ID: 1165824239

View in Genome Browser
Species Human (GRCh38)
Location 19:38696629-38696651
Sequence GAGGAGAGCCTGCACTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165824239_1165824240 -10 Left 1165824239 19:38696629-38696651 CCTTGTGAGTGCAGGCTCTCCTC 0: 1
1: 0
2: 2
3: 15
4: 197
Right 1165824240 19:38696642-38696664 GGCTCTCCTCACCAGAGCTGAGG No data
1165824239_1165824241 -9 Left 1165824239 19:38696629-38696651 CCTTGTGAGTGCAGGCTCTCCTC 0: 1
1: 0
2: 2
3: 15
4: 197
Right 1165824241 19:38696643-38696665 GCTCTCCTCACCAGAGCTGAGGG 0: 1
1: 0
2: 3
3: 20
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165824239 Original CRISPR GAGGAGAGCCTGCACTCACA AGG (reversed) Intronic
900613994 1:3556175-3556197 GAGCAGAGCATGGACTCACAGGG - Intronic
900680255 1:3912511-3912533 GAGGAGAGACTGCACCCTGAAGG + Intergenic
901117882 1:6863336-6863358 GAGAAGGGCCTGAACTCACAGGG - Intronic
902622369 1:17657934-17657956 GAGGTGAGGCTGCCCTGACAAGG + Intronic
902669525 1:17963194-17963216 AAAGAGAGCATGCACTCACCAGG - Intergenic
903889771 1:26561640-26561662 GTGGAGTATCTGCACTCACAGGG + Exonic
904576896 1:31510789-31510811 GAGGAGAGCCAGCAAGAACAGGG - Intergenic
905923514 1:41734119-41734141 GAGCAGAGGCTGCACCCACCAGG + Intronic
911087603 1:93991905-93991927 GAGGGGAGACTGCCCTGACAAGG + Intergenic
914753008 1:150548856-150548878 GGGGAGAGCCTGGACCCACGCGG + Intergenic
915973565 1:160370694-160370716 GAGGGGATCCTGATCTCACAGGG + Exonic
916609286 1:166374468-166374490 GATGTGAGCCTGGACTCACTGGG + Intergenic
921262539 1:213396660-213396682 GAGGAGAGCATGTACAGACAAGG - Intergenic
922615486 1:226958746-226958768 GAGGAGAGCAGGCAGGCACACGG + Intronic
922673415 1:227532473-227532495 GGGGAAAGCCAGCAGTCACAGGG + Intergenic
923212218 1:231813700-231813722 GAGGTGAGACTAAACTCACAAGG - Intronic
923410922 1:233708220-233708242 GAGGAGGGGCTGGACTCAGAGGG - Intergenic
923986558 1:239387861-239387883 GGGGAGAGTCTGCACTCGCGAGG + Intronic
1062895284 10:1098282-1098304 AAAGAGAGCGTGCACACACAAGG - Intronic
1067748299 10:48952990-48953012 AAGGAGAGCCTGAACTGTCAGGG - Intronic
1067944017 10:50679282-50679304 GAGGAACCCCTGCAGTCACAAGG - Intergenic
1070809224 10:79289251-79289273 GAAGAAAGCCTGCATTCCCATGG + Intronic
1070865510 10:79706151-79706173 GAGGAGCCCCTGCAGTCACAAGG - Exonic
1070879304 10:79844282-79844304 GAGGAGCCCCTGCAGTCACAAGG - Exonic
1071632410 10:87228372-87228394 GAGGAGCCCCTGCAGTCACAAGG - Exonic
1071645863 10:87360590-87360612 GAGGAGCCCCTGCAGTCACAAGG - Exonic
1074901380 10:117818932-117818954 GAGGAGAGCAATCACTCCCAGGG + Intergenic
1075893761 10:125977517-125977539 AAGGAGAGCCAGCACTCAAGTGG - Intronic
1080195546 11:29604362-29604384 AAGGAAAGCCTACCCTCACATGG + Intergenic
1081097840 11:38962539-38962561 GAGGATACCCTCCACACACAAGG + Intergenic
1081905790 11:46668833-46668855 CAGGGCAGCCTGCACTCAGATGG + Exonic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1084906957 11:72355887-72355909 GAGGCCAGCCTGTGCTCACAGGG - Intronic
1086541516 11:87917701-87917723 GAAGAGTGCATGGACTCACAGGG - Intergenic
1087193578 11:95282394-95282416 GAGCTCAGCCTGCACTCACTTGG + Intergenic
1087905754 11:103695069-103695091 GCAGAGAGTCTGCACCCACATGG - Intergenic
1089378188 11:118009949-118009971 GAGCAGAGTCTGCACCCTCACGG - Intergenic
1091261392 11:134237610-134237632 GAGGAGAGCCAGGACCCACCAGG + Intronic
1093116324 12:15216039-15216061 GCCTAGACCCTGCACTCACAAGG + Intronic
1100481504 12:94983959-94983981 GAGAAGAGCCTGTCCACACAAGG + Intronic
1102075640 12:110057593-110057615 GGGGAGAGCCAGCACCCCCAAGG + Intronic
1102104222 12:110306850-110306872 GAGGATGGCCTGAACTCACAAGG - Intronic
1103361345 12:120356196-120356218 AAGGAGAGCCTGCTCTCATGGGG - Intronic
1103466813 12:121148691-121148713 GGGGAGAGCCAGCACCCCCAGGG - Intronic
1107764607 13:43720889-43720911 GTGGAGAGCATGCCCTCTCAGGG - Intronic
1110423040 13:75335091-75335113 GAGGGGAGCGAGCATTCACAGGG - Intronic
1112699530 13:101990161-101990183 GAGTAGAGCTAGCAATCACAGGG + Intronic
1112706895 13:102080477-102080499 CAGGAGAGCCAGCAGTCAAAGGG - Intronic
1119666795 14:76490814-76490836 CAGGACAGCCTGCTCTCCCAGGG - Intronic
1120515156 14:85461897-85461919 ATGGAGGGCCTGGACTCACAAGG + Intergenic
1122860535 14:104580469-104580491 GAGAAGGGGCTGCACTCTCAGGG + Intronic
1124218409 15:27828379-27828401 GAGGAGCCCCTGCCCTCAGAGGG - Intronic
1124386211 15:29210049-29210071 CAGGAGAGACTGCCCTCCCAGGG + Intronic
1126646651 15:50881611-50881633 GAGGATTGCTTGAACTCACAAGG + Intergenic
1129256717 15:74337944-74337966 GAGGATGGCCTGCAGCCACATGG - Exonic
1129443373 15:75598735-75598757 CAGGAGAGCCTATACACACAAGG + Intronic
1130149117 15:81297983-81298005 GAGAGGAGCCTCCACCCACAGGG - Intronic
1131070235 15:89461405-89461427 GATGAGAAGGTGCACTCACAGGG - Intergenic
1131224488 15:90612440-90612462 GAGGAGAGCATGCACTAATGGGG + Intronic
1131463978 15:92639787-92639809 AAGGGGAGCAGGCACTCACATGG - Intronic
1132958869 16:2611323-2611345 GAGTAGACCCTGCACGCACTAGG + Intergenic
1135993557 16:27231934-27231956 CAGCAGATCCTGCACTCACCAGG + Intronic
1136448681 16:30339894-30339916 GCGGAGGGCAGGCACTCACAGGG + Intergenic
1141259749 16:82441693-82441715 GAGGAGAGGATTCATTCACATGG + Intergenic
1141952673 16:87348748-87348770 GAGGGCGGCCTGCACTCACCCGG + Intronic
1142047181 16:87932969-87932991 GCGGAGGGCAGGCACTCACAGGG - Intronic
1144103902 17:11969193-11969215 GAGGAAAGACTGGACTGACATGG - Intronic
1145071424 17:19811955-19811977 GAGAAGAGCCTAAACTCACAAGG + Intronic
1146473717 17:33145005-33145027 GAGGAGAGTAAGCACTCACGTGG - Intronic
1146658472 17:34649173-34649195 GGGCAGAGGCTTCACTCACAGGG + Intergenic
1148384276 17:47223054-47223076 AGGGAGAGGCTGCACTCACCTGG - Exonic
1148481415 17:47961853-47961875 CAGGAGTGCCTGCAGTCACCAGG - Intergenic
1150608477 17:66714251-66714273 GAGGGGGGCGTGGACTCACAAGG - Intronic
1150959000 17:69893844-69893866 GAATAGGGCCTTCACTCACAAGG + Intergenic
1152349247 17:79774625-79774647 GTGGAGAGCCTGCTCTCAGGAGG - Intergenic
1152870947 17:82752613-82752635 GCGGAGCGCCTGCTCTCGCACGG + Intronic
1153554725 18:6299757-6299779 GAGGATAGCTTGAACTCAGAAGG - Intronic
1155090437 18:22504097-22504119 GAAGACAGCGTGAACTCACAGGG + Intergenic
1156566711 18:38199631-38199653 GAGGAGTGACTTCACACACAGGG + Intergenic
1158978258 18:62732760-62732782 GAGGAGAACCTCCATTAACATGG + Intronic
1159348372 18:67236871-67236893 GATGAGAGCCTCCATTCACTGGG - Intergenic
1160409883 18:78668059-78668081 GATGAGAGCCTGTCCTTACACGG - Intergenic
1160497419 18:79383565-79383587 GAGGAGAGGCTGCAGCCCCACGG - Intergenic
1161170308 19:2809269-2809291 GAGCACAGCTTGCACACACAGGG + Intronic
1162015663 19:7845282-7845304 GAGGTGAGCCTGGGCTCACCAGG + Intronic
1162443376 19:10707232-10707254 GGGGAAAGCCTGCCGTCACATGG - Intronic
1163532792 19:17860458-17860480 TAGGAGAACCTGGACTCCCATGG + Intronic
1164524978 19:29007029-29007051 GAGGAGAGCTGTCACTCCCAGGG - Intergenic
1165824239 19:38696629-38696651 GAGGAGAGCCTGCACTCACAAGG - Intronic
1165902330 19:39174647-39174669 GAAGAGAGCGTTCAATCACAGGG - Intronic
1168247575 19:55120925-55120947 GAGGAGGGCCTGCAGTTCCAAGG + Intergenic
925519759 2:4730400-4730422 GACAAGAGCCTCCACTCTCAAGG - Intergenic
927680573 2:25136462-25136484 GAGGCCAGCCTGAGCTCACACGG - Intronic
927849016 2:26487319-26487341 CAGGAGAGCCTGAAGTCACATGG - Intronic
928233834 2:29522909-29522931 GGGGAGAGCCTGCACTCAGAGGG + Intronic
928446731 2:31339592-31339614 GAGGGGAGCCTGCACACCCGTGG - Exonic
928956383 2:36873468-36873490 GAGGAGAGCCTGAGCCCAGAAGG + Intronic
930032943 2:47069443-47069465 GAGAAGAGCCCAGACTCACAAGG - Intronic
933992274 2:87642389-87642411 GAGGGGAGCCAGCCTTCACAGGG + Intergenic
935040332 2:99420274-99420296 GGGGAGAGACTGCCCTCCCAGGG + Intronic
936301576 2:111308450-111308472 GAGGGGAGCCAGCCTTCACAGGG - Intergenic
938364129 2:130720575-130720597 GAGGAGAGCCTACGCACACTAGG + Intergenic
941224077 2:162823106-162823128 GAAGACAGTCTGCACTCAGATGG + Intronic
943818768 2:192291661-192291683 TAGGAGAGGCTGCATTCAAAAGG - Intergenic
947437516 2:230085250-230085272 GAGGAGAGGCTGCACTCTAAGGG - Intergenic
947990907 2:234486820-234486842 GTGGAGAGGCTTCTCTCACATGG + Intergenic
948664967 2:239529002-239529024 GAGAGGCACCTGCACTCACATGG - Intergenic
948885130 2:240878522-240878544 GAGGAGAGCCTGCCCTGGCCTGG + Intronic
948915130 2:241030568-241030590 GACAAGTGCCTGGACTCACAGGG - Exonic
1168771160 20:417801-417823 CAGGAGACCCTGCACTCCCATGG + Exonic
1169029287 20:2395486-2395508 GAGGAGAGCCTGCCCTTGGAGGG + Intronic
1171722995 20:28583938-28583960 TAGGAGAGCCTGCAATTAAATGG + Intergenic
1171755088 20:29099519-29099541 TAGGAGAGCCTGCAATTAAATGG - Intergenic
1172292878 20:33788823-33788845 AGGGAGAGCCAGCACTCACCAGG - Intronic
1173347943 20:42218032-42218054 GAGGAGAGCATGCTCTCAGCAGG - Intronic
1175414897 20:58794771-58794793 GAGGAGAGTCTACACTTCCAGGG + Intergenic
1176135828 20:63521586-63521608 GGGGCGATCCTGCACTCACCTGG - Exonic
1176206946 20:63894468-63894490 GCGGAGCGCCTGCAGTTACAGGG + Intergenic
1176256923 20:64157861-64157883 GAGAAGAGGCAGAACTCACAGGG + Intronic
1176386524 21:6140854-6140876 TAGGAGAATCTGCACTCACCTGG - Intergenic
1176411149 21:6450260-6450282 CAGGACAGCCTGCACACAAAGGG + Intergenic
1178884705 21:36476069-36476091 AAAGAGAGCCTGCACTCAGCAGG - Intronic
1179686642 21:43058582-43058604 CAGGACAGCCTGCACACAAAGGG + Intronic
1179736949 21:43397398-43397420 TAGGAGAATCTGCACTCACCTGG + Intergenic
1180052426 21:45337399-45337421 CAGGGGAGCCTGTGCTCACAGGG + Intergenic
1182034812 22:27189562-27189584 GAGCAGAGCCAGACCTCACAGGG + Intergenic
1184283345 22:43451751-43451773 GAGCAGTGCCTGGACTCACCCGG - Intronic
1184774137 22:46615095-46615117 CAGGGGAACCTGCACACACAGGG - Intronic
1184774145 22:46615129-46615151 CAGGAGAGCCTACACACACAGGG - Intronic
1184774199 22:46615351-46615373 CAGGGGAACCTGCACACACAGGG - Intronic
1184774207 22:46615385-46615407 CAGGAGAGCCTACACACACAGGG - Intronic
1184774236 22:46615505-46615527 CAGGGGAACCTGCACACACAGGG - Intronic
1184774396 22:46616114-46616136 CAGGGGAACCTGCACGCACAGGG - Intronic
1184774507 22:46616576-46616598 CAGGGGAACCTGCACGCACAGGG - Intronic
1184774551 22:46616766-46616788 CAGGGGAACCTGCACGCACAGGG - Intronic
949530547 3:4951114-4951136 GAGGAGAGACTGCACGGAGAGGG - Intergenic
950229054 3:11260040-11260062 GAGCAGGGCCTGAACACACATGG + Exonic
950479581 3:13236207-13236229 GATCAGAGCCTGCACTCAGGTGG + Intergenic
951169901 3:19529030-19529052 GAGAAGAGCCCGCAGTCAGAAGG + Intronic
952591976 3:34966722-34966744 GAGGAAAACCTCAACTCACAAGG - Intergenic
956214012 3:66829575-66829597 TAGCAGAGCCTGAATTCACACGG - Intergenic
956688519 3:71854889-71854911 GAGAAGAGGCTGGAGTCACAGGG + Intergenic
956857173 3:73286684-73286706 GAGGGGATGCTGGACTCACAGGG - Intergenic
959335047 3:105053526-105053548 GAGGATAGCTTGAACTCAGAAGG + Intergenic
960338277 3:116445090-116445112 GAGGAGAGGCTTCACCAACACGG + Exonic
963667860 3:148212479-148212501 GTGGAGAGTCTCCATTCACAGGG + Intergenic
963902291 3:150744214-150744236 GATGACAGCCTCCACTCTCAGGG + Intronic
964632025 3:158821211-158821233 AAGGACAGCCTGAACTCAAAGGG - Intronic
966686917 3:182705430-182705452 AAGGAGAGACTGCCCTCCCAGGG - Intergenic
967795390 3:193593406-193593428 GATTAGAGCCTGCACTTACCAGG - Exonic
968923484 4:3534770-3534792 GAGGAGAGCATGCCGTCACCTGG - Intergenic
969369919 4:6724975-6724997 AAGGAAAGCCTGCACAGACAGGG + Intergenic
973741989 4:53927295-53927317 GAGGAGGGTCTGGACTCCCAGGG + Intronic
975688793 4:76945978-76946000 GAGAATAGCTTGAACTCACAAGG - Intergenic
976717447 4:88137723-88137745 GTGGACAGCCTGCACTCACACGG + Intronic
979561624 4:122108180-122108202 GGGGAAAGCCGGCAGTCACAGGG - Intergenic
982162607 4:152585106-152585128 GAGGAGAGCCGACACTGAGAAGG + Intergenic
984022368 4:174501363-174501385 AAGCAGAGACTGCTCTCACATGG - Intronic
984549068 4:181139328-181139350 CAGGGGAGCTTGGACTCACAGGG - Intergenic
985092873 4:186381832-186381854 GGGGAAAGCCGGCAGTCACAGGG - Intergenic
985217782 4:187672015-187672037 GGGGAAAGCCGGCAGTCACAGGG + Intergenic
985438526 4:189959832-189959854 TAGGAGAGCCTGCAATTAAATGG - Intronic
986004607 5:3657501-3657523 GAGGGGAGGGAGCACTCACAGGG + Intergenic
987640110 5:20601681-20601703 GGGGAAAGCCGGCAGTCACAGGG - Intergenic
991441164 5:66650955-66650977 GAGGAGGAACTGCAGTCACATGG + Intronic
998095537 5:139393940-139393962 GAGGGGATCCTACACTCAAAAGG + Exonic
1003143167 6:3488395-3488417 GCAGAGTGCCTGCACACACAGGG - Intergenic
1003257658 6:4488409-4488431 GAGGAGAGCATGGCCCCACATGG + Intergenic
1009358832 6:62789107-62789129 TAGGAGAGCAGGCACTTACAGGG + Intergenic
1010128631 6:72465203-72465225 GAGGAGAGCCTGCATTCTCGTGG - Intergenic
1010575515 6:77525361-77525383 GAGGAGGCCCTGCAAACACAAGG + Intergenic
1010657629 6:78530453-78530475 GAGGACACCCAGCACTGACAGGG + Intergenic
1016135147 6:140532077-140532099 GAGGTGATCCTGCACTCCCCTGG - Intergenic
1017798541 6:157870373-157870395 GAGGGGTACATGCACTCACACGG - Intronic
1019415126 7:923585-923607 GAGGGGAGGCTGCACCCGCAGGG - Intronic
1020042472 7:5014503-5014525 TAGGGGAGACTGTACTCACAGGG - Intronic
1023987183 7:45103522-45103544 GAGGAGAGCCTGCATGGCCAGGG + Intronic
1024246191 7:47472133-47472155 GAGGAGAGGATGCAGACACAGGG - Intronic
1026511704 7:71032937-71032959 TGGGAGAACCTTCACTCACAAGG - Intergenic
1029521707 7:101066952-101066974 GATGAGAGGCAGGACTCACAGGG + Intergenic
1032067492 7:128782671-128782693 GAGGTGATACTGCTCTCACAAGG + Intergenic
1032407672 7:131668424-131668446 GTGGAGTGGCTGCACTGACATGG - Intergenic
1033128713 7:138726987-138727009 CAGGAGAGCCTGCAGTAACCTGG + Intronic
1034666173 7:152820228-152820250 GAGAGCAGCCTGGACTCACAAGG - Intronic
1042815602 8:72874977-72874999 GAGGTGAGCCTGCCATCAGAGGG - Intronic
1044406256 8:91829966-91829988 CAGAAGAGCCTGCAATGACATGG - Intergenic
1045048957 8:98305630-98305652 ATGGAGTGCCTGCACTCACGTGG + Intergenic
1048016551 8:130502150-130502172 GAGGAAGACCTGCACTCACTGGG - Intergenic
1049271093 8:141696688-141696710 GAGGTGAGCCTTGAGTCACAAGG + Intergenic
1051029563 9:12658245-12658267 CAGGAGAGCAAGGACTCACAGGG - Intergenic
1051620436 9:19044968-19044990 GAGCAGAGACTGCACTAAAAAGG + Intronic
1053470192 9:38340716-38340738 GGCGAGAGCCTGGCCTCACAGGG - Intergenic
1053747541 9:41215166-41215188 TAGGAGAGCCTGCAATTAAATGG - Intergenic
1053799194 9:41753794-41753816 GAGGAGAGCATGCCGTCACCTGG - Intergenic
1054146018 9:61561205-61561227 GAGGAGAGCATGCCGTCACCTGG + Intergenic
1054187608 9:61965853-61965875 GAGGAGAGCATGCCGTCACCTGG - Intergenic
1054465752 9:65492283-65492305 GAGGAGAGCATGCCATCACCTGG + Intergenic
1054479744 9:65650202-65650224 TAGGAGAGCCTGCAATTAAATGG + Intergenic
1054650909 9:67622728-67622750 GAGGAGAGCATGCCATCACCTGG + Intergenic
1055204309 9:73708939-73708961 GAGCAGAGCCAGCTCCCACAGGG - Intergenic
1057257910 9:93566441-93566463 GAGAAGAGCCTTCAGTCAAAAGG - Intergenic
1059543183 9:115150993-115151015 GAGGAGAGCCAGCATTTCCAGGG - Intronic
1059617768 9:115969246-115969268 AAGGAGAGCAGGCAGTCACATGG + Intergenic
1060789501 9:126476375-126476397 GAGGAGGGCCTGCAGACAAACGG + Intronic
1061664922 9:132155050-132155072 GAGGAAAGGCTGCAATCAGAAGG - Intergenic
1061809865 9:133155962-133155984 GAGGAGAGCCACCACCCTCACGG + Intronic
1062382404 9:136292805-136292827 CAGCAGAGCCAGCAGTCACACGG + Intronic
1062448528 9:136605906-136605928 GATCAGAGCCTGCACACACTAGG - Intergenic
1202783673 9_KI270718v1_random:25937-25959 TAGGAGAGCCTGCAATTAAATGG - Intergenic
1186343212 X:8664704-8664726 GAGGAGAGCCTGCTGACACAAGG + Intronic
1186441615 X:9591794-9591816 GAGGACAGCATGAACTCATAGGG + Intronic
1186522950 X:10221813-10221835 GAGGGGAGCCTGAACTCAAGGGG + Intronic
1186683311 X:11898310-11898332 GAGGAAAGCAGGCACTCACTTGG + Intergenic
1195681178 X:107547724-107547746 TAGGAGAGCCTGGAGTCACTTGG - Intronic
1196943596 X:120801830-120801852 GAGGAGAGGCAGCACAGACAGGG + Intergenic