ID: 1165807020

View in Genome Browser
Species Human (GRCh38)
Location 19:38586611-38586633
Sequence ACGTGGAGCCCTTTAACATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165807020 Original CRISPR ACGTGGAGCCCTTTAACATA AGG Intronic
904594774 1:31636645-31636667 ATGTGAAGCCCTTTGACATTGGG + Intronic
918575501 1:186054270-186054292 AGGGGGAGCATTTTAACATAGGG + Intronic
1064771383 10:18727185-18727207 GGGTGGAGCCCATTAACATATGG + Intergenic
1074394566 10:113087024-113087046 AAGTGTAGCCCAGTAACATAAGG + Intronic
1079372416 11:19862966-19862988 ACGTGGAGACCTCTTAGATATGG + Intronic
1080392780 11:31863786-31863808 AAGTGGAGCCCTTCAATATGCGG + Intronic
1089582802 11:119492037-119492059 ACAAGGAGCCCTTTAACAACAGG - Intergenic
1091597180 12:1885990-1886012 ACGAGGATCCCTTTAAAACAAGG + Exonic
1094629340 12:32157782-32157804 ACGTGGAAACATTTAAAATATGG - Intronic
1096462105 12:51827533-51827555 ACGTTATGCCCTTTAACAAATGG - Intergenic
1097992169 12:65847335-65847357 CTGTTGAGCCATTTAACATATGG + Intronic
1099837482 12:87925264-87925286 ACTTGGAGCTCTGGAACATAAGG - Intergenic
1108944078 13:55999685-55999707 AAGTGTAGCCCTTTCACATCTGG + Intergenic
1112400314 13:99071785-99071807 GCATGGATCCCTTTAAGATACGG - Intronic
1113601782 13:111574554-111574576 TCGTGGTGCCCTTTAACACGGGG - Intergenic
1120833151 14:89015944-89015966 ATGTGGAAGCCTTTAAGATAAGG + Intergenic
1125712639 15:41799295-41799317 AGGTGGAGCCCTCTGACAGAGGG + Intronic
1127607805 15:60607163-60607185 GCATGGAGCCATTTAGCATAGGG + Intronic
1127963231 15:63905696-63905718 ACGTGGACCCCTTTAGGACAGGG + Intergenic
1139132788 16:64166411-64166433 ACATGGAGGCCTTTAATCTATGG + Intergenic
1140079290 16:71729533-71729555 ACCTGGAACACTTTAACAGAAGG - Intronic
1142928390 17:3260840-3260862 GCGTGGAGCCCTTTTCCATATGG + Intergenic
1152143412 17:78552195-78552217 AGGTGGAACCCTTTAACGTGAGG - Intronic
1159027388 18:63196671-63196693 CCGTGCGGCCCTTTATCATACGG + Intronic
1165807020 19:38586611-38586633 ACGTGGAGCCCTTTAACATAAGG + Intronic
1168545806 19:57248818-57248840 CCTTGGAGCCCTTTAACCTGTGG + Intronic
926530635 2:14040557-14040579 ACGGGGAGATATTTAACATAGGG + Intergenic
931809464 2:65840732-65840754 ACATTGAGCTATTTAACATATGG + Intergenic
946151389 2:217774328-217774350 ACATGGAGCCCTTTAAGTTCAGG - Intergenic
1182254908 22:29031109-29031131 ACTTGGAGCCCCTTAATCTACGG - Intronic
971527988 4:27645928-27645950 TCATGGAGCCCTTTAACAAGAGG + Intergenic
974843730 4:67325983-67326005 ACGTGGTGCCTTTGAACACACGG - Intergenic
980986528 4:139700663-139700685 ACTTGGAGACCTTTAAGAAAAGG - Intronic
986213458 5:5695585-5695607 GGGTGGAGCCCTTTAAGAGAAGG - Intergenic
990628674 5:57642643-57642665 ATGGCCAGCCCTTTAACATAGGG + Intergenic
1001588840 5:172851787-172851809 AAGTGGAGCCCTTTTACCCAGGG - Intronic
1013799579 6:113926415-113926437 ACGTGGTGTTCTTTAACCTATGG - Intergenic
1014677988 6:124391478-124391500 ATGAGGAGCCCTTTAACAATTGG + Intronic
1018189369 6:161295360-161295382 GGGTGGAGCCCTTCAACAGACGG - Intergenic
1020735162 7:11939228-11939250 ACTTGGAGCCATCTAAAATAGGG - Intergenic
1031442801 7:121814038-121814060 AAGGGGATCTCTTTAACATAGGG - Intergenic
1034105490 7:148486392-148486414 ACCTGGAGCCCTTCAATAAATGG + Intergenic
1046519213 8:115302871-115302893 ACATGAAGCCCTTTACCATTCGG - Intergenic
1051086497 9:13355611-13355633 ATGTTTATCCCTTTAACATATGG + Intergenic
1197191333 X:123650720-123650742 ACGTTGATCCCTTTACCATTAGG - Intronic
1200907006 Y:8494030-8494052 ACATGGAGCATTTTATCATAAGG + Intergenic
1202259794 Y:22958572-22958594 ACATGGAGCATTGTAACATAAGG + Intergenic
1202412780 Y:24592316-24592338 ACATGGAGCATTGTAACATAAGG + Intergenic
1202458001 Y:25077754-25077776 ACATGGAGCATTGTAACATAAGG - Intergenic