ID: 1165823193

View in Genome Browser
Species Human (GRCh38)
Location 19:38690264-38690286
Sequence CGGTGAACAGCAGTGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165823193_1165823199 13 Left 1165823193 19:38690264-38690286 CCATCCTTCACTGCTGTTCACCG 0: 1
1: 0
2: 4
3: 26
4: 269
Right 1165823199 19:38690300-38690322 ACTGTTGACTTCCACCCCTCCGG 0: 2
1: 8
2: 34
3: 98
4: 222
1165823193_1165823202 24 Left 1165823193 19:38690264-38690286 CCATCCTTCACTGCTGTTCACCG 0: 1
1: 0
2: 4
3: 26
4: 269
Right 1165823202 19:38690311-38690333 CCACCCCTCCGGATCCAGCAGGG 0: 17
1: 68
2: 120
3: 148
4: 241
1165823193_1165823200 23 Left 1165823193 19:38690264-38690286 CCATCCTTCACTGCTGTTCACCG 0: 1
1: 0
2: 4
3: 26
4: 269
Right 1165823200 19:38690310-38690332 TCCACCCCTCCGGATCCAGCAGG 0: 17
1: 53
2: 127
3: 140
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165823193 Original CRISPR CGGTGAACAGCAGTGAAGGA TGG (reversed) Intronic
902812784 1:18898442-18898464 CAGGGCCCAGCAGTGAAGGATGG - Intronic
906704883 1:47887724-47887746 CGCTGAAGAGCAGCGAAGAAAGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907602971 1:55788566-55788588 CGGTGAACAGCCGTGGTGGACGG + Intergenic
908714595 1:67055657-67055679 TGGTTAACAGCAGAGAGGGAAGG - Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909094912 1:71274633-71274655 TGGAGTACAGCAATGAAGGAGGG - Intergenic
909442210 1:75710080-75710102 CTGGGAACAGGAATGAAGGAAGG + Intergenic
910697714 1:90038788-90038810 TGGGGAACAGCAGGTAAGGAAGG - Intergenic
913273161 1:117113697-117113719 CGGTGAAAAGCATGGTAGGAGGG - Intronic
915020514 1:152774976-152774998 CCCTGAACACCAATGAAGGACGG + Intronic
915445125 1:155970200-155970222 CGGAGATCAACACTGAAGGATGG - Intronic
917099553 1:171431621-171431643 AGCGGAACAGCAGAGAAGGAGGG - Intergenic
919274744 1:195399374-195399396 CAGTGTATAGCAGGGAAGGATGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921888249 1:220327799-220327821 TGGTGACAGGCAGTGAAGGAGGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1062927583 10:1328305-1328327 CAGTTAACAGCAGTGGAGGGTGG + Intronic
1065736198 10:28754778-28754800 TGGTGAAGGGCAGGGAAGGAGGG + Intergenic
1067083928 10:43228326-43228348 TGCTGACCACCAGTGAAGGAGGG - Intronic
1067681653 10:48445536-48445558 GGGTGAACAGCAGGGAAGCGGGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072174456 10:92903956-92903978 GGGTTCACAGCAGGGAAGGATGG - Intronic
1075049397 10:119171445-119171467 CTGAGAATAGGAGTGAAGGAGGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077386480 11:2271639-2271661 CGGAGAACAGGAGGGCAGGACGG - Intergenic
1077975220 11:7240968-7240990 CAGTGAACAGCAGTGAGCCAAGG - Intronic
1078240724 11:9529024-9529046 CGCTGAACTACAGTGCAGGAGGG - Intergenic
1079166835 11:18052019-18052041 CAGTGAAATGCAGTGAGGGATGG - Intergenic
1081614331 11:44581663-44581685 CGGTGAACTGCAGTGGATGGTGG + Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085690410 11:78659645-78659667 CAGTGGAGAGCAGTGAAGCAGGG - Intronic
1086450828 11:86915018-86915040 CTGGGAACAGCTGAGAAGGAAGG + Intronic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089692592 11:120196122-120196144 CTTTGCACAGCAGTGAATGATGG + Intergenic
1092142547 12:6193849-6193871 AGGTGAACAGCAGCGAGGCAGGG + Intergenic
1093582401 12:20797771-20797793 AGGTGAAGAGCAGTGAAGATTGG - Intergenic
1093742519 12:22704816-22704838 CGATGAACAGCATAGAGGGATGG - Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1097777029 12:63658896-63658918 GGGTGAAGAGAAATGAAGGAAGG + Intronic
1098071100 12:66675586-66675608 AGGTAAACAGCTGTGAAGGTAGG + Intronic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1106713440 13:32362808-32362830 AGGAGAACAGCAGTGTGGGATGG - Intronic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110660420 13:78054324-78054346 CAGTGACCAGCAGTGACGGAGGG - Intergenic
1111686103 13:91502453-91502475 AGGTGAACAGCACTGGAGGGAGG + Intronic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112431431 13:99354108-99354130 AGGTGCAGAGCAGTGAAGGGGGG - Intronic
1113704265 13:112415801-112415823 AGGTAATCAGCAGTGAAGCAGGG + Intronic
1113709283 13:112453197-112453219 GGGTGCACATCAGTGAGGGAAGG + Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1117061224 14:51965906-51965928 CGGAGCACAAAAGTGAAGGAGGG + Intronic
1117154280 14:52922412-52922434 AGGTGAACTACAGTGAAAGAGGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120723895 14:87916645-87916667 GGGTGAGCTGCAGTGGAGGAAGG + Intronic
1121662434 14:95645558-95645580 TAGTGAACAGGAGTGTAGGATGG + Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1125255620 15:37759651-37759673 CAGGGAACAGCAGTGGATGATGG + Intergenic
1125549234 15:40532495-40532517 TGGTGAACAGCTGTGAAGCAGGG - Intronic
1125550606 15:40541725-40541747 GGGTGAGCAGGAGTGAGGGAGGG - Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126508269 15:49433997-49434019 TGGTGATCAGCACTGAAGGGAGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129996118 15:80007743-80007765 CTGAGAACAGCAGTGTAGCATGG - Intergenic
1130213381 15:81946446-81946468 TGGTGCCCAGCAGTGAAGGGAGG + Intergenic
1131120929 15:89823053-89823075 TGGTGACCAGCAGTGGGGGAGGG + Intergenic
1131481047 15:92782081-92782103 CGCTGGACAGCAGTGAAGTCAGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132016728 15:98324445-98324467 CGGTGAGTAACAGGGAAGGAAGG + Intergenic
1132828314 16:1915805-1915827 CGGTGGAGAGGAGGGAAGGAGGG + Intronic
1134804973 16:17116501-17116523 CCGTGAATAGCAGTAAAGCATGG - Intronic
1139548598 16:67661242-67661264 TGGAGACCAGCAGTGGAGGAAGG - Intronic
1141605293 16:85149770-85149792 CGGAGAACAGCAGGCATGGAGGG - Intergenic
1141757022 16:85998034-85998056 CTGTGATCAGCAGTGATGGCAGG + Intergenic
1142836904 17:2593949-2593971 CGGTGGATGGGAGTGAAGGACGG + Exonic
1143856338 17:9853369-9853391 CAGGGAACAGCTGTGCAGGACGG + Intronic
1145039674 17:19567890-19567912 GTGTGAACAGCACAGAAGGAAGG + Intronic
1146702288 17:34971599-34971621 CTGTGCCAAGCAGTGAAGGAGGG + Intronic
1148819191 17:50350747-50350769 TGGTGAAAAGCAGAGGAGGAGGG + Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1152499618 17:80699073-80699095 TGGAGTACAGCAGTGAAGCAAGG - Intronic
1152623927 17:81379802-81379824 GGGTGAACAGCAGTGGAGGGTGG + Intergenic
1153095414 18:1395860-1395882 CTGTGAACAGCTATGAAGAAAGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154484876 18:14865564-14865586 TGGTGAACAGGAGGGACGGAAGG - Intergenic
1155520986 18:26668895-26668917 CTGTGAACTGCAGTGAAGGCAGG + Intergenic
1156087837 18:33429334-33429356 GGGAGAAAAGCAGAGAAGGAGGG + Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157738440 18:50071206-50071228 GGGTGAATAACAGTGGAGGAAGG - Intronic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158267427 18:55675850-55675872 CGTTGAATAGCAGTGATGAAAGG + Intergenic
1158943240 18:62425580-62425602 GGGAAAACAGCAGGGAAGGAGGG - Intergenic
1159474842 18:68907821-68907843 CGTTAAACAGCAGTAATGGAAGG + Intronic
1160580658 18:79883103-79883125 CGGTGAAAAGCAGCAAAGGGTGG + Intronic
1161784271 19:6313491-6313513 CAGTGAACTGCAGCGAAGGCTGG - Intronic
1162569044 19:11460283-11460305 AGGTGATCAGTAGTGAAGGCTGG - Intronic
1163051195 19:14685396-14685418 AAGTCAACAGCAGAGAAGGAAGG + Intronic
1163633611 19:18428813-18428835 GGGTGAACAGCAGTGACGCCAGG - Intronic
1164903843 19:31950633-31950655 AGGTGAACAGGAGAGAATGAGGG - Intergenic
1165823193 19:38690264-38690286 CGGTGAACAGCAGTGAAGGATGG - Intronic
1165992215 19:39822927-39822949 GGGTGGACAGGAGTGAAGGTGGG + Intergenic
1166039785 19:40194847-40194869 CGGTGAACAGGAATAAATGATGG + Intronic
1167630848 19:50625565-50625587 CTGGGAACAGCAATGAAGTAAGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168346426 19:55652276-55652298 CGGAGAACAACAGGCAAGGAAGG - Intronic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928921638 2:36534021-36534043 GGGTGAAAAGGAGAGAAGGAAGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929553804 2:42911260-42911282 AAGTGAAGAGCAGGGAAGGAAGG + Intergenic
929582116 2:43087973-43087995 GGGTGAGCAGCAGGTAAGGAGGG + Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
930936194 2:56955148-56955170 CTGAGAACAGCAGGGAAGGAGGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932208871 2:69910179-69910201 CGGTGAAGACAAGTAAAGGAGGG - Intronic
932337689 2:70940228-70940250 GGGGGAGCAGCTGTGAAGGAAGG + Exonic
932768858 2:74489383-74489405 GGGAGGACAGCAGTGAAGCAGGG + Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933970550 2:87466564-87466586 GAGAGAACAGCAGAGAAGGATGG - Intergenic
935056823 2:99574902-99574924 CGGTGAAGAGAAGTCAAGGGAGG + Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937284902 2:120744095-120744117 GGCTGAAGATCAGTGAAGGAAGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
942061020 2:172228806-172228828 CTGTGAACAGGAATGAAGAAAGG + Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
944295825 2:198061424-198061446 CGGCCCCCAGCAGTGAAGGAGGG + Intronic
944516852 2:200521102-200521124 CGGTGAACATCAATGAATGGAGG - Intronic
947966645 2:234287749-234287771 CCCTGAACAGCAGGGAAGGTGGG - Intergenic
948569821 2:238910900-238910922 GGGTGAGCAGCAGGGAAGGCTGG - Intergenic
948762101 2:240198664-240198686 CGGTGATGGGCAGTGATGGACGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172122679 20:32608054-32608076 CCGTGGACAGCAGTGAAGGCAGG - Intronic
1172230121 20:33330762-33330784 CTGTAAACAGCAGAGCAGGAGGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173829795 20:46074923-46074945 CGGTGAACAGAAAGGAAGAAAGG - Intronic
1174694043 20:52539478-52539500 AGATGAACAGGAGTGATGGATGG - Intergenic
1174972028 20:55286650-55286672 AGGTGGACAGTAGTGAAGCAGGG + Intergenic
1175080594 20:56417348-56417370 CGGGGAACAGCAGGGGAGAAGGG - Intronic
1175444823 20:59012856-59012878 CGGGGAACAGGAGAGACGGAGGG + Intergenic
1175657449 20:60783766-60783788 CAGGAAACAGCTGTGAAGGAAGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177738119 21:25118775-25118797 CGGGGAACAGCAGTGGTAGAGGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178440850 21:32597121-32597143 CTGGGGACAGCAGGGAAGGATGG - Intronic
1178788360 21:35675298-35675320 CGGTGGCCAGCAGAGATGGAAGG - Intronic
1179242175 21:39602143-39602165 GGGTGAAAAGCAGAGAAGGCAGG - Intronic
1179374784 21:40840863-40840885 AGGTGGACAGGAGTTAAGGAGGG + Intronic
1181468933 22:23126345-23126367 AGGTGAACTGCAGGGGAGGACGG - Intronic
1181519249 22:23436002-23436024 GGGTGCACTGCAGTCAAGGAAGG + Intergenic
1183811956 22:40265259-40265281 CAGGGAACAGCAGTCAAAGATGG + Exonic
1203294260 22_KI270736v1_random:25576-25598 TGGTGAGCATCAGAGAAGGATGG - Intergenic
949185855 3:1190690-1190712 CAGAGAACAGCGGTGAGGGAGGG + Intronic
950158248 3:10739947-10739969 CAGTGAACAGCAGGGAAGGTAGG - Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
956672491 3:71704438-71704460 CTGAGAACAGCTGTGAAGGCAGG + Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
967320744 3:188192395-188192417 CTGTTAACAGCAGGGAAGAAAGG + Intronic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
968743320 4:2342300-2342322 CGTTGAACAGCCATGAGGGATGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969347118 4:6576451-6576473 GGGTGAGCAGCAGGGAAGGAAGG + Intronic
972100349 4:35407659-35407681 GGGTGAACAGAAGTCAAGAATGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974121105 4:57640209-57640231 CAGTGAGCAGCAGTGCGGGATGG + Intergenic
974152037 4:58022478-58022500 CAGTAATCAGCAGTGAAGGGAGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978595495 4:110373227-110373249 GGGAGAGCAGCAGTGAAGGCAGG + Intronic
978644831 4:110917734-110917756 AGGTGCACAGCAGTGAAAGAGGG + Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980889457 4:138798568-138798590 CTGGGAGCAGCAGTGGAGGAGGG + Intergenic
982479360 4:155890734-155890756 CAGGGAATAGCAGAGAAGGAAGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984639499 4:182145262-182145284 AGTTGAAAAGGAGTGAAGGAGGG + Intronic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
994336345 5:98570898-98570920 CAGTGCACAGCTGGGAAGGAAGG - Intergenic
994342154 5:98642941-98642963 GGGTGATCAGCAATGATGGAGGG + Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997674152 5:135700493-135700515 CCGAGGACAGCAATGAAGGAGGG + Intergenic
1000299170 5:159939830-159939852 CAGTGCACAGGAGAGAAGGAAGG - Intronic
1001189175 5:169610881-169610903 CAGTGGACAGCAGTCAAGTATGG + Intergenic
1002330575 5:178437698-178437720 AGGTGAGCAGCAGGGAAGTAGGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1007231764 6:40353129-40353151 AAGTGCACAGTAGTGAAGGAGGG - Intergenic
1008132932 6:47739140-47739162 TGGTGAGCAGCAGTGATGGTGGG + Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009229363 6:61043668-61043690 TGGTGAACAGCAGTGGGGGTGGG + Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG + Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1012868759 6:104648314-104648336 CGGTCAGCTGCAGTGAATGAAGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1017068189 6:150549330-150549352 CTGTGAACGGCAGTGCAGGCTGG - Intergenic
1018311672 6:162516143-162516165 CAGTCATCAGCTGTGAAGGAGGG - Intronic
1019961318 7:4462260-4462282 CGGTGAACTACAGAGAAAGAAGG + Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021291920 7:18855862-18855884 CGGTGCACAGAAGTAAAAGAAGG - Intronic
1021818131 7:24468098-24468120 TGGTTAACAGAAGTTAAGGATGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022502103 7:30888119-30888141 CGTTGAAAAGCAGTTAAGGCAGG + Intronic
1024113970 7:46174505-46174527 AAGAGAACAGCATTGAAGGAGGG + Intergenic
1024246246 7:47472440-47472462 CAGTGAGTACCAGTGAAGGAGGG - Intronic
1024270161 7:47635851-47635873 AGGAGAAGAGGAGTGAAGGAGGG + Intergenic
1025021569 7:55484450-55484472 GGGTGAGCAGCAGTGCAGGCTGG + Intronic
1026031063 7:66794784-66794806 CAGTGCACAACAGTGAAAGAGGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034234742 7:149557845-149557867 CCGTGAACAGGAGAAAAGGATGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035256762 7:157634022-157634044 TGGGGAACAGCAGTGGAGGCGGG + Intronic
1035957601 8:4099488-4099510 TAGTGAACAGCATTGAAGGCTGG - Intronic
1036222437 8:6931905-6931927 TGCTGATCAGCAGGGAAGGAGGG + Intergenic
1036227839 8:6974813-6974835 TGCTGATCAGCAGAGAAGGAGGG + Intergenic
1036229284 8:6985787-6985809 TGCTGATCAGCAGGGAAGGAGGG + Intergenic
1036230292 8:6993930-6993952 TGCTGATCAGCAGAGAAGGAGGG + Intergenic
1036231736 8:7004891-7004913 TGCTGATCAGCAGGGAAGGAGGG + Intronic
1036232744 8:7013033-7013055 TGCTGATCAGCAGAGAAGGAGGG + Intronic
1036234212 8:7024126-7024148 TGCTGATCAGCAGGGAAGGAGGG + Intergenic
1036236770 8:7045593-7045615 TGCTGATCAGCAGGGAAGGAGGG + Intergenic
1036621874 8:10429594-10429616 AGGAGAACAGCACTGAGGGATGG + Intergenic
1037773448 8:21817090-21817112 ACCTGAACAGCAGTGGAGGAGGG - Intergenic
1038770938 8:30479031-30479053 AGGTGAACAGCAGTGAACAAGGG - Intronic
1038992070 8:32878797-32878819 GGGTGAACTGCAGTGAAGGAGGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040298644 8:46176439-46176461 CGGTGAGAAGCAGTGAATGCTGG + Intergenic
1040362104 8:46675618-46675640 GGGAGAAAAGAAGTGAAGGAAGG - Intergenic
1041144061 8:54853325-54853347 CAGGAAGCAGCAGTGAAGGAAGG + Intergenic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1041218593 8:55626475-55626497 CAGTGGAAAGCAGGGAAGGAGGG + Intergenic
1043493195 8:80770335-80770357 TGGTTACCAGGAGTGAAGGAGGG - Intronic
1044319463 8:90786184-90786206 GGGTGAACGACAGTGAGGGAAGG + Intronic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045244675 8:100432656-100432678 TGGTGAGCAGCAGGCAAGGAGGG - Intergenic
1045534694 8:103016663-103016685 CAGAGAACAGCTGTGCAGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047256613 8:123218045-123218067 AGGCGAGCAGCAGTGAAGGATGG + Intergenic
1047771901 8:128036622-128036644 CTGTGAACTGCAGTGACGGGAGG - Intergenic
1050018754 9:1262213-1262235 TGGTAGACAGCACTGAAGGATGG + Intergenic
1050365786 9:4872683-4872705 AGATGAACAGCTGTGAAAGAAGG + Intronic
1053604690 9:39645285-39645307 AGGTGAACAGCGGTGAAGTAAGG + Intergenic
1054248852 9:62697131-62697153 AGGTGAACAGCGGTGAAGTAAGG - Intergenic
1054562963 9:66731657-66731679 AGGTGAACAGCGGTGAAGTAAGG - Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056466998 9:86867083-86867105 CAGTGATGGGCAGTGAAGGAAGG - Intergenic
1058393658 9:104525015-104525037 AGGTGCACAGAAGTGAAGAATGG - Intergenic
1060663657 9:125419690-125419712 CGGGGAACAGCAGGACAGGAAGG + Intergenic
1186397624 X:9225666-9225688 TGGTTAACAGCAGTTATGGAGGG - Intergenic
1186410661 X:9342430-9342452 GGGTGAAAAGCAGAGAAGGATGG - Intergenic
1187770540 X:22690946-22690968 AGGTCAAGAGCAGTGGAGGATGG - Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188820684 X:34771015-34771037 CAGGGAACAGGAGTGAAAGAAGG - Intergenic
1188879320 X:35472423-35472445 AGGTGATCAGACGTGAAGGATGG - Intergenic
1188912920 X:35872349-35872371 TGGTGAATAGCAGTGAAAGCAGG + Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1190705109 X:53020957-53020979 GGGGGACCAGCAGTGAGGGATGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1193578336 X:83231457-83231479 TGATGAGCATCAGTGAAGGATGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195390732 X:104359423-104359445 CAGTGAACTGCATTGAAGCAGGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196469354 X:116008264-116008286 TGGTGAGCAGGTGTGAAGGAAGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic