ID: 1165817591

View in Genome Browser
Species Human (GRCh38)
Location 19:38651614-38651636
Sequence CAAAAAAAAAGCCAACGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 399}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165817591_1165817595 9 Left 1165817591 19:38651614-38651636 CCTGACCGTTGGCTTTTTTTTTG 0: 1
1: 0
2: 0
3: 30
4: 399
Right 1165817595 19:38651646-38651668 TTTTGCTCTTGTTGCCCATGTGG 0: 3
1: 53
2: 142
3: 242
4: 496
1165817591_1165817596 19 Left 1165817591 19:38651614-38651636 CCTGACCGTTGGCTTTTTTTTTG 0: 1
1: 0
2: 0
3: 30
4: 399
Right 1165817596 19:38651656-38651678 GTTGCCCATGTGGCTGTATTAGG 0: 1
1: 0
2: 1
3: 18
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165817591 Original CRISPR CAAAAAAAAAGCCAACGGTC AGG (reversed) Intronic
901668812 1:10842130-10842152 CAAAAAAAAAGAAAAAGGGCAGG - Intergenic
901699141 1:11034399-11034421 AAAAAAAAAAACCAAGGATCCGG + Intronic
902452182 1:16503450-16503472 AAAAAAAAAAGCCCACCGTTAGG - Intergenic
902598777 1:17526915-17526937 AAAAAAAAAAGACAAGGCTCAGG + Intergenic
902877030 1:19346805-19346827 AAAAAAAAAAGACAAAAGTCGGG - Intronic
903176200 1:21582817-21582839 CAATAAAAAAACAAACGGCCAGG - Intergenic
903312488 1:22470572-22470594 CAAAAGAAAAGCCTATGGTCAGG + Intronic
904018464 1:27442704-27442726 CAAAAAACTAGCCAAAGGGCCGG + Intronic
904673282 1:32181555-32181577 GAAGAAAAAAGCCAAGGGTTTGG + Exonic
904904299 1:33883457-33883479 AAAAAAAAAAGGCAACTGTGAGG - Intronic
906944025 1:50280255-50280277 CAAACAAAATGCCATCTGTCTGG - Intergenic
907025199 1:51111185-51111207 GAAAAAAAAACCCAGAGGTCTGG + Intronic
909214364 1:72867585-72867607 AAAAAAAAAAGCCCACTTTCAGG - Intergenic
910781368 1:90938599-90938621 CAAAATAAAAGCCATCGTTTTGG + Exonic
911365510 1:96932874-96932896 TAAAAAAAAAACCCATGGTCAGG + Intergenic
911991819 1:104707710-104707732 AATAAAAAAAACCAACTGTCTGG - Intergenic
912760791 1:112365603-112365625 CAAAAAAAAAGAAAAAGGGCCGG + Intergenic
912904170 1:113686521-113686543 CTAAAAATAAACCCACGGTCGGG + Intergenic
913144215 1:115973659-115973681 AAAAAAAAAAGGCTACGGGCTGG + Intergenic
913387305 1:118272456-118272478 CTAAAAGAAAGCCAAGGGCCAGG - Intergenic
914838773 1:151230540-151230562 CAAAAAAAAGGGCAACAGTGTGG - Intronic
915717047 1:157954580-157954602 AAAAAAAAAAGCCACAGGTCTGG + Intergenic
916594988 1:166235014-166235036 CAAAAAAAAATCAAAAGGACTGG - Intergenic
917409911 1:174748878-174748900 AAAAAAAAAAGACATCAGTCCGG + Intronic
917549485 1:176009125-176009147 CAACAAAACAGCCAAAGGTGGGG - Intronic
919463702 1:197908320-197908342 CAACAAAAAAGCCAACAATTTGG - Intergenic
919525845 1:198649452-198649474 CAAAGAAAAAGGAAAAGGTCAGG + Intronic
919617886 1:199830230-199830252 CAAAAATAATGCCAAGGGTTTGG - Intergenic
919898767 1:202028042-202028064 AAAAAAAAAAGAAAACAGTCTGG + Intergenic
920220421 1:204394855-204394877 AAAAAAAAAAGCAAAGGGCCTGG + Intergenic
920341707 1:205279255-205279277 AAAAAAAAAAGCCAAAGGGAAGG + Intergenic
922276843 1:224087039-224087061 CAAAAAAAAAGAAAACAGACAGG + Intergenic
922289652 1:224199694-224199716 CAAAAAAAAAAGCAAGGGTGAGG + Intergenic
922510011 1:226157532-226157554 GAAAAAAAAAGCCATAGGCCAGG - Intronic
922551136 1:226495437-226495459 GAAAAAAAAAAACAACAGTCAGG - Intergenic
923843715 1:237704736-237704758 CAAAAAAAAATTCAAAGGTAAGG + Intronic
1063274748 10:4553020-4553042 AAAAAAAAAAGACAACAGTGGGG - Intergenic
1063409903 10:5829477-5829499 CAAGAAAACAGCCAATGGCCAGG + Intronic
1063914369 10:10866623-10866645 AAAAAAAAAATCCAACAATCAGG + Intergenic
1064553080 10:16521602-16521624 AAAAAAAAAAGGCAGCGGACGGG - Exonic
1066667240 10:37796367-37796389 AAAAAAAAAAGCCAGCTGTAGGG - Intronic
1069409323 10:68136390-68136412 CTAAAAACATGCCACCGGTCAGG + Intronic
1069516305 10:69080312-69080334 AAAAAAAAAAGCCTAGAGTCTGG + Intergenic
1069970396 10:72162942-72162964 CAAAAAAAAAGGAAAAGGACTGG + Intronic
1072051826 10:91712391-91712413 TAATAAAAAAGCCAAGTGTCAGG - Intergenic
1072986540 10:100145838-100145860 CAAAAAAAAAAAGAACAGTCTGG - Intergenic
1073360277 10:102893219-102893241 CAAACAAAAAGCCAAAGGTGAGG - Intronic
1073544520 10:104337474-104337496 GAAAAAAAAAGCCACCGACCAGG - Intronic
1074443546 10:113499341-113499363 GTAAAAAAAAGCCATCCGTCTGG - Intergenic
1075614633 10:123882568-123882590 GAGAAAAAAAGCCAAAGTTCTGG + Intronic
1076695113 10:132243670-132243692 AAAAACAAAAGCCAAGGGCCAGG + Intronic
1078842250 11:15089481-15089503 CAAAAAAATAGCCCACGGAATGG - Intergenic
1079469464 11:20764605-20764627 CAAAAAAAAAAAAAAAGGTCTGG - Intronic
1079942078 11:26693511-26693533 CAAAGAAAACCCCAACGTTCAGG - Intronic
1082183438 11:49148135-49148157 CAGAAAAAAATCCAACTGTCAGG + Intronic
1083968248 11:66056412-66056434 AAAAAAAAAAGCCACAAGTCTGG + Intronic
1084221438 11:67682678-67682700 TAAAATAAAAGCCAAAGGTGAGG - Intergenic
1084930539 11:72552221-72552243 AAAAAAAAAAGCCAATATTCTGG + Intergenic
1085143402 11:74170764-74170786 CAACGAAAAGGCCAAGGGTCTGG - Exonic
1086268595 11:85031935-85031957 AAAAAAAAAAGCCAGTTGTCAGG - Intronic
1086989977 11:93292124-93292146 CAAGAACAGAGCCAAAGGTCAGG + Intergenic
1087454135 11:98362077-98362099 AAAAAAAAAAGCCAGCGTGCTGG - Intergenic
1088998139 11:115021490-115021512 CAAAAAAAAAACAAAAAGTCTGG - Intergenic
1090680276 11:129048222-129048244 CAAAAACAAAGCTAAAGATCAGG + Intronic
1091022628 11:132114567-132114589 CAAATACAAAGCCAATGGCCAGG - Intronic
1091792853 12:3281457-3281479 CAAAAATAAAGCCAAAAGACAGG + Intronic
1092221286 12:6715694-6715716 CAAAAAACAAACAAACGGCCGGG - Intergenic
1092305366 12:7295280-7295302 CAAACAAAAAGCCAAAGGTGAGG - Intergenic
1092369480 12:7904685-7904707 AAAAAAAAAAGCTATCGGCCGGG - Intergenic
1092560373 12:9606907-9606929 CAAAAAAATAGCCAAGTGTGGGG - Intronic
1093623812 12:21323122-21323144 CAAACAGAAAGCCAAAGGCCAGG + Intronic
1095383696 12:41625917-41625939 AAAAAAAAAAGTCAAAGGTAGGG - Intergenic
1095414908 12:41965903-41965925 CAAAAAAAGAGCCAAATTTCTGG - Intergenic
1095831997 12:46597908-46597930 AAAAAAAAAAGCCCAGGGACAGG - Intergenic
1096205467 12:49718063-49718085 AAAAAAAAAAAACAACGGCCAGG + Intronic
1096680006 12:53249386-53249408 AAAAAAAAAAACCAACAGGCCGG + Intergenic
1098064840 12:66602836-66602858 AAAAAAAAAAGCAAAAGATCTGG - Intronic
1099269380 12:80488087-80488109 CAAAAAAAAAAACAACTGTAAGG - Intronic
1100251526 12:92829797-92829819 CAAAAAACAAGCCAAATGCCAGG + Intronic
1100481561 12:94984325-94984347 TAAAAAACAAGCAAACGGCCGGG + Intronic
1102340470 12:112117533-112117555 AAAAAAAAAAGCCAGGGGCCAGG + Intergenic
1102787591 12:115617204-115617226 CAAAAAGAATGCCCAAGGTCAGG - Intergenic
1102827727 12:115963717-115963739 CAAAAAAAAAGCAAACTTTTTGG + Intronic
1102905506 12:116671707-116671729 CAAAAAAAAAGCACAAGCTCAGG - Intergenic
1103620707 12:122185577-122185599 GAAAAAGAAAGCCAAGGGTTGGG - Intronic
1103634365 12:122291186-122291208 CAAAAAAAAAGAAAAGGGTCGGG - Intronic
1103973513 12:124687229-124687251 CGACAAAACAGGCAACGGTCTGG - Intergenic
1104659648 12:130601351-130601373 AAAAAAAAAAGCAAACCGGCTGG + Intronic
1105317821 13:19283593-19283615 AAAAAAAAAAAACAAAGGTCAGG + Intergenic
1106564326 13:30871667-30871689 CAATAAAAAAGCCAAGGAACAGG + Intergenic
1107187047 13:37535426-37535448 GAAAAAAAAAGTCTACGGCCGGG - Intergenic
1107848409 13:44544547-44544569 AAAAAAAAAAACCAACGGGAAGG + Intronic
1108018683 13:46102581-46102603 AAAAAAAAAAACTAACAGTCTGG - Intronic
1108102098 13:46967510-46967532 AAAAAAAAAAGGCAAGGGCCAGG - Intergenic
1108757063 13:53516311-53516333 AAAAACAAAAGCAAACGGTAAGG - Intergenic
1109019043 13:57061607-57061629 CAAAAAAAAAGCCAAACATTTGG - Intergenic
1109724160 13:66317017-66317039 CAAAAACAAAGCTAGCGGGCCGG - Intronic
1112286999 13:98113058-98113080 TGGAAAAAAAGCCAACGTTCTGG + Intergenic
1112408140 13:99138790-99138812 CAAACAAAAAGCCAAAAGTGAGG + Intergenic
1114295377 14:21324645-21324667 CAAACATAACGACAACGGTCGGG - Exonic
1114409142 14:22484468-22484490 AAAGAAAAAAGCCTACTGTCTGG - Intergenic
1114642171 14:24231041-24231063 CAAAAAATTAGCCAAGGGTCTGG - Intronic
1114702270 14:24690951-24690973 CTAAAAAAAAGCCAAAGCACTGG - Intergenic
1115447971 14:33513785-33513807 CAAAGAAAAAGCTCACGCTCTGG + Intronic
1115594679 14:34897930-34897952 AAAAAAAAATGCCAAGGGGCAGG - Intergenic
1115782411 14:36784350-36784372 AAAAAAAACAGCCAATGTTCTGG - Intronic
1115999623 14:39228997-39229019 CATAAGAAAAGCCATTGGTCGGG + Intergenic
1116221051 14:42087450-42087472 AAAAAAAAAAGCCAACAGCTGGG + Intergenic
1117110659 14:52450456-52450478 AAAAAAAAAAGCCAAAGCTCGGG + Intronic
1117618036 14:57554300-57554322 CAAAAAAAGAGGCATCAGTCTGG - Intergenic
1117939104 14:60941707-60941729 AAAAAAAAAAGTCAATGGCCGGG + Intronic
1118279887 14:64418849-64418871 AAAGAAAAAAGACAAAGGTCGGG - Intronic
1118292484 14:64539669-64539691 CAAAAAAAAACCCCACTGCCTGG - Intronic
1118764930 14:68903541-68903563 AAAAAAAAAAGCCACTGGTGGGG + Intronic
1119240210 14:73053154-73053176 AAAAAAAAAGGCCAAGGGCCAGG - Intergenic
1119355107 14:73999791-73999813 CAAAAAAAAAGGTAAAGGGCCGG + Intronic
1119908320 14:78325671-78325693 TAAAAAAAAAGCCTAGGGTCAGG + Intronic
1120274604 14:82355529-82355551 CACAGAAAAAGCCAACAGACAGG + Intergenic
1120633501 14:86921634-86921656 CAAAGTAAAAGCCAACAGCCTGG - Exonic
1121182960 14:91943211-91943233 CAAAAAAAAAAGCTAAGGTCAGG + Intronic
1121335899 14:93077314-93077336 CAAAAAAAAAGAAATGGGTCAGG - Intronic
1122185793 14:99994100-99994122 AAAAAAAAAAGCCAAAAGGCTGG - Intronic
1122754047 14:103963358-103963380 CAAAAGAAAAGCCATCGATATGG - Intronic
1124485314 15:30109521-30109543 GAAAAATAAAGCCATGGGTCGGG + Intergenic
1124518264 15:30387750-30387772 GAAAAATAAAGCCATGGGTCGGG - Intronic
1124540389 15:30578500-30578522 GAAAAATAAAGCCATGGGTCGGG + Intergenic
1124758264 15:32429081-32429103 GAAAAATAAAGCCATGGGTCGGG - Intergenic
1125497993 15:40215472-40215494 CAAAAAAAAAGCCAGAGGCCGGG + Intronic
1125834014 15:42735386-42735408 CAAAAAGAAAGCCCATGGTATGG + Intronic
1125895498 15:43298459-43298481 CAAAATAAAAGAAAACGGCCAGG + Intronic
1126471313 15:49013881-49013903 CAAGAAAAAAGTCAAGGGTCAGG - Intronic
1127104239 15:55596145-55596167 TAAAAAAAAACCCAGCAGTCTGG - Intergenic
1127163022 15:56211145-56211167 CAAACCAAAAGCAAAGGGTCTGG + Intronic
1127892459 15:63267428-63267450 CAAAATAAAAGCCATCTGTAAGG - Exonic
1128969981 15:72099924-72099946 AAAAAAAAAAGCAAAGGATCAGG + Intronic
1129305106 15:74654693-74654715 AAAAAAATAGGCCAACTGTCAGG - Intronic
1129963825 15:79715313-79715335 CAAGAAAAAAACAAACGGCCGGG + Intergenic
1130744616 15:86637784-86637806 CAATATAAAAGCAAACAGTCTGG - Intronic
1132919923 16:2382443-2382465 CAAAAAAACAGGCAAAGGACTGG - Intergenic
1133288571 16:4703000-4703022 CAAAAAAGAACCCAAAGGACTGG + Intronic
1134155475 16:11839388-11839410 AAAAAAAAAAGCCAACCGGTTGG + Intronic
1134303444 16:13011814-13011836 AAAAAAAAAAGTCAAAGGCCAGG - Intronic
1135924758 16:26683694-26683716 AAAAAAAAAAGCTAAGTGTCCGG + Intergenic
1136218483 16:28811846-28811868 AAAAAAAAAAACAAACGGCCAGG - Intergenic
1136423840 16:30155327-30155349 AAAAAAAAAAGGCCAAGGTCAGG + Intergenic
1136542633 16:30936739-30936761 CAAAAAAAAAAAAAAAGGTCGGG - Intronic
1137228025 16:46533749-46533771 CAAAAGAAAAGCCTACTGCCAGG - Intergenic
1137278306 16:46952622-46952644 CAAAAAAAAAGACCAAGGCCGGG + Intergenic
1137566432 16:49535462-49535484 CAAAAGAAAAGACAAAGATCAGG + Intronic
1138828725 16:60353260-60353282 GAAAAAAATAGCCAAAGATCAGG - Intergenic
1140357747 16:74320620-74320642 CAAAATAAAATCCAAAGGTTTGG + Intergenic
1140554179 16:75901623-75901645 AAAAAAAAAAGCTACCGGGCAGG - Intergenic
1140565219 16:76034456-76034478 CAAAAAAAAATCTAACTGTTGGG - Intergenic
1140725475 16:77807639-77807661 CAAAGAAAATGCCATAGGTCAGG - Intronic
1141753579 16:85976114-85976136 CAAAAAAAAAAACAATGATCTGG + Intergenic
1141755085 16:85985642-85985664 AAAAAAAAAACCCAACAGTGTGG + Intergenic
1142382436 16:89740644-89740666 AAAAAAAAAAACCCACGGCCTGG + Intronic
1143549931 17:7624244-7624266 CAAAAAAAAAGAAAATGGCCAGG - Intronic
1143806347 17:9430942-9430964 TAAAAAACAAGCCAAAGGCCGGG - Intronic
1144043709 17:11435882-11435904 CAAAAAGAAAGCCATCCATCAGG - Intronic
1145353836 17:22118207-22118229 AAAAAAAAAAACAAACGGTGTGG + Intergenic
1146081628 17:29785793-29785815 AAAAAAAAAAGTAAACGGACTGG - Intronic
1146246615 17:31289898-31289920 TAAAAAAAAAACCAACGATGGGG - Intronic
1146369213 17:32254440-32254462 AAAAAAAACATCCAACGGCCGGG - Intergenic
1146406418 17:32542620-32542642 AAAAAAAAAAGCCAACAGTTAGG + Intronic
1146779283 17:35653434-35653456 CAAAAACAAAACCAAGGGACTGG - Intronic
1147794474 17:43032805-43032827 CAAAAAAAAAACCACTAGTCTGG - Intergenic
1147886264 17:43686484-43686506 CAAAAAAAAAAAAAAAGGTCAGG - Intergenic
1148130684 17:45261084-45261106 AAAAAAAAAAACCAGAGGTCGGG - Intronic
1148172645 17:45536026-45536048 TAAAAAATAAGCCATCAGTCTGG + Intergenic
1148276625 17:46309423-46309445 TAAAAAATAAGCCATCAGTCTGG - Intronic
1148298742 17:46527011-46527033 TAAAAAATAAGCCATCAGTCTGG - Intronic
1148363276 17:47031508-47031530 TAAAAAATAAGCCATCAGTCTGG - Intronic
1148833721 17:50454009-50454031 CAAAAAAATAGCCAACCATGGGG + Intronic
1149260260 17:54872870-54872892 AAAAAAAAAAGTCAAGGGCCAGG + Intergenic
1149831478 17:59876337-59876359 CAAAAAAAAAACAAACAGTTAGG - Intronic
1150403849 17:64882946-64882968 TAAAAAATAAGCCATCAGTCTGG + Intronic
1150556429 17:66258879-66258901 AAAAAAAAAAGGCATAGGTCAGG + Intergenic
1150659449 17:67062735-67062757 AAAAAAAAAAGCCATGGGTTAGG - Intergenic
1150760478 17:67956666-67956688 AAAAAAAAAAAAAAACGGTCAGG + Intronic
1150780889 17:68121151-68121173 AAAAAAAAAAGCCAAAGGTTTGG + Intergenic
1151048116 17:70945628-70945650 CAAAAAAACATTCAATGGTCTGG + Intergenic
1151792513 17:76317361-76317383 AAAAAAAAAAATCAACAGTCAGG + Intronic
1152916931 17:83044015-83044037 CAACAAAAAAGCCCAGAGTCAGG + Intronic
1203160060 17_GL000205v2_random:41052-41074 CAAAACAAAATCTAACTGTCAGG - Intergenic
1153200946 18:2646915-2646937 CAAAAAATTAGCCAGCGTTCTGG - Intergenic
1153343977 18:4006636-4006658 AAAAAAAAAAGCCAGGGGTTGGG - Intronic
1154206841 18:12344742-12344764 CAGAATAAAAGCAAAAGGTCAGG + Intronic
1154945947 18:21161574-21161596 AAAAACAAAAAACAACGGTCGGG - Intergenic
1155777076 18:29778276-29778298 AAAAAAAAAAGCCAAGTGTGGGG + Intergenic
1155916501 18:31562650-31562672 CAAGAAAAAAGCCAAGGTTAAGG + Intergenic
1157368250 18:47086300-47086322 TAAAAAAAAAGCCTACAGGCAGG - Intronic
1157669267 18:49514490-49514512 AAAAAAAAAAGCAGAGGGTCTGG + Intergenic
1159361770 18:67414684-67414706 CAAAAAAAAAAAAAATGGTCAGG - Intergenic
1160880929 19:1319761-1319783 CAAAAAAAAAACAAACAGGCCGG - Intergenic
1161165908 19:2787241-2787263 CAAGAGAAAAGCCAAGGATCAGG - Intronic
1161254584 19:3300468-3300490 CAAAAAAAAATCAAACAGACTGG + Intergenic
1161849222 19:6730323-6730345 CAACAAAACAGCCAGCGGGCGGG - Exonic
1162599411 19:11656279-11656301 CAAAAAAAAAAACAACTGTGTGG + Intergenic
1163015609 19:14452097-14452119 TAAAAAATAAGCCAGGGGTCGGG + Intronic
1163085299 19:14975456-14975478 CAAAAAAAATGAAAACGGCCAGG + Intronic
1164061607 19:21680195-21680217 CATAATAAAAGGCTACGGTCGGG + Intergenic
1165817591 19:38651614-38651636 CAAAAAAAAAGCCAACGGTCAGG - Intronic
1165852492 19:38857894-38857916 CAAAAAAAAAGTAAAAGGCCAGG + Intergenic
1166059852 19:40319523-40319545 AAAAAAAAAAGCCAAGGGCCTGG - Exonic
1166372851 19:42311936-42311958 AAAAAAAAAAGCAAACTGCCTGG - Intergenic
1167714822 19:51136390-51136412 AAAAAAAAAAGCCATGGGCCAGG - Exonic
1167920812 19:52781765-52781787 AAAAAAAAAAAACAGCGGTCAGG + Intronic
1168711607 19:58503814-58503836 CAAAAAAACAGCCAATTGGCTGG + Intronic
926400387 2:12490542-12490564 AAAAAAAAAAGTCAACGTTATGG - Intergenic
927051348 2:19332542-19332564 CAAACAAAAAACAAACGGTGAGG - Intergenic
927699912 2:25261451-25261473 AAAAAAAAAAGCCAGAGGTGGGG + Intronic
928519613 2:32075847-32075869 AAAAAAAAAAGCCAGGAGTCTGG - Intronic
928894278 2:36243150-36243172 CAAAAAAAAAGTCAACCATGGGG + Intergenic
929881223 2:45838771-45838793 CAAATAAAGAGCTAAAGGTCAGG - Intronic
930121128 2:47761760-47761782 CAAAAAAAAAGTCAACCAGCAGG - Intronic
930139544 2:47937632-47937654 CAAAAAAAAAGCCAGGTCTCAGG + Intergenic
930389319 2:50740507-50740529 CAACAAAAAATCCAAAGCTCAGG - Intronic
931401742 2:61937603-61937625 CAAACAAAAAGCCAAAGGTGAGG + Intronic
931490296 2:62738058-62738080 CTAAAAAAAAGACAAAGGCCAGG - Intronic
932167657 2:69522824-69522846 AAAAGAAAAAGCCAAGGGTGAGG + Intronic
932268119 2:70385882-70385904 AAAAAAAAAAGTCCACGGCCTGG - Intergenic
932555686 2:72823486-72823508 CAAAAAAAAAGACAGTGGCCAGG + Intronic
932637569 2:73405207-73405229 CAAAAGAAAAGCCCATGGCCAGG - Intronic
932716735 2:74106081-74106103 AAAAAAAAAAGCCAAGAGACTGG - Exonic
933392333 2:81687244-81687266 CAAAAAAAAAACCAACCATATGG + Intergenic
933895476 2:86807167-86807189 AAAAAAAAAAGCCAGCGTGCTGG + Intronic
934994692 2:98946824-98946846 CCAAAAGAAAAGCAACGGTCTGG - Intergenic
935061038 2:99607966-99607988 TAAAAAAAAACCCAACTGGCAGG + Intronic
935689113 2:105714508-105714530 CAACTAAAAAGCCAACAGCCAGG + Intergenic
936095055 2:109525069-109525091 AAAAAAAAAAAACAACGGTAAGG - Intergenic
936732973 2:115406007-115406029 CAGAAGAAAAGCCAAGGGTGCGG - Intronic
936972158 2:118186273-118186295 CAAAAACAAAGCCATCTCTCCGG - Intergenic
937172969 2:119895624-119895646 CAAAAAAAAAGAAAAAGGCCGGG + Intronic
937188861 2:120072933-120072955 AAAAAAAAAAGTCATCTGTCAGG + Intronic
938142173 2:128803657-128803679 GAAACAAAAAGCCAAAGGTGAGG + Intergenic
940597764 2:155816686-155816708 CAAAAAACAAGCCAAACATCTGG + Intergenic
940840025 2:158568972-158568994 CCAAAAAAAAGCCATCCGTGTGG + Intronic
940954335 2:159712103-159712125 AAAAAAAAAAGCCAACCAGCTGG + Intergenic
941794792 2:169587238-169587260 CAAAAAAAAAAGCAAAAGTCAGG - Intronic
941969287 2:171332277-171332299 CAAAAAAAAAGCTGAGGGGCGGG - Intronic
942663801 2:178294855-178294877 AAAAAAAAAAGCTAATGGTGAGG - Intronic
942777219 2:179596679-179596701 AAAAAGAAAAGCCAAGGGTGTGG - Intronic
943643465 2:190383768-190383790 CAAAAAAAAAAAAAAGGGTCGGG - Intergenic
944986205 2:205180573-205180595 AAAAAAAAAAGCCAATGTTTTGG - Intronic
946251864 2:218418927-218418949 AAAAAAAAAAGCCAAGGGTGGGG + Intergenic
946938075 2:224742545-224742567 AAAAAAAAAAACCAACCATCAGG + Intergenic
947765733 2:232635826-232635848 AAAAAAAAAAGCCAAGGGGAAGG + Intronic
947778894 2:232739376-232739398 CAAAAAAAAAGAAAAGGGTTAGG + Intronic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
1169310088 20:4530099-4530121 CAAAAGAAAAGACATTGGTCTGG + Intergenic
1170617596 20:17966908-17966930 CAAAAATAAAGCCACGCGTCAGG + Intronic
1170677282 20:18494381-18494403 GAAAAAAAAAGCTAATGGTCAGG + Intronic
1172069640 20:32247178-32247200 CAAACAAAAAACCAAAGGTGAGG - Intergenic
1172402572 20:34662384-34662406 AAAAAAAAAAGGCAAAGGGCTGG - Intronic
1172488724 20:35316932-35316954 CAAAAAAAAAGGAAATGGGCCGG - Intronic
1173824777 20:46041168-46041190 AAAAAAAAAAGCCAATGGCCAGG + Intronic
1174464017 20:50703252-50703274 CAAAAAAAAACCAAAAGGGCCGG + Intergenic
1175514057 20:59557565-59557587 CAAAAAAAAAAAAAAAGGTCGGG - Intergenic
1177031303 21:15984066-15984088 CATAAAATAGGCAAACGGTCTGG - Intergenic
1177146545 21:17412899-17412921 CAAAAAAAAAAACAATGGTCTGG + Intergenic
1178606540 21:34041463-34041485 CAAAAAAAAAGCCCAGCATCTGG - Intergenic
1180222630 21:46368959-46368981 CAAACAATAAGCCAACGCTTTGG - Intronic
1180845947 22:18982412-18982434 CAAAAAACAAGCAAACTGTCTGG + Intergenic
1181095976 22:20505580-20505602 AAAAAAAAAAACCAAGGGCCGGG + Intronic
1181288931 22:21775777-21775799 AAAAAAAAAAGACAAGGGCCAGG - Intronic
1181565428 22:23733995-23734017 AAAAAAAAAAGCAAACTTTCAGG - Intergenic
1182267323 22:29127654-29127676 AAAAAAAAAAGTAAACAGTCTGG + Intronic
1183662996 22:39232487-39232509 CAAAAAAAAAGAAAAAAGTCAGG - Intronic
1184798215 22:46744122-46744144 CAAAAAAAAAGGCAACAATAGGG + Intergenic
950062963 3:10087644-10087666 CAAAAAAAAAGAAAAAGGCCAGG - Intronic
950507011 3:13401271-13401293 AAAAAAAAAAGGCAATGGTGCGG + Intronic
950580683 3:13860045-13860067 AAAAAAAAAACCCAAGTGTCTGG - Intronic
951070610 3:18324588-18324610 AAAAAAAAAGGCAAATGGTCTGG - Intronic
951360643 3:21720553-21720575 CAAAAAAAATGCCAATTCTCAGG + Intronic
952398699 3:32943702-32943724 AAAAAAAAAAAACAACGGCCAGG - Intergenic
952679191 3:36071637-36071659 AAAAAAAAAAGCCCAGGATCAGG - Intergenic
952909432 3:38169598-38169620 CAAAAAAAAAACGAACAGCCAGG - Intronic
953356248 3:42258544-42258566 CCAAAAGAAAGCAAACGGTAGGG - Intronic
954403025 3:50329143-50329165 CAAAAAAAAAAAAAACGGCCGGG - Intergenic
954833113 3:53440137-53440159 CAAAAACAAAGCAAACAGTAGGG - Intergenic
955924393 3:63991288-63991310 CAAAAAAAAAACCAGGGGTGGGG - Intronic
957714723 3:83911777-83911799 CAAAAAAAAAAACAATGGACAGG + Intergenic
957893126 3:86385905-86385927 AAAAAAAAAAGTCAGCTGTCTGG + Intergenic
958745374 3:98127634-98127656 CAAAAAGAAAGTCAATGGTGTGG - Intergenic
958852708 3:99348246-99348268 GAAAAAAAAATCCCACGATCAGG + Intergenic
959661446 3:108873206-108873228 CTAAAGAAAATGCAACGGTCTGG + Intergenic
960382111 3:116975728-116975750 AAAAAAAAAAGCCGATGGGCTGG - Intronic
960554898 3:119017048-119017070 AAAAAAAAAAGCCAACTATGGGG + Intronic
960601283 3:119461295-119461317 AAAAAAAAAGGACAAAGGTCAGG + Intronic
961430310 3:126877258-126877280 CAAAAATTAAGTCAACGGCCGGG + Intronic
962792407 3:138823407-138823429 AAAAAAAAAAAGCAACGGTCGGG + Intronic
963296924 3:143556738-143556760 CAGAAAAAAAGAAAACGATCTGG - Intronic
964488436 3:157209398-157209420 AAAAAAAAGAGTCAACGGCCAGG - Intergenic
966507094 3:180717162-180717184 AAAAAAAAAAGTAAACCGTCTGG + Intronic
967027595 3:185578351-185578373 CAAAAAAAAAAAAAAAGGTCGGG - Intergenic
967418262 3:189243533-189243555 AAAAAAAAAAGCCAATTTTCAGG - Intronic
968016156 3:195335880-195335902 AAAAAAAAAAGCCAACGAAGTGG - Intronic
968206674 3:196808566-196808588 AAAAAAAAAAGCGAACCGGCCGG + Intronic
968646000 4:1740798-1740820 GAAAAGAAAAGCAAACGTTCAGG - Intronic
969393291 4:6905109-6905131 CAAAAAAATAGCCAACGTGGTGG - Intergenic
969630646 4:8333916-8333938 CCAAAAGAAAGCCAATGGGCAGG + Intergenic
970017212 4:11525581-11525603 CAAAAGAAAAGCCGATGTTCTGG + Intergenic
970944796 4:21678374-21678396 CAAAAAAACAGCCAATAGACTGG + Intronic
972014808 4:34230666-34230688 CAAAAAAAAAGTTAAAGCTCAGG - Intergenic
976953963 4:90870803-90870825 AAAAAAAAAAGCCAAGGACCTGG - Intronic
978298167 4:107233416-107233438 AAAAAAAAAAGCCAAAGATTTGG + Intronic
978834646 4:113134269-113134291 AAAAAAAAAAGACAACTTTCAGG - Intronic
979667049 4:123323744-123323766 CAAAAAAAAAGACATTGGTGAGG + Intergenic
981529073 4:145734612-145734634 CAAATAAAAATCACACGGTCAGG - Intronic
982717313 4:158822468-158822490 CAAAACAAAACAAAACGGTCAGG - Intronic
983306565 4:165997323-165997345 CATAAAAAAAGACAACAGTGTGG + Intronic
984560767 4:181266673-181266695 CAGAAAAAAAGCCAAAGGAGAGG - Intergenic
986573285 5:9187709-9187731 CAAAAGAAAAGCCAAAAATCAGG + Intronic
988592534 5:32561518-32561540 AAAAAAAAAGGCCACCGGCCAGG - Intronic
988788773 5:34588243-34588265 AAAAAAATAAGCCAATGGACAGG - Intergenic
988826561 5:34941860-34941882 CAAAAAAAAACACAAGGGCCAGG - Intronic
988985760 5:36617170-36617192 CAAAAAAAAAGAAAGCGGTTTGG + Intronic
989764152 5:45059605-45059627 TAAAAAAGAAGACAAGGGTCAGG + Intergenic
990215971 5:53532178-53532200 AAAAAAAAAAACCAAGGGTCAGG + Intergenic
990444046 5:55876889-55876911 GAAAAAAAAATCCAACTGGCTGG - Intronic
990994620 5:61719310-61719332 CAAAACAAAAGGCCACTGTCTGG - Intronic
992518828 5:77525814-77525836 CAAAAAAATAGCCCAAGGCCCGG + Intronic
992831048 5:80593840-80593862 AAAAAAAAAAGTCAATGGGCTGG + Intergenic
992843346 5:80718484-80718506 AAAAAAAAAAACCAAAGGTGAGG - Intronic
993541492 5:89158350-89158372 GAAAAAAAAAGCCAACAGAGTGG - Intergenic
994090525 5:95806001-95806023 AAAAAAAAAAGCCAAAAGCCGGG - Intronic
994642964 5:102433417-102433439 GAAAAAAAAATCCAAAGGACAGG - Intronic
994910720 5:105902347-105902369 GAAAAAAAAAAAAAACGGTCTGG - Intergenic
995040112 5:107577938-107577960 GGAAAAAAATGCCAACTGTCAGG - Intronic
995242234 5:109898552-109898574 CAGAAAATAAGCCAACGGAATGG - Intergenic
995985862 5:118172907-118172929 AAAAAAAAAAGCCAACAGAATGG - Intergenic
996560804 5:124827074-124827096 CAAAAAAAAAGAGAAAAGTCTGG - Intergenic
997935275 5:138105167-138105189 AAAAAAAAAAAGCAACGGTCAGG + Intergenic
997935322 5:138105472-138105494 AAAAAAAAAAAGCAACGGTCAGG + Intergenic
1000230464 5:159310840-159310862 CAAAAATAAAGCCAGCATTCTGG - Intergenic
1000903265 5:166933781-166933803 CAAACAAAAAGCCAAAGATGAGG + Intergenic
1001698748 5:173691557-173691579 AAAAAAAAAACCCAAAGGCCAGG + Intergenic
1002721647 5:181265037-181265059 AAAAAAAAAAGCCAAGGGGAAGG + Intergenic
1003049003 6:2763849-2763871 AAAAAAAAAAGCTCACGGTCGGG + Intergenic
1005036351 6:21558632-21558654 AAAAAAAAAAGACAACTTTCGGG - Intergenic
1005637244 6:27764195-27764217 CAAAGAAAAAACCCAAGGTCTGG + Intergenic
1006837025 6:37005291-37005313 CAAGAAACCAGCCAAGGGTCTGG + Intergenic
1007057890 6:38906056-38906078 AAAAAAAAAAGCCAAGTGTGTGG - Intronic
1007680892 6:43632650-43632672 AAAAAAAAAAGACAAGTGTCAGG - Intronic
1008916495 6:56793090-56793112 AAAAAAAAAAGCAAAAGGTTAGG + Intronic
1008984425 6:57525375-57525397 CACAAAAAAAGTCAAAGGCCTGG - Intronic
1009172476 6:60418274-60418296 CACAAAAAAAGTCAAAGGCCTGG - Intergenic
1009212336 6:60876991-60877013 CAAAAAAAATGCTAACAATCGGG - Intergenic
1010049830 6:71489822-71489844 GAAAAAAAAAGCCAGAGCTCAGG - Intergenic
1010049832 6:71489859-71489881 AAAAAAAAAAGCCAGAGCTCAGG - Intergenic
1010889775 6:81292410-81292432 GAAAAAAAAATCCAAGGTTCAGG - Intergenic
1015167099 6:130210597-130210619 CAAAAAAAAAAAAAAAGGTCAGG + Intronic
1015852770 6:137591151-137591173 CAAAACAAAACCCAACCATCTGG + Intergenic
1017109332 6:150917547-150917569 CAAAAAAAAATCTAAAGGTTAGG + Intronic
1017825877 6:158081593-158081615 AAAAAAAAAAGGCACAGGTCAGG - Intronic
1017869945 6:158478790-158478812 TAAAAAAAAATCCAAAGCTCAGG - Intronic
1018031143 6:159843031-159843053 CAAAAAAAAAAAAAAAGGTCAGG - Intergenic
1018969452 6:168516381-168516403 AAAAAAAAAAGCCAAATGCCAGG + Intronic
1020035772 7:4962195-4962217 AAAAAAAAAAGACAAGGGCCAGG + Intergenic
1021100173 7:16579124-16579146 CACAAAAAATGGCAACTGTCTGG + Intronic
1021789107 7:24182709-24182731 CAAAAATAAAGCCATCAGACTGG + Intergenic
1022459057 7:30586864-30586886 AAAAAAAAAAGCCAAAAGTTTGG + Intergenic
1023438639 7:40164113-40164135 AAAAAAAAAAGTCAAGGGTCAGG - Intronic
1024887504 7:54161157-54161179 ACAAAAAAAAGCCAAAGGTGAGG + Intergenic
1024957867 7:54944388-54944410 CAAAAAAAAAGCATTCTGTCAGG - Intergenic
1025152929 7:56574561-56574583 AAAAAAAAAAGTCAAAGGTCTGG + Intergenic
1025953975 7:66168623-66168645 AAAAAAAAAAGGCAAGGGTGGGG - Intergenic
1025958067 7:66197836-66197858 AAAAAAAAAAAACAAAGGTCAGG - Intergenic
1026569067 7:71513680-71513702 AAAAAAAATAGCCAAGGGGCCGG - Intronic
1027253596 7:76415364-76415386 CAAAAAAAAAAAAAAAGGTCTGG + Intronic
1027500971 7:78950957-78950979 AAAAAAAAAAGCTAACGTTAGGG - Intronic
1027635169 7:80662573-80662595 AAAAAAAAAAGCCATAAGTCTGG - Intronic
1028881825 7:95888635-95888657 CAAAAAAATTGCCAAAGGCCTGG + Intronic
1029130641 7:98328008-98328030 CAAAAAAAAAAACAATGTTCGGG - Intronic
1029349231 7:100001250-100001272 AAAAAAAAAAGCTCAAGGTCTGG - Intergenic
1029707696 7:102284500-102284522 AAAAAAAAAAACCACCTGTCGGG + Intergenic
1030194920 7:106843970-106843992 AAAAAAAAAAGGAAACTGTCGGG + Intergenic
1030589268 7:111460686-111460708 CAAAAAAAAAGATTACAGTCAGG + Intronic
1031082385 7:117271338-117271360 GAAAAAAAAAACCAACAGTGTGG - Intergenic
1032147220 7:129394992-129395014 AAAAAAAAAAACCCACTGTCAGG - Intronic
1032163823 7:129530352-129530374 AAAAAAAAAAGCCAACGTGGTGG + Intergenic
1033335335 7:140447411-140447433 CAAAAAAAAAAACAACAGGCCGG - Intergenic
1034077345 7:148244856-148244878 TAAAAAAAAAGGCAACAGCCTGG - Intronic
1034518694 7:151602167-151602189 CAAAACAAAAGCCAAAGATCAGG + Intronic
1035434980 7:158852936-158852958 CAAACAAAAAGCCAAGGGCGAGG - Intergenic
1035841565 8:2817443-2817465 CAGAAAAGAAGCCATCGATCAGG + Intergenic
1037984162 8:23276387-23276409 AAAAAAAAAAATCAAAGGTCGGG + Intronic
1038765692 8:30425694-30425716 AAGAAAAAAAGCCACCGGGCCGG - Intronic
1038769018 8:30458951-30458973 AAAAAAAAAAGCCAACATGCTGG - Intronic
1041162668 8:55061034-55061056 AAAAAAAAAAGCCCATGGTGCGG + Intergenic
1042066223 8:64880120-64880142 AAAAAAAAAAGCCAAAAGGCGGG + Intergenic
1042516135 8:69661549-69661571 AAAAAAGAAAGCAAAGGGTCAGG + Intergenic
1044018354 8:87074107-87074129 AAAAAAAAAAGGCAGCAGTCTGG + Intronic
1046389662 8:113553710-113553732 AAAAAAAAAAGCCAATGCTGTGG + Intergenic
1047208334 8:122820854-122820876 CCAAATCAAAGCCAACGGCCAGG + Intronic
1048699284 8:137069724-137069746 CAAAAAAAGAGCCACCAGGCTGG - Intergenic
1051181847 9:14419678-14419700 CAAAAGAAAAGCCAACAGGGAGG - Intergenic
1051742395 9:20264373-20264395 CCACCAAAAAGCCAAAGGTCAGG + Intergenic
1051817135 9:21121395-21121417 CAAAGAAAAAGCCTAAGTTCAGG - Intergenic
1051817250 9:21122204-21122226 CAAAGAAAAAGCCTAAGTTCGGG - Intergenic
1053126920 9:35589243-35589265 CAAAAAACAATCCCAGGGTCGGG + Intergenic
1055422920 9:76162619-76162641 CTGAAAAAAAGACAAGGGTCTGG - Intronic
1055747695 9:79468254-79468276 AAAAAAAAAAGACACTGGTCAGG + Intergenic
1057394892 9:94671026-94671048 CAAAAAATTAGCCAATGGCCGGG + Intergenic
1057595210 9:96410259-96410281 AAAAAAAAAAGCCATAGGCCTGG + Intronic
1057917805 9:99071189-99071211 AAAAAAAAAAGTCAAAGCTCAGG + Intergenic
1058221915 9:102313634-102313656 GAAAAAAAAAGCCAATCTTCTGG + Intergenic
1058679242 9:107426791-107426813 CAAAGAAAAAGAAAACAGTCTGG + Intergenic
1059309029 9:113376035-113376057 AAAAAAAAAAGCCGTGGGTCAGG - Exonic
1059980243 9:119763523-119763545 CAAAGCACAAGCCATCGGTCTGG - Intergenic
1060652413 9:125339999-125340021 CAAAAAACAGGCCAAAGGACAGG - Intronic
1061106161 9:128532025-128532047 AAAAAAAAAAGCCAACCATGTGG - Intronic
1061364331 9:130163606-130163628 AAAAAAAAAAGAAAACGGCCGGG - Intergenic
1185728646 X:2443708-2443730 AAAAAAAAGAGCCAATGGGCCGG + Intronic
1185786495 X:2895669-2895691 AAAAAAAAAAGCCAAGTGTGTGG + Intergenic
1186782703 X:12929328-12929350 CAAGAAAAAAGCAGAGGGTCCGG - Intergenic
1187290102 X:17945168-17945190 CAAACAAAAAGTCATCGGTTAGG + Intergenic
1187328926 X:18317844-18317866 AAAAAAAAAAGAAAAAGGTCTGG + Intronic
1187728706 X:22231218-22231240 CAAAAAAAAAGAAAACTTTCAGG - Intronic
1188795550 X:34459541-34459563 CAAAATAAAAGCCACTGGTTAGG + Intergenic
1190275449 X:48896457-48896479 CAAAAAAAAAAAAAACTGTCTGG + Intronic
1192065626 X:67881579-67881601 CAAACAAAAAGCCAAAGGCGAGG + Intergenic
1193383924 X:80848416-80848438 CAAACAAAAAGCCAAAGGTGAGG + Intergenic
1195565749 X:106337072-106337094 CAAACAAAAAGCCAAAGGTGAGG + Intergenic
1195753048 X:108176382-108176404 AAAAAAAAAAGCCTAGGGCCAGG + Intronic
1196301806 X:114056917-114056939 CAAACAAAAAGCCAAAGGAGAGG - Intergenic
1196335693 X:114530448-114530470 GAGAAAAAAAGTCAAAGGTCTGG + Intergenic
1196653608 X:118194135-118194157 AAAAAAAAAAGACAACTGGCCGG + Intergenic
1199548658 X:149034387-149034409 AAAAAAGAAAGCCAATAGTCAGG + Intergenic