ID: 1165809288

View in Genome Browser
Species Human (GRCh38)
Location 19:38601108-38601130
Sequence CTAAAAATACAAAAGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48746
Summary {0: 1, 1: 160, 2: 9080, 3: 23473, 4: 16032}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165809288_1165809293 7 Left 1165809288 19:38601108-38601130 CCTAGCTTCTTTTGTATTTTTAG 0: 1
1: 160
2: 9080
3: 23473
4: 16032
Right 1165809293 19:38601138-38601160 GGGGTTTCACCATGTTGGCCAGG 0: 64910
1: 151465
2: 197443
3: 160987
4: 104258
1165809288_1165809294 11 Left 1165809288 19:38601108-38601130 CCTAGCTTCTTTTGTATTTTTAG 0: 1
1: 160
2: 9080
3: 23473
4: 16032
Right 1165809294 19:38601142-38601164 TTTCACCATGTTGGCCAGGCTGG 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
1165809288_1165809292 2 Left 1165809288 19:38601108-38601130 CCTAGCTTCTTTTGTATTTTTAG 0: 1
1: 160
2: 9080
3: 23473
4: 16032
Right 1165809292 19:38601133-38601155 GAGACGGGGTTTCACCATGTTGG 0: 34182
1: 124688
2: 145165
3: 98748
4: 47715

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165809288 Original CRISPR CTAAAAATACAAAAGAAGCT AGG (reversed) Intronic
Too many off-targets to display for this crispr