ID: 1165824418

View in Genome Browser
Species Human (GRCh38)
Location 19:38697726-38697748
Sequence AGGGCTGTTCCCCGAGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165824418_1165824424 -3 Left 1165824418 19:38697726-38697748 CCTTGCCCTCGGGGAACAGCCCT No data
Right 1165824424 19:38697746-38697768 CCTCTTTTGTCCTCAGGCTGTGG 0: 1
1: 1
2: 3
3: 36
4: 316
1165824418_1165824427 9 Left 1165824418 19:38697726-38697748 CCTTGCCCTCGGGGAACAGCCCT No data
Right 1165824427 19:38697758-38697780 TCAGGCTGTGGGATGTGTCTTGG 0: 1
1: 0
2: 2
3: 18
4: 241
1165824418_1165824421 -9 Left 1165824418 19:38697726-38697748 CCTTGCCCTCGGGGAACAGCCCT No data
Right 1165824421 19:38697740-38697762 AACAGCCCTCTTTTGTCCTCAGG 0: 1
1: 0
2: 1
3: 7
4: 178
1165824418_1165824425 -2 Left 1165824418 19:38697726-38697748 CCTTGCCCTCGGGGAACAGCCCT No data
Right 1165824425 19:38697747-38697769 CTCTTTTGTCCTCAGGCTGTGGG 0: 1
1: 0
2: 2
3: 19
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165824418 Original CRISPR AGGGCTGTTCCCCGAGGGCA AGG (reversed) Intronic
No off target data available for this crispr