ID: 1165816834

View in Genome Browser
Species Human (GRCh38)
Location 19:38647769-38647791
Sequence TGGGGCCGTACTGGTACGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 15}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165816834_1165816847 8 Left 1165816834 19:38647769-38647791 CCAGTCGTACCAGTACGGCCCCA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1165816847 19:38647800-38647822 GGCAATGGCGCTGGCGGCGGGGG 0: 1
1: 0
2: 3
3: 79
4: 760
1165816834_1165816846 7 Left 1165816834 19:38647769-38647791 CCAGTCGTACCAGTACGGCCCCA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1165816846 19:38647799-38647821 GGGCAATGGCGCTGGCGGCGGGG 0: 1
1: 0
2: 0
3: 14
4: 179
1165816834_1165816845 6 Left 1165816834 19:38647769-38647791 CCAGTCGTACCAGTACGGCCCCA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1165816845 19:38647798-38647820 CGGGCAATGGCGCTGGCGGCGGG 0: 1
1: 0
2: 0
3: 11
4: 123
1165816834_1165816842 -1 Left 1165816834 19:38647769-38647791 CCAGTCGTACCAGTACGGCCCCA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1165816842 19:38647791-38647813 AGCAGCGCGGGCAATGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 115
1165816834_1165816849 17 Left 1165816834 19:38647769-38647791 CCAGTCGTACCAGTACGGCCCCA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1165816849 19:38647809-38647831 GCTGGCGGCGGGGGCAGCATGGG 0: 1
1: 0
2: 3
3: 34
4: 424
1165816834_1165816844 5 Left 1165816834 19:38647769-38647791 CCAGTCGTACCAGTACGGCCCCA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1165816844 19:38647797-38647819 GCGGGCAATGGCGCTGGCGGCGG 0: 1
1: 0
2: 0
3: 15
4: 211
1165816834_1165816850 28 Left 1165816834 19:38647769-38647791 CCAGTCGTACCAGTACGGCCCCA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1165816850 19:38647820-38647842 GGGCAGCATGGGCGACTACATGG 0: 1
1: 0
2: 0
3: 8
4: 102
1165816834_1165816848 16 Left 1165816834 19:38647769-38647791 CCAGTCGTACCAGTACGGCCCCA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1165816848 19:38647808-38647830 CGCTGGCGGCGGGGGCAGCATGG 0: 1
1: 0
2: 1
3: 44
4: 453
1165816834_1165816843 2 Left 1165816834 19:38647769-38647791 CCAGTCGTACCAGTACGGCCCCA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1165816843 19:38647794-38647816 AGCGCGGGCAATGGCGCTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 99
1165816834_1165816838 -7 Left 1165816834 19:38647769-38647791 CCAGTCGTACCAGTACGGCCCCA 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1165816838 19:38647785-38647807 GGCCCCAGCAGCGCGGGCAATGG 0: 1
1: 0
2: 1
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165816834 Original CRISPR TGGGGCCGTACTGGTACGAC TGG (reversed) Exonic