATGGAGG + Intergenic
1182060636 22:27394713-27394735 TGCATGGATGGATGGAGTGGTGG + Intergenic
1182999347 22:34842280-34842302 TCTCAGGGTGGATGGAGTGCTGG - Intergenic
1183524228 22:38314314-38314336 TCCCCAGGTGTGTGGAGTGCAGG - Intronic
1183672842 22:39283284-39283306 CCCCAGGCTGGATGGAGTGGGGG - Intergenic
1184104659 22:42360348-42360370 TCACAAAGTGGGTGGAGTGGGGG - Intergenic
1184167850 22:42741084-42741106 TCTTTAGGTAGATGGGGTGGTGG + Intergenic
1184965106 22:47965837-47965859 TCCCTCCCTGGATGAAGTGGTGG + Intergenic
1185012277 22:48320923-48320945 TGCCTACGTGGGTGGGGTGGAGG + Intergenic
950101947 3:10362607-10362629 TCCCTTGGTGGATGGTACGGGGG + Intronic
952511766 3:34065574-34065596 TCCCTAGGTCCCTGGAGTGATGG - Intergenic
952730260 3:36631039-36631061 TCCCCTGATGTATGGAGTGGTGG - Intergenic
953212444 3:40888097-40888119 TACCAAGGTGGAAGGAGTAGAGG - Intergenic
953449035 3:42991034-42991056 TGTCTAGGTGGAAGCAGTGGGGG + Intronic
954332034 3:49896241-49896263 GCACTGGGTGGATGGGGTGGGGG + Exonic
955726622 3:61940197-61940219 TCGCTGGGTGGATGAAGTGCTGG + Intronic
961707297 3:128797046-128797068 TCCCGACGGGGATGGAGTTGCGG - Intronic
962237075 3:133715797-133715819 TACCAAGGGGGTTGGAGTGGTGG - Intergenic
965104407 3:164339560-164339582 TCCCTGGGGGGCTGGAGTGTTGG + Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
968464128 4:742062-742084 GCCGCAGGTGGATGGAGTGCTGG - Intronic
968935799 4:3609787-3609809 TACATAGGTGGATGGATGGGTGG - Intergenic
969271829 4:6108284-6108306 TGCTCAGCTGGATGGAGTGGTGG - Intronic
969723973 4:8908331-8908353 TCCCTGGGTGGAGGGACTGGCGG - Intergenic
970197434 4:13565810-13565832 TAGCTAGGTGAATGAAGTGGAGG + Intergenic
971323711 4:25626887-25626909 TCTCCAGCTGGATGCAGTGGCGG - Intergenic
972190338 4:36583848-36583870 TCCCTGGGTGGATGGGGGTGGGG - Intergenic
976294461 4:83455780-83455802 TCCCAAGGTGGATGTAGAAGCGG - Exonic
977483258 4:97607510-97607532 TCTCTAAATGGATGGAGTGAGGG - Intronic
980383203 4:132054281-132054303 TCACTAAGTGGATTGAGTGCTGG + Intergenic
980449627 4:132953766-132953788 TACCTAAGTGGATGCAGTGACGG + Intergenic
984499346 4:180538572-180538594 CTCAGAGGTGGATGGAGTGGCGG - Intergenic
986179912 5:5384019-5384041 GCCCTAGCTGCATGGAATGGGGG - Intergenic
988389064 5:30603508-30603530 TCCCTAGCTGGATGGAAATGGGG + Intergenic
994327362 5:98463920-98463942 TCTCTAGGAGGAAGGAGTGTAGG + Intergenic
996467224 5:123816966-123816988 TCCCCAAGTCGATGGAGTTGGGG - Intergenic
997640349 5:135444918-135444940 TTCCTGTGTGGATGGAGTGTTGG + Exonic
997800962 5:136861635-136861657 TCCCTGGGTGGTGGGAGTGAGGG + Intergenic
998337073 5:141382941-141382963 TCCCCAGGAGGATGGAGAGCAGG - Exonic
998382208 5:141733786-141733808 TCCCTAGGAGGTGGGAATGGGGG + Intergenic
1002024158 5:176385429-176385451 CCCCCAGGTGGTTGGTGTGGTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004731834 6:18366491-18366513 AGCCTAGGGGGATGGTGTGGGGG + Intergenic
1005739025 6:28773833-28773855 TCCCTAGGGGGCTGGAGTATCGG + Intergenic
1006255310 6:32828091-32828113 TCCCAAGGTGGTCGTAGTGGTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007220578 6:40275734-40275756 GCCTTAGGAGGAGGGAGTGGAGG - Intergenic
1008036116 6:46746845-46746867 TCCCTAGGTGTCTGGTGGGGTGG - Intergenic
1010752719 6:79632544-79632566 TTCTTAAGTGGGTGGAGTGGAGG + Intronic
1011121762 6:83962097-83962119 TTACTAGGTGGATGGTGGGGTGG - Exonic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1016311583 6:142739044-142739066 CCTCTAGGTGGATGGAGTGTGGG + Intergenic
1017799458 6:157880108-157880130 TCCCCAGGTGAGTGGTGTGGTGG + Intronic
1018096993 6:160397125-160397147 TCCATGGATGGAGGGAGTGGGGG + Intronic
1019340407 7:506404-506426 TCTCTAGGTGGGCGGAGTGGAGG - Intronic
1019850702 7:3553828-3553850 TCCCTCAGTAGAAGGAGTGGTGG - Intronic
1024582636 7:50812462-50812484 TCCCTACGGAGATGGAGTGGGGG + Intergenic
1025204704 7:56985507-56985529 TCCCCAGGAGGGTGGTGTGGGGG - Intergenic
1025667233 7:63591428-63591450 TCCCCAGGAGGGTGGTGTGGGGG + Intergenic
1026491907 7:70870731-70870753 TTCCTGGATGGATGGAGGGGAGG - Intergenic
1027622984 7:80515353-80515375 TCCCTAGGTGGTTTGAGTTGTGG + Intronic
1029848698 7:103440717-103440739 GCTCTAGGTGGCTGGAGAGGTGG + Intronic
1030153420 7:106427892-106427914 GCATTAGTTGGATGGAGTGGAGG - Intergenic
1032075359 7:128833378-128833400 TCCCTAGGCAGATGGAGAAGTGG + Intronic
1032802087 7:135325058-135325080 TGCCCAGGTGGATTGAGGGGTGG + Intergenic
1034270471 7:149801195-149801217 TCCATGGGTGGATGGATGGGTGG - Intergenic
1036795496 8:11753584-11753606 TAGCTAGGGGGATGGGGTGGGGG + Intronic
1040935948 8:52782424-52782446 TTTCTGGGTGGATGAAGTGGAGG + Intergenic
1041959247 8:63593819-63593841 TCCCTGGTGGGATGGAGTTGGGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044555825 8:93561029-93561051 TCATGAGGGGGATGGAGTGGGGG - Intergenic
1044866616 8:96576992-96577014 TGGCTAGGTGGATGGAACGGTGG + Intronic
1047893379 8:129337752-129337774 TACCTAATTGGATGGAGAGGAGG - Intergenic
1052237507 9:26229614-26229636 TTCCTAGGAGAATGAAGTGGAGG - Intergenic
1054164131 9:61703847-61703869 TCCCAAGGTGGTTGGAGTTCAGG - Intergenic
1055320942 9:75083009-75083031 TTTCTGTGTGGATGGAGTGGGGG - Intronic
1056006175 9:82273782-82273804 TCACTAGGACGCTGGAGTGGAGG - Intergenic
1060449218 9:123721431-123721453 TACCCAGGTGGATGGGGAGGTGG - Intronic
1062277293 9:135736975-135736997 CCCCTACGTGGGGGGAGTGGGGG - Intronic
1062445199 9:136590795-136590817 TCCCTCTGGGGATGCAGTGGGGG - Intergenic
1185700948 X:2229388-2229410 TCCCTGGGTGGCTGGAGCAGAGG - Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1185989096 X:4873041-4873063 GCTATAGGTGGATGGAGTGATGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1189697480 X:43679607-43679629 TGCCTAAGGGGATGGAGCGGTGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193553843 X:82930523-82930545 TACCTAGGTGGAAGGCTTGGTGG - Intergenic
1196894288 X:120319595-120319617 TGCCTAGGTGGGAGGAGAGGAGG + Intergenic
1197038189 X:121903562-121903584 CCACTAGGAGGATGGGGTGGAGG + Intergenic
1198094903 X:133370007-133370029 TGACAAGGTAGATGGAGTGGAGG + Intronic
1199745642 X:150770617-150770639 GCCCTATGAGGATGGAGTGCCGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200846074 Y:7833343-7833365 TCCCTGGGGGGCTGGAGTGTCGG - Intergenic