ID: 1165824353

View in Genome Browser
Species Human (GRCh38)
Location 19:38697285-38697307
Sequence TTTCCCTGCATACCAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165824346_1165824353 3 Left 1165824346 19:38697259-38697281 CCGCAGAGGGTCTCCTGCCATCC No data
Right 1165824353 19:38697285-38697307 TTTCCCTGCATACCAGTGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 133
1165824347_1165824353 -10 Left 1165824347 19:38697272-38697294 CCTGCCATCCCATTTTCCCTGCA 0: 1
1: 0
2: 1
3: 32
4: 406
Right 1165824353 19:38697285-38697307 TTTCCCTGCATACCAGTGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 133
1165824342_1165824353 25 Left 1165824342 19:38697237-38697259 CCACAGGGTGGGGTGGGGCCATC 0: 1
1: 0
2: 2
3: 32
4: 307
Right 1165824353 19:38697285-38697307 TTTCCCTGCATACCAGTGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 133
1165824345_1165824353 7 Left 1165824345 19:38697255-38697277 CCATCCGCAGAGGGTCTCCTGCC 0: 1
1: 0
2: 2
3: 13
4: 214
Right 1165824353 19:38697285-38697307 TTTCCCTGCATACCAGTGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 133
1165824341_1165824353 28 Left 1165824341 19:38697234-38697256 CCTCCACAGGGTGGGGTGGGGCC 0: 1
1: 0
2: 6
3: 49
4: 335
Right 1165824353 19:38697285-38697307 TTTCCCTGCATACCAGTGGGTGG 0: 1
1: 0
2: 0
3: 16
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165824353 Original CRISPR TTTCCCTGCATACCAGTGGG TGG Intronic
900766166 1:4507179-4507201 TTCCTCTGCATGCCAGTGAGGGG - Intergenic
902257049 1:15196461-15196483 TTTACCAGCATACCACTGTGAGG + Intronic
905435839 1:37954621-37954643 TGTCCCAGCATCCCACTGGGAGG + Intergenic
905900521 1:41579144-41579166 TATCCCTCCTTACCAGTGGATGG - Intronic
906553674 1:46689364-46689386 TTTCCCTGCATGTCAGTCAGTGG - Intronic
906720838 1:48003323-48003345 CTTCCATGCATGCGAGTGGGTGG - Intergenic
906836340 1:49086546-49086568 CTTGCCTGGATACCAGTGGCAGG - Intronic
908469549 1:64430414-64430436 TTTCTATGCATACCAGTGTCAGG + Intergenic
910696433 1:90022899-90022921 TTTCCCTGCATAAAAGTTGGAGG + Intronic
918603328 1:186390470-186390492 TTTTTCTGCCTACCATTGGGAGG + Intronic
921945170 1:220881200-220881222 CTTCCCTGCTAACCGGTGGGCGG + Exonic
1065862027 10:29879850-29879872 TTTCCCTGCATTCGACAGGGTGG - Intergenic
1067268317 10:44766895-44766917 GTGCCCTGCAGACCAGTGGGAGG - Intergenic
1069842807 10:71350423-71350445 TTTTCCTGCTAACCAGTGGGAGG - Intronic
1070380247 10:75874839-75874861 TTTCCATTCATTCCAGTGAGTGG - Intronic
1074945651 10:118278354-118278376 TCTCTCTGCATACCTGTGGGTGG - Intergenic
1075244776 10:120811158-120811180 TTACTCTGCATAGCAGTGTGTGG - Intergenic
1076229595 10:128808998-128809020 TGTCCCAGCAGACCAGTGGGTGG - Intergenic
1076329681 10:129655112-129655134 TTTCCATGCATACCTCCGGGTGG - Intronic
1078559205 11:12356258-12356280 TTTCCTTGCTAATCAGTGGGAGG - Intronic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1091596953 12:1884740-1884762 TCTCCCTGGACACCCGTGGGAGG + Intronic
1093551994 12:20423777-20423799 TGTCCCTGCATACCACCAGGAGG - Intronic
1095693088 12:45112973-45112995 TTTTGAGGCATACCAGTGGGTGG - Intergenic
1097787637 12:63779373-63779395 TTTCTATGCATACAAGTGAGTGG + Intergenic
1103483030 12:121263723-121263745 TCTCCCTGGAAACCAGTGGCGGG + Intronic
1103904793 12:124321716-124321738 TGTCCCTGCTTACCAGTAGCTGG + Intergenic
1104077893 12:125406705-125406727 CTTCCCAGCTTTCCAGTGGGTGG - Intronic
1104550301 12:129750657-129750679 TTTCACTCCCTACCAGAGGGTGG + Intronic
1106128243 13:26918969-26918991 GTTCCCTGCAGATCTGTGGGAGG - Intergenic
1107021398 13:35756147-35756169 AGTCTCTGCATCCCAGTGGGGGG - Intergenic
1109130942 13:58584934-58584956 TTTCCCTGCCTCCCAGGGCGTGG + Intergenic
1109980354 13:69898462-69898484 TTTCCCTGCATCCTAGTGCCAGG - Intronic
1113385852 13:109847054-109847076 TTTTCCTGCACACCCATGGGAGG - Intergenic
1113870697 13:113558155-113558177 TTTCCCTGGTTCCCAGTGGGCGG + Intergenic
1118907390 14:70032654-70032676 ATTCCCTACATTCCAGTGAGAGG - Intergenic
1122464721 14:101923609-101923631 TTTCCCTGGAAACCAGCGTGAGG - Intronic
1126780644 15:52136397-52136419 TTGGCCTGCACAGCAGTGGGAGG - Intronic
1130014221 15:80174839-80174861 TGTCCCTGGATAGCAGTAGGGGG - Intronic
1130641134 15:85676501-85676523 TCTCCCTGCTCACCTGTGGGTGG - Intronic
1132236889 15:100228834-100228856 TCTCCCTGCCTACCTGTGGGAGG + Intronic
1132629232 16:908823-908845 TGTCACTGCATACCTGTGGATGG - Intronic
1134126310 16:11618619-11618641 TGTCCCCGCCTCCCAGTGGGTGG + Intronic
1136872706 16:33823287-33823309 TTTTCTTGCATTCCCGTGGGAGG - Intergenic
1137688795 16:50405598-50405620 ATCCCTTGCAGACCAGTGGGAGG + Intergenic
1138970511 16:62137116-62137138 GTTCCATGCATGCCAGTGTGGGG - Intergenic
1141592468 16:85077805-85077827 CATCCCTGCATGTCAGTGGGGGG - Intronic
1141610122 16:85176573-85176595 TCTCCCTGCAAGCCAGTTGGCGG + Intronic
1203099467 16_KI270728v1_random:1292767-1292789 TTTTCTTGCATTCCCGTGGGAGG + Intergenic
1143621988 17:8086052-8086074 CTTCCCCGCCTACCAGTGGATGG - Exonic
1146787972 17:35734849-35734871 TTTTCCTGCATTCCAGTAGTAGG - Intronic
1146866218 17:36337177-36337199 TTCCCCTGGCTTCCAGTGGGTGG - Intronic
1147080614 17:38017326-38017348 TTCCCCTGGCTTCCAGTGGGTGG - Intronic
1148736135 17:49865916-49865938 TTCCCCTGCATTCCTGGGGGAGG + Intergenic
1149845254 17:60005683-60005705 TTCCCCTGGCTTCCAGTGGGTGG + Intergenic
1152347887 17:79764915-79764937 TTTACCTGCTTACCAATGGAAGG + Intergenic
1152887158 17:82859205-82859227 TTTCCCTGAAAGCCAGTGCGGGG - Intronic
1152887197 17:82859413-82859435 TTTCCCTGAAAGCCAGTGCGGGG - Intronic
1153972307 18:10237809-10237831 ATTCCCTGCAGACCAGGAGGCGG + Intergenic
1156092224 18:33486001-33486023 TTCCCCTTCAAACCAATGGGTGG - Intergenic
1158683302 18:59588997-59589019 TTTCCCAGCATCCCAGAGGGAGG + Intronic
1162038639 19:7956062-7956084 TCTCCCTGCTGCCCAGTGGGTGG + Intergenic
1165824353 19:38697285-38697307 TTTCCCTGCATACCAGTGGGTGG + Intronic
926627156 2:15101793-15101815 TTTTCCTGCATTCTAGAGGGTGG + Intergenic
927154049 2:20211740-20211762 TTTCCAGGGGTACCAGTGGGAGG + Intronic
929202440 2:39251083-39251105 TTTCACTGAATACCAGTGTCTGG - Intronic
929905791 2:46045545-46045567 TATCCCTTGATACCAGAGGGAGG - Intronic
932317525 2:70795858-70795880 TTTCCCTCCATGCCTGTGGGCGG + Intergenic
933793959 2:85905464-85905486 TTTCCTTGCATTCCAGTGTGAGG + Intergenic
936525811 2:113241034-113241056 TTTCCATGCAGAGAAGTGGGAGG + Intronic
938098069 2:128476039-128476061 TTTCCCTGCCTACCAGGGCCTGG + Intergenic
942802706 2:179893748-179893770 TTTCTCTGCATAAATGTGGGAGG + Intergenic
945148727 2:206765465-206765487 TTTCCCTGCATACAGGAGTGGGG - Exonic
947520608 2:230843309-230843331 TTTCCCAGCATAAAACTGGGCGG - Intergenic
948489541 2:238303675-238303697 GCTCCCTGCAGACCTGTGGGCGG + Intergenic
948631144 2:239303363-239303385 TTTCCCTTCACACCAGACGGCGG - Intronic
1170671885 20:18441708-18441730 TTTCATTGGATCCCAGTGGGCGG - Intronic
1171774118 20:29349936-29349958 CTCACCTGCATTCCAGTGGGTGG - Intergenic
1175156828 20:56976916-56976938 TTTCCCTGCTTACCCCTGGTGGG - Intergenic
1178295981 21:31410820-31410842 TTTATCTGCCTGCCAGTGGGAGG - Intronic
1179014625 21:37585259-37585281 TTTCCCTTCTTACCAGTGTAAGG + Intergenic
1181343590 22:22201261-22201283 TTTGCCTGCAGACCAGCAGGGGG + Intergenic
1183275282 22:36892602-36892624 TTTCCCTGCAAACAAGTGCAGGG + Intergenic
1183964231 22:41431776-41431798 TGTCCCTGCATCCCTGTGTGTGG - Intergenic
1184790163 22:46695275-46695297 TGTCCCTTCATAGCAGTGGTGGG + Exonic
1185080908 22:48708830-48708852 TTTCCCTGCAGCCCAGTGTGAGG - Intronic
1185203194 22:49521151-49521173 TTTCCCCGCATCGCAGTGGAGGG - Intronic
950932277 3:16802459-16802481 TTTTCCTGCATGCCAGTGTCTGG + Intergenic
952948969 3:38502807-38502829 TTTCCCTGCCAAAAAGTGGGAGG + Intronic
955790059 3:62579775-62579797 TTTTCCTGCATTCGAGTGGCAGG + Intronic
955901891 3:63764732-63764754 TTTGCCAGCATAACACTGGGTGG - Intergenic
956168729 3:66416110-66416132 TCTCCCTGCACAAAAGTGGGAGG - Intronic
961545846 3:127632445-127632467 TTTCCCAGCATACCTGCTGGAGG + Intronic
962146479 3:132845031-132845053 TTTACCGGCACACCACTGGGTGG + Intergenic
965572891 3:170189280-170189302 TTCCCTTATATACCAGTGGGTGG + Intergenic
966643417 3:182215811-182215833 CTTCCCTGCAAAACAGAGGGTGG - Intergenic
968553810 4:1237474-1237496 TTTCCCTGCACACCATCAGGAGG - Intronic
972275409 4:37552753-37552775 TTTCTCTGCTTACCACTGGTAGG + Intronic
978160842 4:105546122-105546144 TTTCCCTGCATAGCAGCTTGAGG - Intergenic
980229076 4:130024714-130024736 TTTCCCAGAATAACATTGGGTGG + Intergenic
981748682 4:148073473-148073495 TTTCCATGCATCCCCATGGGAGG + Intergenic
982735530 4:159003066-159003088 TTTCCCTGTATAGCAGAGAGGGG - Intronic
986087574 5:4467011-4467033 TTTCCCTACAAACTAATGGGGGG - Intergenic
986131872 5:4939605-4939627 TCTCCCTGCAGAGCAGAGGGCGG + Intergenic
987525455 5:19044588-19044610 TTGCCCGGCTTCCCAGTGGGAGG - Intergenic
987755054 5:22089345-22089367 TTTCCCCCCATCCCAGTGTGTGG - Intronic
989601572 5:43205153-43205175 TTCCACTGCACACCAGAGGGAGG + Intronic
990097523 5:52135519-52135541 TTTCTCTCCATTCCAGAGGGTGG + Intergenic
991342125 5:65623446-65623468 TTTCCGTGCACAACAGTGGAAGG + Intronic
993845615 5:92939563-92939585 CTTCCCTGACTGCCAGTGGGTGG + Intergenic
996708172 5:126518122-126518144 TGTGCCTGAATTCCAGTGGGAGG - Intergenic
1002153576 5:177257055-177257077 TTGTTCTGCATAACAGTGGGTGG - Exonic
1002186629 5:177457746-177457768 TTCCCCTGCAGGCCAGTGAGGGG - Exonic
1003256689 6:4481364-4481386 TTTCCCTGCAGATGAGAGGGTGG + Intergenic
1004748194 6:18533980-18534002 ATTCCCTGCATTCCTTTGGGGGG + Intergenic
1007809291 6:44474902-44474924 TTTTACAGCATTCCAGTGGGTGG + Intergenic
1011224327 6:85090316-85090338 TCTCACAGCAAACCAGTGGGTGG - Intergenic
1011936377 6:92783508-92783530 TATCCCTGGAAACCAGTGAGCGG - Intergenic
1013030252 6:106325723-106325745 ATTCGCTGGATACCAGAGGGCGG - Exonic
1014242707 6:119035317-119035339 TGTCCCTGAATTCCAGTGGGAGG - Intronic
1017332841 6:153219638-153219660 TTTACCTGTATGCCATTGGGTGG + Intergenic
1019476827 7:1248384-1248406 GGTCCCTGGACACCAGTGGGTGG - Intergenic
1019950074 7:4364978-4365000 TATGCCTGAATTCCAGTGGGAGG - Intergenic
1027260697 7:76462327-76462349 CTTCCCTGCTTTCCTGTGGGGGG + Intronic
1027312076 7:76960440-76960462 CTTCCCTGCTTTCCTGTGGGGGG + Intergenic
1028511481 7:91629725-91629747 TATCCATACATACCAGTTGGAGG - Intergenic
1032505236 7:132429292-132429314 TTTCCCAGCTGTCCAGTGGGTGG - Intronic
1035671643 8:1422664-1422686 GTTCCCTGCCCACCAGGGGGTGG + Intergenic
1036432559 8:8703366-8703388 TTTCCATCCACACCAGTGAGGGG - Exonic
1039285627 8:36037537-36037559 TTACCCTGCATGACAGAGGGAGG + Intergenic
1039422015 8:37451091-37451113 TGTCTCTGCATCACAGTGGGAGG - Intergenic
1042864646 8:73346446-73346468 TTTCCCTTCATACCAGGGCGTGG - Intergenic
1047760437 8:127950298-127950320 TCTCCCTGCATAGGAGTGGGAGG + Intergenic
1052789872 9:32865351-32865373 TTACCCTGCATCACAGTGGGTGG - Intergenic
1052831445 9:33219209-33219231 TTTCCCTATTAACCAGTGGGTGG + Intronic
1052989619 9:34511511-34511533 TTTCCCTGCTTGCTAGTGGGGGG - Intronic
1055889867 9:81112282-81112304 TTTCCCTGCCTACATGGGGGCGG - Intergenic
1058818115 9:108704337-108704359 TTGGCTTGCCTACCAGTGGGTGG - Intergenic
1059305063 9:113347484-113347506 TTCCAGTGCATCCCAGTGGGAGG - Intergenic
1060052863 9:120389701-120389723 TTTCACTGCAGGCCAGTGGAAGG - Intronic
1060428547 9:123527028-123527050 TCTCCCTTCATCCTAGTGGGTGG + Intronic
1062057610 9:134476661-134476683 TTTCCCTGCCTATCAATAGGTGG + Intergenic
1062527822 9:136985386-136985408 TCTCTCTGCAGACCAGTGTGCGG + Exonic
1185512087 X:671153-671175 TTTCTCTGCAGCCCATTGGGAGG + Intergenic
1185872498 X:3675586-3675608 TTTACATGCACCCCAGTGGGAGG - Intronic
1185938335 X:4284411-4284433 TTTCTCTCCATATCAATGGGAGG + Intergenic
1186204260 X:7184788-7184810 TCTTCCTGCATCCCACTGGGAGG - Intergenic
1187773927 X:22733404-22733426 TTTACCAGCACACCACTGGGTGG + Intergenic
1190681543 X:52830737-52830759 TGTCCCTGCAGAGCTGTGGGAGG - Intergenic
1190998620 X:55636777-55636799 TGTCCCTGCAGAGCTGTGGGAGG - Intergenic