ID: 1165821697

View in Genome Browser
Species Human (GRCh38)
Location 19:38680768-38680790
Sequence AGGAATAAAGAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6142
Summary {0: 1, 1: 4, 2: 60, 3: 699, 4: 5378}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165821697_1165821705 11 Left 1165821697 19:38680768-38680790 CCTTCCTCCTTCTCTTTATTCCT 0: 1
1: 4
2: 60
3: 699
4: 5378
Right 1165821705 19:38680802-38680824 TACTCAGGACCATATAGTGAGGG 0: 1
1: 0
2: 1
3: 8
4: 94
1165821697_1165821700 -4 Left 1165821697 19:38680768-38680790 CCTTCCTCCTTCTCTTTATTCCT 0: 1
1: 4
2: 60
3: 699
4: 5378
Right 1165821700 19:38680787-38680809 TCCTACCATTGTCCTTACTCAGG 0: 1
1: 0
2: 0
3: 5
4: 121
1165821697_1165821704 10 Left 1165821697 19:38680768-38680790 CCTTCCTCCTTCTCTTTATTCCT 0: 1
1: 4
2: 60
3: 699
4: 5378
Right 1165821704 19:38680801-38680823 TTACTCAGGACCATATAGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165821697 Original CRISPR AGGAATAAAGAGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr