ID: 1165807173

View in Genome Browser
Species Human (GRCh38)
Location 19:38587554-38587576
Sequence GCCCCCCAGCATCACTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165807172_1165807173 6 Left 1165807172 19:38587525-38587547 CCTAGTACTGGAAAATAAATCTG 0: 1
1: 0
2: 1
3: 35
4: 254
Right 1165807173 19:38587554-38587576 GCCCCCCAGCATCACTGTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165807173 Original CRISPR GCCCCCCAGCATCACTGTGT TGG Intronic
900817005 1:4855705-4855727 GCCCCCCAGCAAGCCTGTGTTGG + Intergenic
901468696 1:9440702-9440724 GTCCCCCAACATCCATGTGTTGG - Intergenic
903461006 1:23521086-23521108 GCCCCCCAGTGTCAGTCTGTGGG + Intronic
907029654 1:51158007-51158029 GCCCCCCAGCATCTCTGCCAGGG + Intergenic
907083325 1:51644926-51644948 GTCCCCCAGCATTCATGTGTTGG + Intronic
910212106 1:84804122-84804144 GCCCCCCAGCCTCACTGAGGGGG + Intergenic
911284370 1:95972550-95972572 GTCCCCCACCATTATTGTGTAGG + Intergenic
911318078 1:96378684-96378706 GTCCCCCACTATTACTGTGTTGG - Intergenic
914858852 1:151370664-151370686 GCACCCCAGCATCAGAGTTTGGG + Intronic
915253235 1:154605536-154605558 GCCCCTCATCAGTACTGTGTTGG - Intronic
917297299 1:173533829-173533851 TCCCCCCAACATTACTGTATAGG - Intronic
917511781 1:175674809-175674831 GCCCCCCAGCATCAATCTGCTGG + Intronic
919227083 1:194718776-194718798 GCCCCCCAGCAAGGCTATGTGGG + Intergenic
922679197 1:227577342-227577364 GCCCCCTACTATTACTGTGTGGG + Intronic
923041554 1:230323414-230323436 CGCCCCCAGCATCAGTGGGTCGG + Exonic
924736244 1:246759412-246759434 GCACCCCAGAATCCCTGTTTAGG + Intronic
924798720 1:247311637-247311659 GCTCCCCAGGCCCACTGTGTTGG + Intronic
1062851536 10:746485-746507 GCCTCCCACTATTACTGTGTGGG - Intergenic
1063607213 10:7533279-7533301 GACTCCCAGCATCACTGCGGGGG + Intergenic
1066367461 10:34791364-34791386 GCTCCCCAGCATCCCACTGTGGG + Intronic
1066644810 10:37595659-37595681 GCTCCCCAACATTTCTGTGTTGG + Intergenic
1067177591 10:43960909-43960931 GGCCCTCAGCATCACTGACTTGG + Intergenic
1069098470 10:64288769-64288791 GTCCCCCAGCAACAATGTTTTGG + Intergenic
1069609121 10:69760761-69760783 GCCCCTCTGCAGCAGTGTGTTGG + Intergenic
1076837227 10:133027224-133027246 GCCCCCCAGGCTCACAGGGTCGG - Intergenic
1078060722 11:8041026-8041048 GGGAACCAGCATCACTGTGTGGG + Intronic
1083714614 11:64568288-64568310 GCCCGCCAGCCTGCCTGTGTGGG - Intronic
1084691910 11:70732517-70732539 GTCCCCCAGCCTCACTGAGCTGG + Intronic
1084747552 11:71182905-71182927 GCCTCTCTGCATCACAGTGTGGG + Intronic
1089083345 11:115796129-115796151 CTCCACCAGCATCACTGTGGTGG - Intergenic
1091283223 11:134394070-134394092 GCCCCCCAGCAGGGCTGTGGTGG - Intronic
1091339692 11:134800752-134800774 CACTCCCAGCATCACTGTGTGGG + Intergenic
1091537958 12:1430876-1430898 GCCCCTCAGCATCACTCTCCAGG - Intronic
1092855551 12:12670085-12670107 AGCCACCAGCATGACTGTGTGGG + Intronic
1095331534 12:40971278-40971300 GCCCCCCGTCCTCAGTGTGTAGG + Intronic
1095666404 12:44805510-44805532 GGCCACCAGCTTCATTGTGTTGG + Intronic
1095670731 12:44857203-44857225 GGCCCCCAGCAACTCTGTGCTGG - Intronic
1100566028 12:95794797-95794819 TCCTCACAGCATCAATGTGTGGG + Intergenic
1100827791 12:98491075-98491097 GTCTCCAGGCATCACTGTGTCGG + Intronic
1101202083 12:102447332-102447354 GTCTCCCAGCATTATTGTGTGGG + Intronic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1103928186 12:124435280-124435302 GGCACCCAGCAGCCCTGTGTGGG + Intronic
1104040158 12:125124696-125124718 GCACCCTAGCATCACTGTCCTGG + Exonic
1106377621 13:29204428-29204450 GCTCCTGAGCATCACTGGGTGGG - Intronic
1107396686 13:40025293-40025315 GCCTCCCAGCATCACTCCCTGGG - Intergenic
1111607906 13:90564235-90564257 GCCCCACAGCAGCACTGAGGTGG - Intergenic
1113788485 13:113015292-113015314 GGCTCCCAGCACCCCTGTGTGGG + Intronic
1113857592 13:113456535-113456557 GCCCCCCTGCAGCACTGTGCAGG - Intronic
1115843900 14:37504140-37504162 GTCTCCCATTATCACTGTGTGGG - Intronic
1117326197 14:54671243-54671265 GCCCAGCAGCATCACTGTTAGGG + Intronic
1119456897 14:74763752-74763774 GCCCCCCGGCATCACTGGCGGGG - Exonic
1119860158 14:77930428-77930450 GCCTCCCAGCAGCACTGGGAAGG - Intronic
1120283048 14:82463612-82463634 GCCAAGCAGCATCACTCTGTGGG + Intergenic
1120300787 14:82703964-82703986 GTCTCCCACTATCACTGTGTGGG + Intergenic
1122767242 14:104081119-104081141 GCCCCCCAGCCTCAGGGTGGAGG + Intergenic
1123449619 15:20351650-20351672 GCCCCCCAGCCCCACTGCCTTGG - Intergenic
1123717047 15:23040635-23040657 GCCCCCCAGCATCTCTGGCCAGG - Intergenic
1123718019 15:23043908-23043930 GCCCCCCAGCATCTCTGGCCAGG - Intergenic
1123718900 15:23046973-23046995 GCCCCCCAGCATCTCTGGCCAGG - Intergenic
1123719113 15:23047716-23047738 GCCCCCCAGCATCTCTGGCCAGG - Intergenic
1123719261 15:23048232-23048254 GCCCCACAGCACCACTGGCTAGG - Intergenic
1123719493 15:23049021-23049043 GCCCCCCAGCATCTCTGGCCAGG - Intergenic
1123937180 15:25199671-25199693 GCAGCCCAGCCTCCCTGTGTGGG + Intergenic
1124444482 15:29717857-29717879 TCCCCCTAGAATCACTGTTTAGG + Intronic
1125753902 15:42049446-42049468 GTCCCCCAGCATTCATGTGTTGG - Intronic
1125984987 15:44041234-44041256 GTCTCCCAGTATCATTGTGTGGG - Intronic
1128143158 15:65316390-65316412 GCCCCCCTGCCTCCCTGAGTGGG - Intergenic
1132735775 16:1385217-1385239 CCCCGCCAGCAGCACTGTGGAGG - Intronic
1134107442 16:11494333-11494355 GCCCCCCAACACCACTGAGTGGG - Intronic
1136932926 16:34435342-34435364 GCCCCTCAGCACCAGTGTGAAGG + Intergenic
1136971646 16:34976472-34976494 GCCCCTCAGCACCAGTGTGAAGG - Intergenic
1137007363 16:35289708-35289730 GCCTCCCATTATCATTGTGTAGG - Intergenic
1139264784 16:65628698-65628720 GTGCCCCAGCATCAGCGTGTTGG - Intergenic
1139513453 16:67440162-67440184 GCCCCTCAGCATCACAGAGCAGG + Intronic
1141798581 16:86291650-86291672 GTCCCCCAGAATTGCTGTGTGGG - Intergenic
1141950891 16:87338683-87338705 GCATCCCTGCATCTCTGTGTGGG - Intronic
1142175392 16:88642829-88642851 GCCCCCCAGCATCAGTGTGGGGG + Intergenic
1144413826 17:15026882-15026904 GCCCCATAGCATTACTGTTTAGG - Intergenic
1144636253 17:16911124-16911146 GCCTCCCAGCATCACTGAGAAGG - Intergenic
1146693865 17:34894409-34894431 GACCCCCATCATCAATCTGTGGG - Intergenic
1148719256 17:49739087-49739109 GCCACCCAGCCTCACTGGGCTGG + Intronic
1152339013 17:79714241-79714263 GCCCCCCAGCCCCACTGCCTTGG + Intergenic
1152905965 17:82971106-82971128 GACCCCCAGCGTGGCTGTGTGGG - Intronic
1153601643 18:6786549-6786571 GCCCCCCAGCATGCCTTTTTGGG + Intronic
1154384498 18:13880764-13880786 GGCCCCTTGCCTCACTGTGTGGG - Intergenic
1155183137 18:23365512-23365534 GCCCCCCAGGATGACTGAGAGGG - Intronic
1157349056 18:46868847-46868869 GTCCCCCTGCCTCACTGTGGTGG + Intronic
1157388723 18:47282906-47282928 GACCCTCACCATAACTGTGTGGG + Intergenic
1158688851 18:59642434-59642456 TCCCCCCTCCATGACTGTGTAGG + Intronic
1160439488 18:78878459-78878481 GCCCCCCAACATCAGTGAGGGGG - Intergenic
1161101991 19:2425920-2425942 GTCCCCCAGCGTCACCCTGTTGG - Exonic
1161275562 19:3414774-3414796 GATCCCCAGCATCACAGAGTCGG - Intronic
1161283936 19:3459343-3459365 GCCACCCAGCCTCACAGTGGGGG - Intronic
1162182881 19:8882736-8882758 GACCCACAGCATCACTGAGCTGG - Exonic
1162183750 19:8888755-8888777 GACCCACAGCATCACTGAGCTGG - Exonic
1162184569 19:8894922-8894944 GACCCACAGCATCACTGAGCTGG - Exonic
1165807173 19:38587554-38587576 GCCCCCCAGCATCACTGTGTTGG + Intronic
1166342391 19:42146507-42146529 GCTCCCCAGCTCCACTTTGTGGG + Intronic
1166384315 19:42371652-42371674 GGTCCCCAGCATCACTGCCTAGG - Intronic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
926283784 2:11471443-11471465 GCCCCCCAGAATTCATGTGTTGG - Intergenic
926678339 2:15645520-15645542 ACCTCCCAGCATCACACTGTTGG + Intergenic
927824502 2:26298712-26298734 GCCCCCCAGCCACTCTGGGTTGG - Intergenic
927954912 2:27201372-27201394 GCCCACCACAATCACTGTGGTGG + Exonic
928949015 2:36798275-36798297 GCCCCTAAGAATCCCTGTGTTGG - Intronic
932142609 2:69293116-69293138 GTCCTCCAGGATCTCTGTGTTGG - Intergenic
932893991 2:75621273-75621295 GCCTACCAGCAACACAGTGTGGG - Intergenic
933166899 2:79086626-79086648 GACCACCAGCATCTCTGTGCTGG + Intronic
938069067 2:128298983-128299005 TCCCTCCTGCATGACTGTGTGGG + Intronic
940080343 2:149794217-149794239 GTCTCCCAGTATTACTGTGTGGG + Intergenic
943391850 2:187279288-187279310 GTCCCCCAACACCATTGTGTTGG - Intergenic
945666971 2:212755309-212755331 GTCCCCCACTATTACTGTGTGGG - Intergenic
948093356 2:235314301-235314323 GCCCCCCACAATCACAGTGGGGG + Intergenic
948673172 2:239581606-239581628 GCCTGCCAGCATCACTGTCTCGG + Intronic
1170412249 20:16104345-16104367 GACCCACAGCAGCACTGTCTGGG - Intergenic
1171391073 20:24802111-24802133 GCCCTGCAGCAGCACTGTGTGGG - Intergenic
1172568967 20:35954175-35954197 GCCCCTGAGCGTAACTGTGTGGG - Exonic
1175459522 20:59141918-59141940 GTCTCCCAGCACCCCTGTGTTGG + Intergenic
1176149206 20:63580743-63580765 CCTCCCCAGCATCACAGTGCAGG - Intergenic
1176300059 21:5095161-5095183 GCGCCCCAGGACCCCTGTGTCGG - Intergenic
1179070237 21:38064397-38064419 GTGCCCAAGCATCACTGTGGGGG - Intronic
1179856963 21:44166750-44166772 GCGCCCCAGGACCCCTGTGTCGG + Intergenic
1180141910 21:45898203-45898225 GCCACCCAGCTGCACTCTGTGGG + Intronic
1180748802 22:18110709-18110731 GCCCCCCGGCATCACAGTGCCGG - Intronic
1182157669 22:28090988-28091010 GACACTCAGCATCACTTTGTTGG - Intronic
1182943088 22:34296977-34296999 GTCCCCCAGTATTCCTGTGTTGG + Intergenic
949214679 3:1551634-1551656 GCCCACCATCATCACTTTGCTGG - Intergenic
949881495 3:8664399-8664421 GCCTCCAAGCATGACTGTGTGGG - Intronic
950009534 3:9713032-9713054 GCCCTTCAGCATCCCTGTGCGGG + Exonic
950073565 3:10171352-10171374 GCCTCTCAGCAACACTGTGAGGG - Intronic
952955035 3:38551605-38551627 TCCAGCCAGCATCACTGTGCAGG + Intronic
953172063 3:40515926-40515948 GCCCCCCACCATCAGTCTGAAGG - Exonic
953891621 3:46755692-46755714 TCCCCCCAGGATCTCTGTGAAGG - Intronic
954274336 3:49532614-49532636 GGCCACAAGCATCACTGTGACGG + Exonic
954698751 3:52441033-52441055 GGCCCCCAGCATCATTCTGCAGG + Exonic
957742092 3:84283356-84283378 ACCCCCCAGAATCTCTGAGTAGG + Intergenic
961032856 3:123621811-123621833 GCGACCCAGCCTCACTGTGGTGG - Intronic
966933804 3:184692396-184692418 GCCCCCCAACTCCACTGTGAGGG + Intergenic
968747992 4:2370810-2370832 GGCGCCCAGCATCACAGTGTGGG - Intronic
969263686 4:6050256-6050278 TCACCCCAGCTTCACGGTGTGGG + Intronic
969317672 4:6391716-6391738 TCCCCCAAGGGTCACTGTGTCGG - Intronic
969680804 4:8642373-8642395 GCACCCCAGCATGAATGTGCAGG + Intergenic
974811597 4:66953118-66953140 GCCCTCCAGATTCACTGGGTTGG - Intergenic
974977322 4:68906769-68906791 GTCCCCCAGCCTCTCTGTGTTGG + Intergenic
975195793 4:71521686-71521708 GCTCCCCAGTCTCACTGTCTGGG - Intronic
980955153 4:139420440-139420462 CCCTCACAGCATCACTGTGTGGG + Intergenic
985929847 5:3048379-3048401 GACCCTCAGGAGCACTGTGTGGG + Intergenic
986595763 5:9420222-9420244 GCCCACTAGCACCACTCTGTTGG - Intronic
997165765 5:131659212-131659234 GCCGCCAAACAACACTGTGTTGG + Intronic
1002193073 5:177488960-177488982 ACCCCCCAGCATCAGCGTGCCGG - Intronic
1004720231 6:18262554-18262576 TTCCCCAAGCATTACTGTGTTGG + Intronic
1004732005 6:18367436-18367458 GCAGCCCATCATCACTGTGGAGG + Intergenic
1005963969 6:30713341-30713363 GCCCCTCTTCATCACTGTGAAGG + Exonic
1006507360 6:34498000-34498022 GCACCCCAGAATCTCTGTGGTGG - Intronic
1009695551 6:67097929-67097951 GTCTCCCATTATCACTGTGTGGG - Intergenic
1010405712 6:75503692-75503714 GCTCCCCATCATCACAGTGGTGG - Intergenic
1012231954 6:96770305-96770327 GCCTCCCACTATTACTGTGTGGG - Intergenic
1014854600 6:126383808-126383830 GCCTCCCAGTATTACTGTCTAGG - Intergenic
1017840767 6:158221003-158221025 GTCCTCCGGCCTCACTGTGTTGG + Intergenic
1018034013 6:159866615-159866637 GCTCCCCTGTATCACTGTGCGGG + Intergenic
1018445230 6:163852310-163852332 GACCCCCAGAATCACTATCTAGG - Intergenic
1018731820 6:166657071-166657093 GCTCCCCACCGTCTCTGTGTTGG - Intronic
1018782315 6:167079305-167079327 GCCCCTCAGCAACACTCTGTAGG - Intergenic
1018992339 6:168683774-168683796 GCCGCCCCACATCACTGTGCTGG - Intergenic
1019201236 6:170317889-170317911 GGCCTCCAGCATAACTGTCTTGG + Exonic
1019610441 7:1934071-1934093 GCCCCCAAAAATCACAGTGTTGG - Intronic
1020280404 7:6647337-6647359 TCCCCCAAGCACCAATGTGTGGG + Intronic
1020406788 7:7844514-7844536 CTTCCCCAACATCACTGTGTTGG + Intronic
1022058578 7:26768065-26768087 GTCTCCCAGTGTCACTGTGTGGG + Intronic
1023535426 7:41203637-41203659 GCCCCCCAGCAGCAGTGCCTGGG - Intergenic
1028007544 7:85593887-85593909 GCCCCCCCACTTCACTGTGCTGG - Intergenic
1032169711 7:129574473-129574495 TTCCCCAAGGATCACTGTGTTGG - Intergenic
1033033331 7:137847173-137847195 TCCCCCCAGCCTCACGGTGCAGG - Intergenic
1033144439 7:138859313-138859335 ACCCCCCAACATGACTGTGTTGG - Intronic
1033598461 7:142872449-142872471 CCGCTCCAGCATCACTGTGGTGG + Exonic
1033603737 7:142909567-142909589 CCGCTCCAGCATCACTGTGGTGG + Exonic
1036470191 8:9046016-9046038 GCCCCCTAGAATCTCTGAGTGGG - Intronic
1037807742 8:22067721-22067743 CCCCCCCAGCCACACTGGGTGGG + Intronic
1038161657 8:25045315-25045337 GTCCCCCAGAATCCATGTGTTGG - Intergenic
1038494251 8:27990453-27990475 TCCTCCCAGGAGCACTGTGTTGG + Intronic
1041753120 8:61282937-61282959 GCTGCACAGCATCACTGGGTAGG - Intronic
1049995817 9:1032673-1032695 GCTTCCCAGCATCCCTGAGTGGG + Intergenic
1054261505 9:62870074-62870096 GCCCCCAAGAATTCCTGTGTTGG + Intergenic
1055380796 9:75704705-75704727 GCCTCCCATTATTACTGTGTGGG + Intergenic
1055892476 9:81138109-81138131 TCCCTCCAGCCTCACTGTGGTGG - Intergenic
1056002109 9:82228192-82228214 GCCGAGCAGCATCAGTGTGTGGG - Intergenic
1056582388 9:87900972-87900994 GTCCCCCAGTATTATTGTGTTGG - Intergenic
1057388611 9:94625284-94625306 GGCCCTCAGCTTCTCTGTGTTGG - Intronic
1058260065 9:102816910-102816932 GTCTCCCAGCATTATTGTGTGGG - Intergenic
1061631202 9:131873369-131873391 GCCCCCTAACATCACTGTCAGGG - Intronic
1061737443 9:132670844-132670866 GGCCCGCAGCATCGCTGTGCTGG + Exonic
1062208722 9:135351624-135351646 GCCCACCAGCCCCACTGTGTAGG + Intergenic
1187398296 X:18937095-18937117 GCCCCCCAGCATTCCTGAGCAGG + Intronic
1190256597 X:48767560-48767582 GCCCGCCACCATGCCTGTGTGGG - Intronic
1190342477 X:49308576-49308598 GCCCCCCAGCCACTCTGGGTTGG - Intronic
1191632209 X:63333785-63333807 GCCTCCCACTATTACTGTGTGGG - Intergenic
1193635388 X:83943894-83943916 CACCCCCAGCATCACTCTGCTGG - Intergenic
1193997720 X:88386996-88387018 GTCCCCCACTATCATTGTGTGGG - Intergenic
1201524358 Y:14914984-14915006 GCCTCCCATTATCATTGTGTGGG + Intergenic
1201599361 Y:15711327-15711349 GTCCCCCACCATTATTGTGTGGG + Intergenic