ID: 1165804230

View in Genome Browser
Species Human (GRCh38)
Location 19:38570827-38570849
Sequence CAGGCTGGACACCTGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165804219_1165804230 22 Left 1165804219 19:38570782-38570804 CCACTGAAGGGATAAGGTATTGG 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1165804230 19:38570827-38570849 CAGGCTGGACACCTGGATCCTGG 0: 1
1: 1
2: 3
3: 29
4: 299
1165804218_1165804230 25 Left 1165804218 19:38570779-38570801 CCTCCACTGAAGGGATAAGGTAT 0: 1
1: 0
2: 0
3: 3
4: 87
Right 1165804230 19:38570827-38570849 CAGGCTGGACACCTGGATCCTGG 0: 1
1: 1
2: 3
3: 29
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165804230 Original CRISPR CAGGCTGGACACCTGGATCC TGG Intronic
900146121 1:1159507-1159529 CTGGCTGAACACCTGCTTCCCGG - Intergenic
900347482 1:2216570-2216592 TTGGGTGGACACCTGGCTCCCGG + Intergenic
900495991 1:2976456-2976478 CCAGGTGGACACCAGGATCCAGG - Intergenic
900536375 1:3179690-3179712 AAGGCCGGGCACCTGCATCCTGG + Intronic
900711341 1:4116529-4116551 GATCCTGGACACCTTGATCCTGG - Intergenic
901063524 1:6484741-6484763 CAGGAGGGACACCAGGGTCCGGG + Intronic
902570838 1:17346202-17346224 CAGGCTGAACCCCAGGAGCCCGG - Intronic
903123739 1:21233761-21233783 CAGGCTGGAGACCGGAATGCAGG + Intronic
903596973 1:24502682-24502704 CAGGCTGGGGACCAGGAACCCGG + Intronic
904012891 1:27399773-27399795 CAGGCTGGAAAACAGGCTCCCGG + Intergenic
904468209 1:30720206-30720228 CAGGCTGAACACCTGGAGTCTGG + Intronic
905239099 1:36571072-36571094 CAGGCAGGACACCTGGCTAATGG - Intergenic
906562235 1:46767667-46767689 CAGGCTAGAGAGCTGAATCCAGG - Intronic
906961572 1:50422442-50422464 CAGGCGCGGCCCCTGGATCCCGG - Intronic
907015677 1:51010476-51010498 CAGGCTGGTCACTTGGGGCCAGG - Intergenic
907251290 1:53141582-53141604 CAGGCTGGAAACCCGGGGCCTGG + Intronic
909787446 1:79633039-79633061 CAGGCTGGAAACCAGGACCTTGG - Intergenic
912565350 1:110583762-110583784 CAGGCTGGGAACCAGGGTCCTGG + Intergenic
917706908 1:177643987-177644009 CAGGAGAGACACCAGGATCCTGG + Intergenic
918257934 1:182766942-182766964 GAAGCTGGGCACCTGGATTCTGG + Intergenic
919905595 1:202076161-202076183 CAGGCTGGAGACCTGGCACTGGG + Intergenic
920245185 1:204582535-204582557 CAGGAAGGACACGTGGCTCCTGG + Intergenic
922459414 1:225803416-225803438 CAGGCTGACCACCTGGGGCCTGG - Intergenic
922472705 1:225886799-225886821 CAGGCTGACCACCTGGGGCCTGG + Exonic
922480518 1:225937513-225937535 CAGGCTGACCACCTGGGGCCTGG + Exonic
923050357 1:230387483-230387505 CAGCCTGGCCTCCTGGATGCTGG - Intronic
924552199 1:245089301-245089323 CTGGCTGGAGACCTGGATTTTGG + Intronic
1065646526 10:27840622-27840644 GTGGCTGGATACCTAGATCCAGG + Intronic
1067088548 10:43255167-43255189 CAGGAAGGACAGCAGGATCCAGG + Intronic
1069772189 10:70907089-70907111 CAGGCTAGACACCTCCTTCCTGG - Intergenic
1069869981 10:71527174-71527196 CAGGCTGGGCAGCTTGTTCCTGG + Intronic
1070341082 10:75499027-75499049 CAGGCTGGGAACCTGGAGGCAGG + Intronic
1070501640 10:77078229-77078251 CAGACAGGACACCTGGCTCCAGG + Intronic
1072463893 10:95645704-95645726 CAGGCTTGGCATCTAGATCCTGG + Intronic
1073462143 10:103671926-103671948 CAGACTGGAAACCTGCACCCTGG + Intronic
1075236584 10:120736449-120736471 GAGGCAGGACACCTGGATGATGG + Intergenic
1076402812 10:130194721-130194743 CAGGCTCGGCCCCTGGCTCCTGG + Intergenic
1076464328 10:130667897-130667919 AAGGCTGGTCCCGTGGATCCAGG - Intergenic
1076835824 10:133020585-133020607 CAGGCGGGATCCCTGGATCTTGG - Intergenic
1077311665 11:1891538-1891560 CTGGCTGGAGACCTGACTCCTGG - Intronic
1081492915 11:43581132-43581154 GAGGCTGGGCTCCGGGATCCGGG + Intronic
1082105472 11:48216857-48216879 CACTCTGCACAGCTGGATCCTGG - Exonic
1083474821 11:62909033-62909055 CAGTCAGGACACCTGGCTCCTGG + Exonic
1083660506 11:64249799-64249821 CAGGATGGGCACCTGTTTCCTGG - Intergenic
1083770465 11:64864205-64864227 CAGGCTGGAGGCCAGGACCCCGG - Intronic
1083828830 11:65218161-65218183 CATGGTGGAGACCTGGCTCCTGG + Intergenic
1084551044 11:69842346-69842368 CAGCCTGGCCACTTGGTTCCAGG - Intergenic
1084915106 11:72422869-72422891 CATTCTGGACACCTCAATCCTGG + Intronic
1085025919 11:73236589-73236611 CAGGCTGGACAGCTGACTCCAGG + Intergenic
1086559782 11:88154481-88154503 CAGGCTGGACACCTGCAGTTTGG - Intronic
1089605325 11:119638228-119638250 CAGGTTGTCCACCTGGACCCAGG - Intronic
1090472092 11:126989801-126989823 CAGGCAAGATAACTGGATCCTGG - Intronic
1090929643 11:131283977-131283999 CAGGCTTGAAACCAGGCTCCTGG - Intergenic
1091245484 11:134090604-134090626 TAGCCTGAACATCTGGATCCTGG + Intronic
1092047649 12:5443369-5443391 CAGGAAGGATACCTGGATGCAGG + Intronic
1095440603 12:42235869-42235891 CAGGCTGAATACCTGGCACCTGG - Intronic
1098094171 12:66936853-66936875 GAGGCAGGATACCTGGGTCCAGG + Intergenic
1101127649 12:101653973-101653995 CAGGCAGAACACCTGAAGCCAGG + Intronic
1101454451 12:104815730-104815752 CAGCCTGGAAACCTGGATTAGGG - Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1103719339 12:122965196-122965218 CAGGATGGAGACCCGCATCCAGG + Intronic
1104870136 12:131989094-131989116 CAGGCTGGACATGTGGATGCTGG + Intronic
1105210299 13:18253376-18253398 CAGGGAGGCCACCTGGAGCCTGG + Intergenic
1108516558 13:51208746-51208768 CAGCCTGTATACCTGGATTCAGG + Intergenic
1109954088 13:69542978-69543000 CAGGCAGGTCACCTGGAGTCGGG - Intergenic
1111766472 13:92536544-92536566 CAGGCTGGACACCTAGAGTGGGG - Intronic
1112506735 13:99980464-99980486 CACGCTGGACGCCCGGCTCCCGG + Intergenic
1113372104 13:109733637-109733659 GAGCCTGGACAGGTGGATCCGGG - Intergenic
1114560041 14:23583008-23583030 CAGGCTGGAGGCCTGGAGCTAGG + Intergenic
1114629709 14:24151254-24151276 CTGGCTGGACAGCAGGACCCTGG + Exonic
1114663794 14:24367211-24367233 CAGGCTGGACACCTGTCACCTGG - Exonic
1116070390 14:40037149-40037171 CAGCCTGGAAACCTGGTTTCAGG - Intergenic
1120932980 14:89867138-89867160 GAGGCAGGAGACCTGGTTCCTGG - Intronic
1121226941 14:92328094-92328116 GAGGCCTGGCACCTGGATCCAGG - Intronic
1121431079 14:93888890-93888912 GAGGCAGCACACCAGGATCCTGG - Intergenic
1122066315 14:99176298-99176320 CAGGCAGGGCACTGGGATCCCGG - Intronic
1122295989 14:100706018-100706040 CAGGCTGTACACCGGGCTCGGGG + Intergenic
1122622885 14:103069921-103069943 CAGGCTGTACACCAGGACACAGG + Intergenic
1122694851 14:103547542-103547564 CAGGCTGGACGGCTGGAGCAAGG - Intergenic
1124661713 15:31555138-31555160 CAGGATGGACAGCTGGATGGTGG + Intronic
1126569737 15:50137843-50137865 CAGTCAGGAGACCTGGGTCCTGG - Intronic
1126671354 15:51118244-51118266 AAGCCTGGACACATGGATCTGGG + Intergenic
1129263987 15:74384191-74384213 AAGGCAGGACTCCTGGGTCCCGG + Intergenic
1129992393 15:79976407-79976429 GAGGCTGCAAACCTGGCTCCAGG - Intergenic
1130353729 15:83112008-83112030 CAGTCAGGAAACCGGGATCCTGG - Intronic
1130993628 15:88891857-88891879 CAGGCTCCACACCTGGAACCAGG + Intronic
1132692142 16:1186326-1186348 CAGGCTGGACCCCTGCCTTCAGG - Intronic
1132713707 16:1280247-1280269 CCGGCTGGACACCTGGCTCCAGG - Intergenic
1133277534 16:4647881-4647903 CATGCTGGGCACCTGGCTCTGGG + Intronic
1133459061 16:5971097-5971119 ACAGCTGGACACCTGGATACGGG - Intergenic
1133482817 16:6187622-6187644 CAGGCTGGAGATCAGGATACAGG + Intronic
1133998068 16:10762660-10762682 CAGCCGGCACTCCTGGATCCCGG - Intronic
1135733873 16:24915683-24915705 CAGGCAGGACCCCTGTCTCCCGG - Intergenic
1136534055 16:30888823-30888845 AAGGCTGGACTCCTGGGTCTTGG - Intronic
1137478443 16:48830891-48830913 CAGCATGGACACCTGGGTTCAGG + Intergenic
1140427679 16:74874686-74874708 GAGGCAGGACACTTGAATCCGGG - Intronic
1140477388 16:75245657-75245679 CAGGCTGGGCACGTGGCACCAGG + Intronic
1140679636 16:77372545-77372567 CATGCTGGGCACCTGAGTCCTGG + Intronic
1142640344 17:1281677-1281699 CTGGCTGCACCCCTGGGTCCTGG - Intronic
1143393337 17:6573309-6573331 CAGGCTGGATGCCAGGGTCCAGG + Intergenic
1144217385 17:13068375-13068397 CAGCCTGGACTGCTGGTTCCGGG - Intergenic
1145261978 17:21359987-21360009 CAGGGTGGTCAGCTGGGTCCTGG - Intergenic
1145362199 17:22221578-22221600 CGGGCTGGCCACCTGGAGCCGGG + Intergenic
1145781673 17:27567804-27567826 GTGTCTGGACACCTGGATCCTGG + Intronic
1146051141 17:29554436-29554458 CAGGCTGGACACCAAACTCCTGG - Intergenic
1146054729 17:29575384-29575406 CTGGATGGAGACCTAGATCCTGG - Exonic
1146128877 17:30252741-30252763 TAAGCTGGCCTCCTGGATCCAGG + Intronic
1146182453 17:30706909-30706931 CAGGCTGGACACCTGGATCTGGG - Intergenic
1146576360 17:33995336-33995358 AAGGCTTGAGACCTGGAACCTGG + Intronic
1147548117 17:41418949-41418971 CAGTCAGGACACCTGGACCCTGG - Intergenic
1148746380 17:49920520-49920542 CAGCCAGGACTCCTGGATTCAGG + Intergenic
1151333359 17:73424217-73424239 CAGGCAGGACACTGGGATCGGGG + Intronic
1151362314 17:73596140-73596162 TAGCCTGGAGACCTGGGTCCTGG + Intronic
1152010092 17:77707669-77707691 CAGGCTGGACATCTGTATCCAGG + Intergenic
1152066451 17:78115198-78115220 CTGCCTGGAGCCCTGGATCCTGG + Intronic
1152230004 17:79109711-79109733 CAGGCTGGATTCCTGAATCTGGG - Intronic
1152237692 17:79147073-79147095 CAGGCTGGGAACCTGGCACCGGG - Intronic
1152376253 17:79920287-79920309 CAGGCTGCTCCCCAGGATCCTGG + Intergenic
1153942665 18:9991176-9991198 CAGGCTAGACACGTGAATGCTGG - Intergenic
1155100715 18:22607546-22607568 CAGCCTTGACACAAGGATCCAGG + Intergenic
1155155267 18:23152180-23152202 CAGGCTGGACTCCTGGGCTCAGG - Intronic
1160077367 18:75691263-75691285 CAGCCTGGTCACCTGAACCCAGG - Intergenic
1160270527 18:77379450-77379472 CAGGACGCACACCTGGAACCTGG - Intergenic
1160505307 18:79423449-79423471 AAGGCTGGGCAAGTGGATCCCGG - Intronic
1160805637 19:991223-991245 CAGGCAAGTCACCTGGTTCCTGG - Exonic
1161022465 19:2016449-2016471 CAGGCCCGCCACCTGGGTCCGGG - Intronic
1161360680 19:3847859-3847881 CAGGCTCCACTCCTGGAGCCGGG + Intronic
1162346656 19:10122415-10122437 CAGGCTGGGCACCTGTAATCGGG + Intergenic
1162700879 19:12513750-12513772 AAGCCAGGACACCTGGAACCCGG - Intronic
1162801445 19:13112908-13112930 CAGCCTGCACAGCTGCATCCAGG + Exonic
1162976370 19:14208896-14208918 CAGGTTGGACACCGGGATCTGGG + Intergenic
1163000480 19:14363693-14363715 CAGGCAGGGCAGCTGGAGCCGGG - Intergenic
1163359063 19:16834109-16834131 CAAGCAGTACATCTGGATCCTGG - Intronic
1163582694 19:18147741-18147763 CCTGCTAGACACCAGGATCCCGG - Intronic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1165110330 19:33498607-33498629 CAGGATGGGCACCTGCCTCCAGG - Intronic
1165374190 19:35430023-35430045 CAGGCTGAACACCTGGAGAGGGG + Intergenic
1165804230 19:38570827-38570849 CAGGCTGGACACCTGGATCCTGG + Intronic
1166054815 19:40282107-40282129 CAGGCTGGGGAGCTGGATCCCGG + Intronic
1166695799 19:44851000-44851022 GAAGCTGGACACCTGGGTCTAGG - Intronic
1166966765 19:46533729-46533751 CCTGCTGGTCACCGGGATCCTGG + Intronic
1167253511 19:48414210-48414232 GAGCCTGGACTCCTGGGTCCTGG + Intronic
1167337705 19:48896775-48896797 AAGGCAGGACTCCTGGGTCCTGG - Intronic
1167553626 19:50178516-50178538 CAGGCTGGAAACCTACAACCTGG - Intergenic
1167597838 19:50436606-50436628 CACGGTGTACACCTGGGTCCAGG - Exonic
1167611600 19:50510484-50510506 GAGGCTGGACCTCTAGATCCCGG - Intronic
925422779 2:3725721-3725743 GAGGCTGGCCAGGTGGATCCCGG + Intronic
926772360 2:16389723-16389745 CAGGCTGGACACATGGCTCAGGG - Intergenic
928100511 2:28434700-28434722 CTGGCCGGCCACCTGCATCCAGG - Intergenic
928240058 2:29578428-29578450 CTGTCTGGACACCTGACTCCAGG + Intronic
929047420 2:37803548-37803570 CAGGGTGGCCACATGCATCCTGG + Intergenic
931463820 2:62469991-62470013 CATGCTGGACATGTGGATCAAGG - Intergenic
931691601 2:64838750-64838772 CTGGGTGGCCACCTGGATCCTGG + Intergenic
933377554 2:81499479-81499501 CAGGCTGGAGTGCTGGATCTTGG + Intergenic
934251510 2:90359749-90359771 CAGACTGGACACCTCCATCTGGG - Intergenic
934258049 2:91443649-91443671 CAGACTGGACACCTCCATCTGGG + Intergenic
934927864 2:98394269-98394291 TGGGCTGGACACCTAGAGCCAGG - Intronic
936526341 2:113244275-113244297 CAGGGAGCACACCTGGCTCCAGG - Intronic
937280258 2:120712804-120712826 CTTGATGGACACCTGGCTCCAGG - Intergenic
942687171 2:178545491-178545513 CAGGCTGGTCACCTTCAGCCTGG + Exonic
944771817 2:202922342-202922364 CAGGCAGGTCACTTGAATCCAGG - Intronic
947068784 2:226262390-226262412 TAGGCTGGAAATCTGGATTCTGG + Intergenic
948395484 2:237642319-237642341 TAGGCTGCACGCCTGGTTCCAGG + Intronic
948829294 2:240590192-240590214 CAGGCTGGGCACCAGGCACCTGG - Intronic
948890885 2:240906570-240906592 GGGGCTGGACACCGTGATCCAGG + Intergenic
948908449 2:240991185-240991207 CAGGCTGGCCACCTGGGGACAGG - Intronic
949036676 2:241818675-241818697 CAGGATGGGGGCCTGGATCCGGG + Intergenic
1169198730 20:3697384-3697406 GCGGCTGGACCCCTGGCTCCTGG - Intronic
1171230685 20:23481696-23481718 CAAGATGGACTCCTGGATTCTGG - Intergenic
1171291443 20:23985066-23985088 CAGGGAGGCCACCTGGAGCCTGG + Exonic
1171320415 20:24238923-24238945 CAGACTGGAGACCTGGAGTCGGG - Intergenic
1173523217 20:43714034-43714056 CAGGCTGGGGACCTGCAGCCAGG + Intronic
1173865571 20:46310371-46310393 CAGGCTGGATTCCTGGACTCAGG + Intergenic
1174264908 20:49324280-49324302 CTGGCTGGACAGCTGGACCAAGG - Intergenic
1175499349 20:59438891-59438913 CTGGCTGGACAGCTGGGGCCAGG - Intergenic
1175845200 20:62054617-62054639 GAGGGTGGACACCTGGGTGCAGG - Intronic
1176073687 20:63239083-63239105 CAGGCTGCAGACCTGTATCTGGG + Intronic
1176301047 21:5099272-5099294 GACGGTGGCCACCTGGATCCCGG + Intergenic
1176654021 21:9573921-9573943 CAGGCTGCACACCTGGGCACAGG - Intergenic
1176708839 21:10133565-10133587 CCAGGTGGATACCTGGATCCTGG + Intergenic
1177883342 21:26719761-26719783 GAGGCTGGACAGCTGGGACCAGG - Intergenic
1179245732 21:39632691-39632713 CAGGCTGGAAGCCTGGATGTTGG + Intronic
1179855982 21:44162626-44162648 GACGGTGGCCACCTGGATCCCGG - Intergenic
1180559243 22:16602033-16602055 CAGGAAAGACACATGGATCCCGG - Intergenic
1180765956 22:18346027-18346049 CAGGGAGGCCACCTGGAGCCTGG - Intergenic
1180780357 22:18516351-18516373 CAGGGAGGCCACCTGGAGCCTGG + Exonic
1180813073 22:18773672-18773694 CAGGGAGGCCACCTGGAGCCTGG + Intergenic
1181107828 22:20585185-20585207 CAGGCTGGACCCCAAGTTCCTGG + Exonic
1181199250 22:21207988-21208010 CAGGGAGGCCACCTGGAGCCTGG + Exonic
1181400515 22:22647869-22647891 CAGGGAGGCCACCTGGAGCCTGG - Intronic
1181702495 22:24628967-24628989 CAGGGAGGCCACCTGGAGCCTGG - Exonic
1181765649 22:25090040-25090062 CAGGCTGGAGCCCAGGAGCCAGG - Intronic
1181803609 22:25362234-25362256 AATGCTGGACGCCGGGATCCTGG - Exonic
1181930384 22:26396130-26396152 AAGGCTGGGCTCCTGCATCCAGG - Intergenic
1183337808 22:37260631-37260653 GAGGATGGACACCCGGGTCCAGG - Intergenic
1183928629 22:41223622-41223644 CAGGCTGCACACCAGCTTCCAGG + Intronic
1184690235 22:46114157-46114179 CGGGCTGAACACCGGGACCCAGG + Intergenic
1184987853 22:48147620-48147642 CAGGCTGAACCCCGGGGTCCAGG - Intergenic
1185049891 22:48548537-48548559 CAGACTGGACCCCAGGCTCCAGG + Intronic
1185330320 22:50249316-50249338 GAGGGTGGGCACCTGGTTCCAGG + Exonic
1203227575 22_KI270731v1_random:86918-86940 CAGGGAGGCCACCTGGAGCCTGG - Intergenic
949918882 3:8985961-8985983 CAGTCTGGAGACCTGGAGTCAGG + Intronic
950110006 3:10412792-10412814 CAGGCTGCACACCTCGGGCCAGG - Intronic
950436990 3:12986136-12986158 CAGGCTGGACCCCTGCGCCCAGG + Intronic
952869466 3:37885573-37885595 AAGGCTGGGAACCTGGACCCTGG + Intronic
953664697 3:44917478-44917500 AAGGCTGGGCCCCTGGCTCCTGG - Intronic
953840473 3:46386141-46386163 CAGGCTGATCACCTGAGTCCAGG - Intergenic
954222599 3:49163695-49163717 CAGGGTAGACACCTGGATAAAGG + Exonic
954314687 3:49794799-49794821 CAGTCTGGAAAACAGGATCCAGG - Intronic
954318379 3:49813584-49813606 CAGGCCTGACACCAGGACCCTGG + Exonic
954619210 3:51986163-51986185 CAGGCTGGAGTCCTGTGTCCTGG - Intronic
955227598 3:57073856-57073878 CTGGCAGGACACCTGGACCCTGG - Exonic
955507807 3:59649183-59649205 CAGTTTGGACACCAGGATCTTGG - Intergenic
956125568 3:66008122-66008144 CAGGCTGATCACCTGGAGTCAGG - Intronic
958730102 3:97952277-97952299 CAGCCTGGACACATTGATCATGG + Intronic
960211448 3:114971898-114971920 CAGACTGGATGCCTGGAACCAGG + Intronic
961269677 3:125679842-125679864 CTGGGTGTCCACCTGGATCCTGG - Intergenic
961326495 3:126112314-126112336 CAGCCTGGCCACTTGGCTCCAGG + Intronic
961507196 3:127377975-127377997 CCGGCTGGACACCAGGAGCCTGG - Intergenic
961658648 3:128456936-128456958 CAGGCAGGCCACCTGGGGCCGGG + Intergenic
961788027 3:129359146-129359168 GAGGCTGGGCACCTGGATTTGGG + Intergenic
961961720 3:130862406-130862428 CAGGCAGGTCACCTGAAGCCAGG - Intronic
963273430 3:143307735-143307757 CAGGCTGGAGACCTTGATCCAGG - Intronic
966805883 3:183807168-183807190 GAGGCTGAACACCTGGGTCTGGG - Intronic
968446626 4:655426-655448 CAAGCCTGGCACCTGGATCCTGG - Intronic
968701475 4:2059971-2059993 CAGGCTGGTCCCCGGGAGCCGGG - Intronic
968881038 4:3300346-3300368 CAGGCTGGACTCCAGGCCCCTGG - Intronic
969620205 4:8275142-8275164 CCGGCTGGACTCCTGGCTCCTGG - Intronic
970101215 4:12524552-12524574 CAGACTGCACTCCTGCATCCTGG - Intergenic
972168042 4:36311233-36311255 CAGGCAGGATACCCAGATCCTGG + Intronic
974103863 4:57445655-57445677 CAGGCAGGAGGCTTGGATCCTGG + Intergenic
978916542 4:114132318-114132340 CAGACTGTTCACATGGATCCAGG - Intergenic
979962311 4:127035976-127035998 CAGGAAGGACACCCAGATCCTGG + Intergenic
983796157 4:171866662-171866684 GAGGCTGGAAATCTGGATCAGGG + Intronic
984892263 4:184504528-184504550 GATGCTGGACACCTGGAGCCAGG + Intergenic
985768598 5:1795176-1795198 CAGGAAGGAGACCTGGACCCTGG + Intergenic
986239172 5:5941798-5941820 CAGGCTGGCCACCTGGCTTCTGG + Intergenic
986317589 5:6600918-6600940 CTGGCTGGACAGGTGGAGCCTGG - Intronic
987001355 5:13663435-13663457 CAGGATGGCCACCAGGATCCTGG - Intergenic
992555537 5:77899278-77899300 GAGGCTGGACAGCTGGCTCGGGG - Intergenic
992561136 5:77954139-77954161 CAGGCTGATCACCTGGGTTCAGG - Intergenic
993844804 5:92927783-92927805 CTGGCTGGACATCAGGAGCCAGG + Intergenic
994524172 5:100882673-100882695 TAGGCTGCACACAGGGATCCTGG - Intronic
995285111 5:110379131-110379153 CAGCCTGTACACCTGGAATCTGG - Intronic
998134825 5:139669040-139669062 CAGGCTGGCCACTGGCATCCAGG - Intronic
999306307 5:150521689-150521711 CAACCTGGACGCCTGGAACCGGG + Exonic
1001901138 5:175430907-175430929 CAGGCGGGTCACCTGAAGCCAGG - Intergenic
1002082898 5:176748103-176748125 CAGGCTGGACACCTCCACCCTGG - Intergenic
1003138999 6:3456241-3456263 CGTGCTGCTCACCTGGATCCCGG - Exonic
1004899780 6:20183383-20183405 CAAGCTGGTCAGCTGGACCCAGG - Intronic
1010378464 6:75202011-75202033 CAGGCTGGAAACCTTGGCCCAGG + Intronic
1012524009 6:100155804-100155826 CAGGGTGGACCACTGGAACCAGG + Intergenic
1016283916 6:142451364-142451386 CTGGCTGCACCCCTGGATGCTGG - Intergenic
1018380649 6:163255345-163255367 CAGGCAGGTGACCTGAATCCAGG + Intronic
1018766646 6:166938818-166938840 CAAGCCTGACAGCTGGATCCAGG - Intronic
1018928032 6:168220451-168220473 CAGGCTGTGCACCTGCCTCCAGG - Intergenic
1019473554 7:1233424-1233446 CCCGCTGGCCGCCTGGATCCGGG - Intronic
1019645449 7:2126428-2126450 CAGCCTGGACCCCAGGAGCCTGG + Intronic
1020371472 7:7436810-7436832 CAGGCGGGTCACTTGAATCCAGG + Intronic
1020911110 7:14132669-14132691 GAGGCTGTAAAACTGGATCCTGG + Intergenic
1021964627 7:25905517-25905539 CAGGGTGGACAGCTGGTGCCCGG + Intergenic
1022386504 7:29904283-29904305 CAGGCCGTACACCTGGTCCCTGG + Exonic
1023033462 7:36110307-36110329 CAGGCTGTACACCTCTACCCTGG + Intergenic
1023561702 7:41480635-41480657 GTGGGTGGACACCTGGATGCTGG + Intergenic
1024114514 7:46179589-46179611 CAGACAGGGCACCTGCATCCAGG - Intergenic
1025280367 7:57622585-57622607 CAGGCTGCACACCTGGGCACAGG - Intergenic
1025304366 7:57842916-57842938 CAGGCTGCACACCTGGGCACAGG + Intergenic
1026287050 7:68972427-68972449 CAGGCAGGAGAGCTGGATGCTGG + Intergenic
1026424489 7:70276604-70276626 CAGGCAGGTCACCTGAATTCAGG - Intronic
1026877949 7:73890494-73890516 CAGGCTGGGGTCCTTGATCCTGG + Intergenic
1027264888 7:76488992-76489014 GAGTCTGGACACCTGGGTCAAGG - Intronic
1027316261 7:76987095-76987117 GAGTCTGGACACCTGGGTCAAGG - Intergenic
1029246077 7:99202615-99202637 CAGGCAGGTCACCTGAGTCCAGG + Intronic
1029485335 7:100836586-100836608 GAGGCTAGACCCCTGGATCCTGG - Intronic
1032765652 7:134990265-134990287 CAGGCTTCACCCCTGGCTCCAGG + Intronic
1033344989 7:140519601-140519623 CAGGCTGGGCACCCAGAGCCCGG + Intronic
1033414737 7:141151916-141151938 CAGGCTGCACCCGTGAATCCTGG - Intronic
1034345779 7:150384359-150384381 CAGCCTGCTCACCTGGCTCCTGG + Intronic
1034364711 7:150536298-150536320 CAGGCTGGCCCCATGGCTCCAGG + Intergenic
1034618003 7:152435796-152435818 CAGGAAAGACACATGGATCCCGG + Exonic
1035226688 7:157437844-157437866 CAGGCTGGACAACTGGGTGGGGG - Intergenic
1035470077 7:159104205-159104227 CAGGCTGGGCTCCTGGCTCCAGG - Intronic
1037494051 8:19421914-19421936 GAGTCTGGAAACCTGGATCCAGG + Intronic
1038529735 8:28308538-28308560 GAGCCTGGACTCCTGGAGCCAGG + Intergenic
1039428364 8:37505595-37505617 CAGGCAGGACAGCTGGAATCTGG - Intergenic
1039545966 8:38411876-38411898 CAGTCTGGTCACATGGATACAGG + Exonic
1039893113 8:41697638-41697660 AGGGCTGGACACCTGCCTCCTGG - Intronic
1041992120 8:64005925-64005947 CATGCTGGACCCCAGGAGCCTGG + Intergenic
1043865922 8:85375728-85375750 CAGGCAGAACAACTGTATCCTGG + Intronic
1045341289 8:101256945-101256967 CAGGATGGGCACCTGGAGCCGGG + Intergenic
1048313760 8:133347001-133347023 CAGGCTGGAGACATGCCTCCAGG - Intergenic
1049081332 8:140445549-140445571 CAGGCTGTCCCCATGGATCCTGG + Intronic
1049241666 8:141540481-141540503 CAGGAGGGACACCTTGATCTGGG - Intergenic
1049579591 8:143405246-143405268 CAGGCTGGACACCTGGCATCAGG - Intergenic
1049579595 8:143405265-143405287 CAGGTTGGACACCTGGCATCAGG - Intergenic
1049579600 8:143405284-143405306 CAGGCCGGACACCTGGCATCAGG - Intergenic
1049579604 8:143405303-143405325 CAGGTTGGACACCTGGCATCAGG - Intergenic
1049579612 8:143405341-143405363 CAGGCTGCACACCTGGCATCAGG - Intergenic
1049579615 8:143405360-143405382 CAGGTTGGACACCTGGCATCAGG - Intergenic
1049579620 8:143405379-143405401 CAGGCCGGACACCTGGCATCAGG - Intergenic
1049579629 8:143405417-143405439 CAGGCCGGACACCTGGCATCAGG - Intergenic
1049755810 8:144310891-144310913 CAGGATGGATGCCAGGATCCGGG + Intronic
1050392642 9:5161868-5161890 CAGGCTGGTCTCCGGGCTCCTGG - Intronic
1051331843 9:16031878-16031900 CTGCCTGTACAGCTGGATCCTGG - Intronic
1053404177 9:37856740-37856762 CAGGCTGGACTCCTAATTCCTGG - Intronic
1053645815 9:40119062-40119084 CCAGGTGGATACCTGGATCCTGG + Intergenic
1053759897 9:41344447-41344469 CCAGGTGGATACCTGGATCCTGG - Intergenic
1054326827 9:63716963-63716985 CCAGGTGGATACCTGGATCCTGG + Intergenic
1054538756 9:66256910-66256932 CCAGGTGGATACCTGGATCCTGG - Intergenic
1056415508 9:86371854-86371876 CAGGCAGAACACTTGAATCCAGG - Intergenic
1059805452 9:117794986-117795008 TAGGCTGGACTCGAGGATCCAGG + Intergenic
1060439890 9:123628486-123628508 GAGGCTGGAGACCTGGGTACAGG + Intronic
1061121573 9:128646434-128646456 CAGGCTGATCACCTGGGTTCAGG - Intronic
1061630827 9:131871130-131871152 CAGGACGCACACCTGGATCCAGG - Intronic
1061631002 9:131872134-131872156 CAGGCTGGGGACCAGGACCCAGG + Intronic
1061816967 9:133203315-133203337 CAGCCTGGACACTTGGCCCCTGG + Intergenic
1062393301 9:136342577-136342599 CAGGCTGCACACCTAGAGCCTGG + Intronic
1202793600 9_KI270719v1_random:102535-102557 CCAGGTGGATACCTGGATCCTGG + Intergenic
1203631741 Un_KI270750v1:77373-77395 CAGGCTGCACACCTGGGCACAGG - Intergenic
1185608686 X:1381402-1381424 GAGGCTGGACACCTGTCTGCTGG + Intronic
1185985006 X:4823139-4823161 AAGGCTGGACAACTCGAACCGGG + Intergenic
1186942170 X:14521558-14521580 CAAGCTGGACACCCTGATGCTGG - Intergenic
1189040936 X:37542102-37542124 GAGACTGGACACCTGCATCTTGG + Intronic
1189041121 X:37542954-37542976 GAGGCTGGACACCTGCATCTTGG + Intronic
1189496638 X:41514712-41514734 CAGGATGGGCACCAGGAGCCTGG + Intergenic
1190803448 X:53813623-53813645 CAGGCTGGACAGCTAAGTCCTGG + Intergenic
1192260682 X:69504571-69504593 CGGGCGGGCCACCTGGCTCCCGG - Intergenic
1192469011 X:71380477-71380499 CAGGCTGGACTCCTGGGCTCAGG + Intronic
1193103712 X:77644167-77644189 CAGGCGGATCACCTGGATTCAGG - Intronic
1195037960 X:100987348-100987370 AAGGCTGCAGACCTGGAGCCTGG - Intronic
1195667936 X:107447729-107447751 CATACTGGACAGCTGGTTCCTGG + Intergenic
1198804957 X:140485044-140485066 CAAGCTGAAGTCCTGGATCCTGG + Intergenic
1200169339 X:154060982-154061004 GAAGCTGGACACCTGGACCAGGG + Intronic