ID: 1165804040

View in Genome Browser
Species Human (GRCh38)
Location 19:38569570-38569592
Sequence CCTGCTTTACAGAAGATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 334}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165804040_1165804051 27 Left 1165804040 19:38569570-38569592 CCTTTCATCTTCTGTAAAGCAGG 0: 1
1: 0
2: 5
3: 27
4: 334
Right 1165804051 19:38569620-38569642 CAGGAAGCAGCATGGCCAAGTGG 0: 1
1: 0
2: 5
3: 44
4: 411
1165804040_1165804046 -7 Left 1165804040 19:38569570-38569592 CCTTTCATCTTCTGTAAAGCAGG 0: 1
1: 0
2: 5
3: 27
4: 334
Right 1165804046 19:38569586-38569608 AAGCAGGCAGGGCGACAGGTGGG 0: 1
1: 0
2: 5
3: 31
4: 371
1165804040_1165804045 -8 Left 1165804040 19:38569570-38569592 CCTTTCATCTTCTGTAAAGCAGG 0: 1
1: 0
2: 5
3: 27
4: 334
Right 1165804045 19:38569585-38569607 AAAGCAGGCAGGGCGACAGGTGG 0: 1
1: 0
2: 0
3: 35
4: 338
1165804040_1165804047 -6 Left 1165804040 19:38569570-38569592 CCTTTCATCTTCTGTAAAGCAGG 0: 1
1: 0
2: 5
3: 27
4: 334
Right 1165804047 19:38569587-38569609 AGCAGGCAGGGCGACAGGTGGGG 0: 1
1: 0
2: 2
3: 51
4: 546
1165804040_1165804049 19 Left 1165804040 19:38569570-38569592 CCTTTCATCTTCTGTAAAGCAGG 0: 1
1: 0
2: 5
3: 27
4: 334
Right 1165804049 19:38569612-38569634 ACCTCACTCAGGAAGCAGCATGG 0: 1
1: 0
2: 17
3: 267
4: 1132
1165804040_1165804048 8 Left 1165804040 19:38569570-38569592 CCTTTCATCTTCTGTAAAGCAGG 0: 1
1: 0
2: 5
3: 27
4: 334
Right 1165804048 19:38569601-38569623 CAGGTGGGGTGACCTCACTCAGG 0: 1
1: 1
2: 0
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165804040 Original CRISPR CCTGCTTTACAGAAGATGAA AGG (reversed) Intronic
900052698 1:608117-608139 TCTGCTTTATAGATGAGGAAAGG - Intergenic
903085395 1:20853075-20853097 GCTGGTTTACATAAAATGAATGG - Intronic
905699028 1:39998104-39998126 CCTGCTTTAGAGATGATGAAGGG + Intergenic
906760472 1:48372722-48372744 CCTAGTTTTCAGAAGATGTATGG - Intronic
907755249 1:57304566-57304588 CCTGCTTTACAGAGGTAGAAAGG - Intronic
908646826 1:66287515-66287537 CCTGCTTTAAAGGAGCTGAGAGG + Intronic
908845597 1:68321345-68321367 CCTGCTTTACAGAAGAACCCTGG + Intergenic
910055843 1:83032258-83032280 CCTAGTTTTCAGAAGATGTATGG + Intergenic
910267574 1:85354825-85354847 CTTACATTAGAGAAGATGAAAGG + Intronic
910326398 1:86013077-86013099 TCTGTTTTACAGATGAGGAAAGG + Intronic
910352425 1:86313512-86313534 CCTGATGGATAGAAGATGAAGGG + Intergenic
910817918 1:91312060-91312082 CCTGGATTTCAGAAGATGTATGG + Intronic
911331491 1:96530325-96530347 CCTGGATTTCAGAAGATGTATGG + Intergenic
912311418 1:108625034-108625056 GCTGCTTTGCAGAAGTTGCAGGG - Intronic
912788237 1:112625064-112625086 GGTGTTTTACAGGAGATGAAGGG - Intronic
912950300 1:114116122-114116144 CCTGCGTTACAGACTATGAGAGG + Intronic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
913588164 1:120296824-120296846 CCAGCTTCACAGAAGATGGCAGG - Intergenic
913620021 1:120601545-120601567 CCAGCTTCACAGAAGATGGCAGG + Intergenic
914258980 1:145982946-145982968 CCTGGTTTACAGTAGAGAAAGGG + Intergenic
914570181 1:148908697-148908719 CCAGCTTCACAGAAGATGGCAGG - Intronic
914602647 1:149221572-149221594 CCAGCTTCACAGAAGATGGCAGG + Intergenic
916653045 1:166848694-166848716 CCTTCTTTGCAGATGAAGAAGGG - Intronic
916785822 1:168086457-168086479 CCTACTTTCCAGAAAATGTAAGG - Intronic
917377018 1:174359648-174359670 CCTTCTTTACAAAACATGATGGG + Intronic
918190198 1:182166342-182166364 CCTGTTTTACAGATGAGGACAGG - Intergenic
919290481 1:195623755-195623777 CCTAGTTTTCAGAAGATGTATGG + Intergenic
920287338 1:204890122-204890144 CTTGCCTGACAGAAGATGTAGGG + Intronic
920305567 1:205016143-205016165 CCTGCTTTGCAGAAGGGAAATGG - Intronic
920597941 1:207291869-207291891 CCTGATTTTCAGAGGATGTATGG + Intergenic
921312848 1:213861738-213861760 CCTCATTAACAGAAGATGCACGG + Intergenic
924858409 1:247897036-247897058 GCTGCTTTACAGATCATGATGGG - Intergenic
924907855 1:248475326-248475348 CCTGATTTACCGACAATGAATGG + Intergenic
924916254 1:248572756-248572778 CCTGATTTACCGACAATGAATGG - Intergenic
1062938803 10:1406850-1406872 CCTACTTCACAGATGATGAATGG + Intronic
1063641304 10:7833369-7833391 GCTGCTATAAAAAAGATGAAAGG - Intronic
1065862248 10:29881807-29881829 CATGCTTTACAGCAAAAGAATGG + Intergenic
1067315005 10:45152593-45152615 CCTGCTTTTCAGAAATTTAAAGG + Intergenic
1067812298 10:49439249-49439271 CCTGGATTTCAGAAGATGTATGG - Intergenic
1067827646 10:49589949-49589971 ACTGCTTTACAGAAGTAAAAAGG - Intergenic
1069043197 10:63716148-63716170 CCTGCTTCAAAGGAGAAGAAAGG - Intergenic
1069076847 10:64046196-64046218 ACAACTTTAAAGAAGATGAAAGG - Intergenic
1069175742 10:65286384-65286406 CCTACATTTCAGAAGATGTATGG - Intergenic
1069945511 10:71982846-71982868 CCTGCTTTACAGATGAAGTACGG + Intronic
1071018948 10:81029595-81029617 CCTACATTTCAGAAGATGTATGG - Intergenic
1072741253 10:97911282-97911304 CCTGCTTTGTAGAAAATGAAGGG - Intronic
1073679819 10:105690633-105690655 CCTACTTGACAGGAGAAGAAAGG + Intergenic
1074604294 10:114945104-114945126 CCCATTTTACAGAAGAAGAAAGG + Intronic
1076656015 10:132023884-132023906 TCTGCTCCACAGAAAATGAACGG - Intergenic
1076689750 10:132216859-132216881 CCTGCATTTCAGAGGATGTATGG + Intronic
1078770881 11:14350452-14350474 CATTCATGACAGAAGATGAAGGG - Intronic
1079425051 11:20332492-20332514 CCCATTTTACAGAAGAGGAAGGG - Intergenic
1085612602 11:77965719-77965741 CCTGTTTATCAGCAGATGAATGG - Intronic
1085984750 11:81772122-81772144 GCTGATATACAGAAAATGAAAGG + Intergenic
1087498931 11:98926711-98926733 TCAGCTTTACAGAGGATAAAGGG + Intergenic
1088365452 11:109035657-109035679 TCTGCCTAACAGCAGATGAAAGG + Intergenic
1090628966 11:128629587-128629609 CCTGTTTTACAGGATATGGAGGG - Intergenic
1093067499 12:14673848-14673870 TCTGCTTCACTGAAGATGCAGGG - Intronic
1093089413 12:14904642-14904664 CCGTCTTTGCAGAAGATAAAGGG + Intronic
1093638670 12:21501116-21501138 CCTGCTTCACAGTAGCGGAAGGG - Intronic
1093973944 12:25400821-25400843 CCTGGATTTCAGAAGATGTATGG + Intergenic
1094095138 12:26695300-26695322 TCTTCTTTACAGAAGAAAAAAGG + Intronic
1096305026 12:50466885-50466907 CCTGTGTCACAGAAGCTGAAAGG - Intronic
1096453941 12:51769971-51769993 CCTGCTTCACAGAAGGTGAAAGG + Exonic
1099370990 12:81829647-81829669 CCTGCCTTAGAGCAGAAGAAAGG - Intergenic
1099644411 12:85333685-85333707 CCTCCTTGAAAGAAGAAGAAAGG - Intergenic
1101359028 12:104008936-104008958 CCTACATTTCAGAAGATGTATGG + Intronic
1102623236 12:114213711-114213733 CTTGCTCTACAGAAACTGAATGG - Intergenic
1103383843 12:120516095-120516117 CTTTCTTTACAGGAGATGAGAGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105253071 13:18718392-18718414 CATGATTTACAGAAGCTGAGTGG + Intergenic
1106597022 13:31152922-31152944 CCTTCTTTACAGATGCTGAGAGG - Exonic
1109420450 13:62105204-62105226 CCTCCTTTAAAGAAGAAAAAAGG - Intergenic
1110241732 13:73274932-73274954 CTTGAATTACTGAAGATGAAAGG + Intergenic
1111080633 13:83302211-83302233 CCTGCTTTACAGAATATATTGGG + Intergenic
1114987677 14:28250950-28250972 CCTGGATTTCAGAAGATGTATGG - Intergenic
1115134332 14:30090867-30090889 CCTAGTTTACAGAAGATGTGTGG - Intronic
1116387387 14:44348333-44348355 CCTGGATTTCAGAAGATGTATGG + Intergenic
1116501305 14:45626158-45626180 CCTTCATTACAGAAGATCAAAGG + Intergenic
1118069607 14:62231870-62231892 CCTACATTTCAGAAGATGTATGG + Intergenic
1118090026 14:62464149-62464171 GCTGCTTTAAAGAAAAAGAAAGG - Intergenic
1119169313 14:72521769-72521791 CCTGTTCTACAGATGAGGAAAGG - Intronic
1119347399 14:73937754-73937776 ACTGCTTTACTGGAAATGAAGGG - Intronic
1123911002 15:24966956-24966978 CCTGCTTACCAGTAGATGATTGG + Intronic
1125101241 15:35915013-35915035 CCTGCTTCACAGAAGCTTATAGG + Intergenic
1126231397 15:46330379-46330401 CCTGCTTTTGAGAACCTGAATGG - Intergenic
1128732351 15:70029751-70029773 ACTGCTTGGCAGAAGGTGAAAGG + Intergenic
1129237202 15:74230812-74230834 CCTGCTCTGCAGATGAGGAATGG + Intergenic
1129654952 15:77517897-77517919 CCCATTTTACAGAAGAAGAAAGG - Intergenic
1129958215 15:79658746-79658768 CTTGCTTTAAAGAAGAAGGAGGG - Intergenic
1132599313 16:766955-766977 CTTGCTTTCCAGAACATGAACGG + Exonic
1135644291 16:24147785-24147807 CCTATTTTACAGATGAAGAAGGG - Intronic
1141045361 16:80711641-80711663 CCTACATTTCTGAAGATGAAAGG - Intronic
1143039735 17:4025000-4025022 GCTGCTTTGCAGAAGGTGACTGG + Exonic
1143210848 17:5186213-5186235 CCTGGATTTCAGAAGATGTATGG - Intronic
1143935715 17:10482027-10482049 CCTGGATTTCAGAAGATGTATGG - Intergenic
1146323659 17:31867063-31867085 CCTCCTTTACAGATGAGGATGGG + Intronic
1150621897 17:66814043-66814065 CCCATTTTACAGAAGAAGAAAGG + Intergenic
1151128305 17:71869010-71869032 CCTGCATTAAAGAAGAAGAGAGG + Intergenic
1152700003 17:81814009-81814031 CCTGCTTTCCAGGACATGCACGG - Exonic
1154150276 18:11901108-11901130 CTGGCTTTTCAGAAGATGAAAGG + Intronic
1154335119 18:13458836-13458858 CTGGCTTTCCAGATGATGAAGGG + Intronic
1154508055 18:15061692-15061714 CCTGCATTGCAGTAGCTGAAGGG + Intergenic
1155621511 18:27785445-27785467 AGTGCTTTACAGCAGAAGAAAGG + Intergenic
1155871601 18:31036334-31036356 GATGATTTACAGAAGATAAATGG - Intronic
1156192820 18:34739424-34739446 CCTGCTTTGCAGACTATTAATGG + Intronic
1156516842 18:37687421-37687443 CCTGCTCTCCAGAAGCTGTAGGG - Intergenic
1156583779 18:38409616-38409638 CCTAGGTTTCAGAAGATGAATGG + Intergenic
1156769167 18:40698523-40698545 CCTGGATTTCAGAAGATGTATGG + Intergenic
1162661347 19:12171487-12171509 ACTATTTTACAGAAGATGAAAGG - Intronic
1163223544 19:15938809-15938831 CCTGCTTTACAGAATATTAGAGG + Intergenic
1164460355 19:28442288-28442310 CATGCATTACAGAATGTGAAAGG - Intergenic
1164670646 19:30070319-30070341 CCTGCTCCGGAGAAGATGAAGGG - Intergenic
1165549364 19:36570777-36570799 CTTGATTTACAGAAAATGTATGG + Intronic
1165804040 19:38569570-38569592 CCTGCTTTACAGAAGATGAAAGG - Intronic
1166422186 19:42646061-42646083 CCTCCTATACAGAAGAGAAACGG - Intronic
1166879479 19:45918999-45919021 CCTGTTTTACAGATGAGCAAAGG + Intergenic
1167810511 19:51825490-51825512 CCTGCTTTGGGGTAGATGAAAGG + Exonic
1167863643 19:52306300-52306322 CCTGCTTGACAGCACTTGAAGGG + Intronic
1168277556 19:55285911-55285933 CCTGAGTTACAGGAGAAGAAGGG + Intronic
1168496993 19:56861598-56861620 CCTATTTTACAGATGAGGAAGGG + Intergenic
1168564307 19:57410822-57410844 TGTGCTTTACAGAATCTGAAAGG + Intronic
925511349 2:4629146-4629168 TCTGCTTGACAGGAGATGAAAGG + Intergenic
925816554 2:7757075-7757097 CCTGTTTTACAGAATATTAATGG - Intergenic
925857901 2:8148366-8148388 CCTGACTTACAGAAGCAGAAAGG + Intergenic
927380735 2:22476645-22476667 CCTAGATTACAGAAGATGAATGG + Intergenic
928075758 2:28263034-28263056 CTTGCCTTCCAGTAGATGAAAGG + Intronic
928259947 2:29757457-29757479 CCTTCCTTACAGGACATGAAAGG - Intronic
929453415 2:42050832-42050854 CCTGATGGTCAGAAGATGAATGG - Intronic
930006776 2:46904150-46904172 CCTAGTTTTCAGAAGATGTATGG + Exonic
930023955 2:47018816-47018838 CCTGTTTTACAGAAGAGAGAAGG + Intronic
931397322 2:61899195-61899217 CCTGCTTTAAAGAAGAAAAGGGG - Intronic
933064175 2:77773051-77773073 CCTAGATTTCAGAAGATGAATGG - Intergenic
933175780 2:79171056-79171078 CCTGCTATACAGAAAATGAGGGG + Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935079324 2:99776975-99776997 CCTGCTTTAAAGAAGCTTACAGG + Intronic
935106210 2:100046119-100046141 CCTGTTTTACAGATCAAGAAAGG - Intronic
937216607 2:120317153-120317175 CCAGGTTTACAGAAGGAGAAAGG - Intergenic
937796683 2:126030915-126030937 CTTTCTTCAAAGAAGATGAAAGG + Intergenic
939079179 2:137639359-137639381 CCTGTATTTCAGAAGATGTATGG + Intronic
941155115 2:161968159-161968181 CCTGTTTCACAGAAAATAAAAGG - Intronic
942889012 2:180964813-180964835 CCTGCATTTCAGAAGTTGTATGG + Intergenic
943262151 2:185679760-185679782 CCTGCTTTCCTGATGATGGAAGG - Intergenic
943313228 2:186353483-186353505 CCTACATTTCAGAAGATGTATGG + Intergenic
943548425 2:189309901-189309923 CCTGGTCAACAGAATATGAATGG - Intergenic
943565347 2:189509924-189509946 CCTGGATTTCAGAAGATGTATGG + Intergenic
944982003 2:205132000-205132022 CCTGTGTTACAGAAGAGGAATGG - Intronic
945172154 2:207008051-207008073 CCTTCCTTTCAGAGGATGAAGGG + Intergenic
945186772 2:207147514-207147536 CCTCATTTACAGAAGATAATTGG + Intronic
946574250 2:221057169-221057191 CCTGGATTTCAGAAGATGTATGG - Intergenic
947008439 2:225538353-225538375 CCTAGTTTTCAGAAGATGTATGG - Intronic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
1169311479 20:4545370-4545392 CCTGCCTTAAAAAAGAAGAAAGG - Intergenic
1170077533 20:12436002-12436024 CCTGGTTAACAGAAGATGACTGG - Intergenic
1170433502 20:16298774-16298796 TCTGGTTTTCAGAAGATGCAGGG + Intronic
1171094152 20:22315608-22315630 TCTACTTTACAGAAGATCTAAGG + Intergenic
1171445542 20:25200916-25200938 CTTGCTTTAGAAAAGAAGAAAGG - Intronic
1172356484 20:34283852-34283874 CCAGCCTTTCAAAAGATGAAGGG + Intronic
1173713233 20:45178838-45178860 CCTGCCTGACTGAACATGAAAGG - Intergenic
1174302750 20:49594139-49594161 TCTGTTTTACAGATGATGGAAGG - Intergenic
1175632639 20:60555245-60555267 CCTGCTTTACACAGGATCATGGG - Intergenic
1175791125 20:61740545-61740567 CCTGCTTTCCAGGAGAAGAAAGG - Intronic
1175918281 20:62437818-62437840 AGTGCTTTATGGAAGATGAAAGG + Intergenic
1175918286 20:62437854-62437876 TCTTCTTTAGAGAAGAGGAAGGG + Intergenic
1176790024 21:13310107-13310129 CCTGCATTGCAGTAGCTGAAGGG - Intergenic
1176838576 21:13818277-13818299 CATGATTTACAGAAGCTGAGTGG + Intergenic
1178418518 21:32424340-32424362 CCTGCTCAACAGGAGATGACAGG + Intronic
1178587384 21:33881533-33881555 GCTGCTTTCCAGAAGCTCAAAGG + Intronic
1179062944 21:37996467-37996489 CCTGCTTTTCAGATGAGGAAAGG - Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181986664 22:26804736-26804758 CCTACTTTACAGATGAGGAAAGG + Intergenic
1182013362 22:27018882-27018904 CCTGCTTTACAATGGATGGATGG - Intergenic
1182330165 22:29546002-29546024 CCTGGATTTCAGAAGATGTACGG - Intronic
1182882266 22:33743730-33743752 CCCATTTTACAGATGATGAAAGG + Intronic
1184628183 22:45754319-45754341 TCTACTTTACAGATGAAGAAAGG - Intronic
1184931703 22:47686178-47686200 CCTGTTTTGCAGAAGAGAAAAGG - Intergenic
1185343832 22:50302890-50302912 CCTGCTTTGGAGGAGATGGAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949566717 3:5252039-5252061 CCTGCTTTGTAGATGAAGAAAGG - Intergenic
949677797 3:6477609-6477631 TCAGCTTTACAGCAGATGTAGGG - Intergenic
952438429 3:33296910-33296932 CCTTTTTTACAGAAATTGAAAGG - Intronic
952546445 3:34424908-34424930 CCTGCTTTGCAGTGGCTGAATGG + Intergenic
952735040 3:36680930-36680952 CCTGTATTTCAGAAGATGCATGG - Intergenic
952818080 3:37462880-37462902 CTTGTTTTACAGAAAAGGAAAGG + Intronic
952979498 3:38723422-38723444 ACTGCTTCACAGAAGGTGAAGGG - Exonic
953797714 3:45997985-45998007 CCTGCCTTAAAGCAGGTGAAAGG + Intergenic
954408269 3:50357586-50357608 CTTGGTTTACAGATAATGAAAGG + Intronic
954888216 3:53896554-53896576 CCTGGGTTACAGGAGAAGAAAGG - Intergenic
956750792 3:72342314-72342336 CCTGTTTCACAAAAGAAGAAAGG + Intergenic
957856899 3:85891171-85891193 CTTGCTATGCAGAAGATTAAAGG - Intronic
958059775 3:88464888-88464910 TCTATTTTACAGATGATGAATGG + Intergenic
959894126 3:111587695-111587717 CCTACATTTCAGAAGATGTATGG - Intronic
960007933 3:112800174-112800196 CCTGCTTCACAAATGAAGAAAGG - Intronic
960310709 3:116113311-116113333 GTTGTTTTACAGAGGATGAATGG - Intronic
960519185 3:118635870-118635892 CTTGCTATATATAAGATGAAGGG - Intergenic
960958758 3:123054263-123054285 CCTCCTTGACAGAGGGTGAAAGG - Intergenic
961046375 3:123711515-123711537 CCTGCCTCACAGGAGCTGAAGGG + Intronic
961424254 3:126832581-126832603 CCTGTTTTACAAAGGAAGAATGG + Intronic
962170788 3:133099100-133099122 CCTAGATTTCAGAAGATGAATGG - Intronic
962589331 3:136872899-136872921 CCTGCATTTCAGAAGATGTATGG + Intronic
962879257 3:139560826-139560848 CCTTCTTTACAGGAGAGGAAAGG - Exonic
963252381 3:143115155-143115177 CCTGGTTTACAAAACCTGAAGGG - Intergenic
963611524 3:147474868-147474890 TCTACTTTACAGATGATGAAAGG + Intronic
966123392 3:176547988-176548010 CCTGGATTTCAGAAGATGTATGG - Intergenic
966191984 3:177279861-177279883 CTGGCTTTACAGGTGATGAATGG + Intergenic
966598632 3:181751742-181751764 CCTGTTTTATACAAGAAGAAAGG - Intergenic
966807881 3:183820443-183820465 CCTGCTTTTCGGATGAAGAAAGG + Intronic
967844721 3:194034662-194034684 ACTGCATTACAGAAGAAGAAAGG + Intergenic
970048873 4:11887983-11888005 TCTGGTTTACAGGAGATGACTGG + Intergenic
971307816 4:25498834-25498856 CCTATTTTACAGATGAGGAATGG - Intergenic
971615042 4:28777997-28778019 CCTGCTTTATTGAAGATTCAAGG + Intergenic
972431541 4:38987744-38987766 CTTGTTTTACAGAGGATGTAAGG + Intronic
973790995 4:54378052-54378074 CCTGCTTTAAAGAAAACAAAAGG + Intergenic
974037235 4:56827728-56827750 CCTAGATTTCAGAAGATGAATGG + Intergenic
974144484 4:57930070-57930092 CCTGTGTTACAGAATAAGAAGGG - Intergenic
974341089 4:60615873-60615895 CCTGTATTTCAGAAGATGTATGG + Intergenic
974981886 4:68967156-68967178 CCTACTTTTCAGAGGATGTACGG - Intergenic
975100392 4:70506566-70506588 ACTTCTTCACAAAAGATGAAGGG - Intergenic
976771074 4:88653304-88653326 CCTGCTTTACATAAGGTGGTGGG + Intronic
977227123 4:94405885-94405907 CTTGCTTGTAAGAAGATGAAAGG - Intergenic
977269019 4:94891804-94891826 CATGCTTTACAGAGAAAGAATGG + Intronic
977369509 4:96117372-96117394 CCTGTTTTACTGAAGTTTAAGGG + Intergenic
978551216 4:109929307-109929329 TCTATTTTACAGAAGAAGAAAGG - Intronic
978841224 4:113215285-113215307 CCTTCTTTACAGATGGGGAATGG - Intronic
979209246 4:118079351-118079373 GCTGATTTAGAGAAGCTGAAAGG + Intronic
979500484 4:121434430-121434452 CCTGGGTTTCAGAAGATGTATGG - Intergenic
980976953 4:139620327-139620349 CCCTCTTTACAGATGAAGAAAGG + Intergenic
981296117 4:143133813-143133835 CCTGTTTTACAAAAGGAGAAGGG - Intergenic
982045152 4:151437580-151437602 CCTGCTTTACACAGTAGGAATGG - Intronic
982279144 4:153666102-153666124 CCTACATTTCAGAAGATGTATGG + Intergenic
983342736 4:166485900-166485922 CTTCCTTTACATAAGAGGAAAGG + Intergenic
983617152 4:169720092-169720114 CCTCCTTTACAAAAAAAGAAAGG + Exonic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
986599321 5:9455908-9455930 CCTGCTTCCCCGAAGAAGAAGGG - Intronic
987163631 5:15171407-15171429 GCGGCTTTACAGCATATGAAAGG + Intergenic
987390306 5:17369045-17369067 CCTCCTTTTCAGAAAATGACAGG - Intergenic
988129122 5:27080116-27080138 CCTGCATTTCAGAAGACGGATGG - Intronic
988453212 5:31363958-31363980 CCTGCTTTAGAATAAATGAAGGG + Intergenic
988808917 5:34766062-34766084 CCTGGATTTCAGAAGATGTATGG + Intronic
988830880 5:34986248-34986270 CCTGCTAAAAAGAAGAAGAAGGG + Intergenic
990248261 5:53885316-53885338 CCTGATTTAGAAAAGATCAAAGG + Exonic
990539126 5:56754803-56754825 CCTATTTTACAGATGAGGAAAGG + Intergenic
994407988 5:99369908-99369930 GCTGCTTTACTGCAGCTGAAAGG + Intergenic
994552790 5:101258763-101258785 CCTACATTTCAGAAGATGTATGG + Intergenic
996219331 5:120910407-120910429 TCTGCTTTGAAGAACATGAAGGG + Intergenic
996760662 5:126983233-126983255 CCTGTTTTTCAGTAAATGAAGGG + Intronic
997150801 5:131492775-131492797 TCTGCTTAACAGAAGATGAATGG - Exonic
997266758 5:132499318-132499340 CCTACTTTCCAGGAGAGGAATGG - Intergenic
997360924 5:133294366-133294388 CCCATTTTACAGAAGAGGAACGG - Intronic
999108017 5:149091036-149091058 CCTGGATTTCAGAAGATGTATGG + Intergenic
999346090 5:150820710-150820732 CCTAGATTTCAGAAGATGAATGG - Intergenic
999960239 5:156747338-156747360 CCTGACCTACAGAAAATGAAAGG - Intronic
1000263332 5:159611221-159611243 CCTGCTGAAAAGAAGATGAGCGG + Intergenic
1000947199 5:167436888-167436910 CCTACATTTCAGAAGATGTATGG + Intronic
1001181661 5:169526191-169526213 CCTAGTTTTCAGAAGATGTATGG - Intergenic
1001795515 5:174499009-174499031 CCTGGATTTCAGAAGATGTATGG + Intergenic
1002703475 5:181143731-181143753 CCTGCTTCCCTGAAGATGGAAGG + Intergenic
1002883243 6:1271488-1271510 CCCTTTTTACAGATGATGAATGG + Intergenic
1004498950 6:16191842-16191864 CCTTCTTTACAAAAGCTTAAAGG + Intergenic
1006691842 6:35894827-35894849 ACTTCTTCAGAGAAGATGAATGG - Intronic
1007269640 6:40626748-40626770 CATGCTTTACAAAGGATAAATGG - Intergenic
1007703154 6:43775943-43775965 TCTGCTTTCCAGAAGAATAAAGG - Intronic
1007839775 6:44706285-44706307 CCTGCCTTACAGAGAATCAAGGG - Intergenic
1009901007 6:69807827-69807849 CCTGGATTTCAGAAGATGTATGG - Intergenic
1010884372 6:81218170-81218192 CCTGGATTTCAGAAGATGTATGG + Intergenic
1010973224 6:82284696-82284718 TCTGTTTTTCAGAAAATGAACGG + Intergenic
1011509713 6:88087205-88087227 AAAGCTTTACAGAATATGAAAGG - Intergenic
1013068926 6:106710585-106710607 CTTGCCTTACACAGGATGAAGGG - Intergenic
1013745532 6:113341208-113341230 TCTGCTTTGGAGAAGATGGAAGG + Intergenic
1013840705 6:114389563-114389585 GCTGCTTTGCAGAAAATTAAAGG - Intergenic
1013928609 6:115502835-115502857 CCTGGATTTCAGAGGATGAATGG + Intergenic
1013943044 6:115688858-115688880 ACTGTTTTGCAGAAGAGGAAGGG - Intergenic
1014561622 6:122898197-122898219 CCTGTTTTAAAGAAGTTGTAAGG + Intergenic
1014730960 6:125030965-125030987 CCTACATTTCAGAAGATGTAGGG - Intronic
1015588228 6:134797744-134797766 CTTGCTTTGTAAAAGATGAAAGG - Intergenic
1016192388 6:141287130-141287152 CCTGCCTTACAAAGGCTGAAAGG - Intergenic
1016756016 6:147687596-147687618 TCTGCATTAAAGAAGATTAATGG - Intronic
1017435816 6:154414716-154414738 ACTCCTTTACAGAAGAGGAAAGG - Intronic
1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG + Intronic
1018412036 6:163559606-163559628 CCTACTTTGCAGAAGATTACAGG - Intronic
1019219930 6:170465078-170465100 CCTGCTTTCCACAAGCTGACTGG + Intergenic
1019246811 6:170714701-170714723 TCTGCTTTATAGATGAGGAAAGG + Intergenic
1020012222 7:4812179-4812201 CATGCTTTAGAGAAACTGAAAGG - Intronic
1023650518 7:42364371-42364393 CCTTCATTTCAGAAGATGTAGGG - Intergenic
1025099021 7:56120516-56120538 CCTGCTTTTCAGAAATTAAAAGG - Intergenic
1026140806 7:67704788-67704810 TTTGCATTACAGAAGATGGATGG - Intergenic
1026463577 7:70634994-70635016 CCCTCTTTACAGATGGTGAAGGG - Intronic
1026768535 7:73176560-73176582 CCTGCTTTTCAGAAATTAAAAGG + Intergenic
1027009405 7:74729932-74729954 CCTGCTTTTCAGAAATTAAAAGG + Intronic
1027059570 7:75074369-75074391 CCTGTTTTATGGAAGATGACTGG + Intergenic
1027078638 7:75216096-75216118 CCTGCTTTTCAGAAATTAAAAGG - Intergenic
1027657088 7:80944127-80944149 CCTATTTTACAGAGGATAAAAGG + Intergenic
1027869171 7:83684955-83684977 TCTGTTTCCCAGAAGATGAAGGG + Intergenic
1029047476 7:97645398-97645420 CCTGGATTTCAGAAGATGTATGG + Intergenic
1029202608 7:98848995-98849017 CCTAGTGTACAGCAGATGAAAGG + Intronic
1029221586 7:98994812-98994834 CCTGTCTTTCAGAAGCTGAAAGG + Exonic
1029257082 7:99276751-99276773 CATGTTAGACAGAAGATGAAAGG + Intergenic
1029859231 7:103551519-103551541 CCTGCTTTTTATAAAATGAAGGG - Intronic
1031844187 7:126784603-126784625 CCTTCTTCACAGAAGCTGAAAGG + Intronic
1031928362 7:127659971-127659993 CCTGCTTTATGCAAGATAAACGG - Intronic
1032072536 7:128817451-128817473 CCTGCTTGACAGGATATGAGAGG + Intronic
1032318278 7:130861216-130861238 CCTAGATTTCAGAAGATGAATGG + Intergenic
1032744977 7:134777425-134777447 CCTGGTTTTTAGAAGATAAATGG - Intronic
1032746068 7:134787539-134787561 CCTGCCCTAGAGAAGATGTAGGG - Intronic
1032976821 7:137234222-137234244 ACTGATGTACAAAAGATGAAAGG - Intronic
1033031391 7:137830714-137830736 CCTGTTATACAGAAAAGGAAAGG + Intronic
1035118431 7:156544697-156544719 TTTACTTTACAGAAGAAGAATGG - Intergenic
1035501330 8:93259-93281 TCTGCTTTATAGATGAGGAAAGG - Intergenic
1036392291 8:8334003-8334025 CCTGCATCAGAGAGGATGAAGGG + Intronic
1036451426 8:8871186-8871208 CCTGGTTTACAGATGAGGAGTGG - Intronic
1038272081 8:26083269-26083291 GCTGGTACACAGAAGATGAAAGG + Intergenic
1038746535 8:30259814-30259836 CCTCATTTACAGATGAGGAAAGG - Intergenic
1040041550 8:42920620-42920642 CCTAGTTTACAGAGTATGAAGGG + Intronic
1042361090 8:67884152-67884174 CCTGCTTTAGAGAAGAGAAATGG - Intergenic
1042722154 8:71838044-71838066 CCTGACTTACAGAAGAGGTAAGG + Intronic
1044238941 8:89866202-89866224 CCTAATTTGCACAAGATGAAAGG - Intergenic
1045068595 8:98476966-98476988 CCTGCTTTTATGAAGAAGAAAGG - Intronic
1045870030 8:106915925-106915947 CCTCCTTTACACAAGATGGGTGG - Intergenic
1046125019 8:109895217-109895239 TCTGTTTTATAGATGATGAATGG + Intergenic
1046607620 8:116388897-116388919 TCTGCTTTTCAGATGATGTATGG + Intergenic
1050151031 9:2620014-2620036 ACTGCTTTACAGAAGAGGAAAGG - Intergenic
1052091390 9:24332396-24332418 CCTACTTTACAGGTGAAGAAAGG + Intergenic
1052140046 9:24970004-24970026 CCTGCTTTACACACAATGGACGG + Intergenic
1052203611 9:25811473-25811495 CCAGCAGGACAGAAGATGAAGGG - Intergenic
1053882653 9:42611488-42611510 CCTGGATTTCAGAAGATGTATGG - Intergenic
1053890016 9:42682814-42682836 CCTGGATTTCAGAAGATGTATGG + Intergenic
1054221680 9:62418956-62418978 CCTGGATTTCAGAAGATGTATGG - Intergenic
1054229034 9:62490217-62490239 CCTGGATTTCAGAAGATGTATGG + Intergenic
1054928332 9:70610812-70610834 CTTACTTTACAGATGAGGAAAGG + Intronic
1055028958 9:71752670-71752692 ACTGTTTGGCAGAAGATGAAGGG - Intronic
1055761072 9:79608593-79608615 ACTGCTGTACAGAAAACGAATGG + Intronic
1055794069 9:79955342-79955364 CCTAGATTTCAGAAGATGAATGG + Intergenic
1056023136 9:82462639-82462661 CCTCCTATACTGGAGATGAAAGG + Intergenic
1056476091 9:86952508-86952530 CCTGCTTTACTGTGCATGAAAGG - Intergenic
1056595161 9:88002018-88002040 CCTGGATTTCAGAAGATGTATGG + Intergenic
1058219565 9:102280581-102280603 CCTGCTTTCAAGAAGAAAAAGGG - Intergenic
1058837304 9:108869668-108869690 CCTGCTTTAAAAAAAGTGAATGG + Intronic
1059852256 9:118355761-118355783 TCTCCATTACAGAAGATAAAAGG + Intergenic
1060428343 9:123525593-123525615 CCTGCTCTACAGGAGCTAAAGGG + Intronic
1061996716 9:134189898-134189920 CCTGCTTTGCACCAGATGGAAGG - Intergenic
1062157887 9:135063851-135063873 CCTAGTTTTCAGAAGATGTATGG - Intergenic
1203607583 Un_KI270748v1:70153-70175 TCTGCTTTATAGATGAGGAAAGG + Intergenic
1186148962 X:6654089-6654111 CCTGCCTTACAGAAAATGCTGGG - Intergenic
1186165298 X:6821017-6821039 CCTAGATTTCAGAAGATGAATGG - Intergenic
1187998102 X:24951144-24951166 CCTGTTTTGGTGAAGATGAAGGG - Intronic
1188997610 X:36904951-36904973 CCTGGATTTCAGAAGATGTATGG + Intergenic
1189371288 X:40431580-40431602 CCTGGATTTCAGAAGATGTATGG + Intergenic
1191595703 X:62941690-62941712 CCTGCTTTAATGGTGATGAAGGG + Intergenic
1192032199 X:67525578-67525600 CCTGCTCTTCAGAAGCTCAAAGG + Intergenic
1193459723 X:81775867-81775889 CCTGGATTCCAGAAGATGTATGG - Intergenic
1194089073 X:89563584-89563606 CCTAGATTTCAGAAGATGAATGG - Intergenic
1194895292 X:99432584-99432606 CCTGCATTTCAGAGGATGTATGG + Intergenic
1195152431 X:102085597-102085619 CCTGGTTTACAGATGACCAAAGG + Intergenic
1195362005 X:104091632-104091654 CGTACTTCACAGAAGAGGAAAGG - Intergenic
1197160563 X:123317955-123317977 CCTGGATTTCAGAAGATGTATGG - Intronic
1197856392 X:130918012-130918034 CCTGCCTCACAGAAGTTGGAAGG - Intergenic
1199301720 X:146221124-146221146 CCTGGATTCCAGAAGATGTATGG - Intergenic
1199527669 X:148810672-148810694 CCTCTTTTACAGACGAGGAAAGG - Intronic
1199645317 X:149904134-149904156 CCTCCTCTGCACAAGATGAATGG + Intergenic
1200441741 Y:3219634-3219656 CCTAGATTTCAGAAGATGAATGG - Intergenic
1200824904 Y:7627374-7627396 CCTGCCTTCCAGAGGAGGAATGG + Intergenic
1202235151 Y:22703713-22703735 CCTGCCTTCCAGAGGAGGAATGG - Intergenic
1202308008 Y:23492455-23492477 CCTGCCTTCCAGAGGAGGAATGG + Intergenic
1202562793 Y:26178131-26178153 CCTGCCTTCCAGAGGAGGAATGG - Intergenic