ID: 1165824421

View in Genome Browser
Species Human (GRCh38)
Location 19:38697740-38697762
Sequence AACAGCCCTCTTTTGTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165824409_1165824421 26 Left 1165824409 19:38697691-38697713 CCTAGGTCTGGGCCTGGCAACAC No data
Right 1165824421 19:38697740-38697762 AACAGCCCTCTTTTGTCCTCAGG 0: 1
1: 0
2: 1
3: 7
4: 178
1165824412_1165824421 14 Left 1165824412 19:38697703-38697725 CCTGGCAACACCAGAGCACGGGG 0: 1
1: 0
2: 2
3: 7
4: 128
Right 1165824421 19:38697740-38697762 AACAGCCCTCTTTTGTCCTCAGG 0: 1
1: 0
2: 1
3: 7
4: 178
1165824414_1165824421 4 Left 1165824414 19:38697713-38697735 CCAGAGCACGGGGCCTTGCCCTC 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1165824421 19:38697740-38697762 AACAGCCCTCTTTTGTCCTCAGG 0: 1
1: 0
2: 1
3: 7
4: 178
1165824418_1165824421 -9 Left 1165824418 19:38697726-38697748 CCTTGCCCTCGGGGAACAGCCCT No data
Right 1165824421 19:38697740-38697762 AACAGCCCTCTTTTGTCCTCAGG 0: 1
1: 0
2: 1
3: 7
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165824421 Original CRISPR AACAGCCCTCTTTTGTCCTC AGG Intronic
901628469 1:10636463-10636485 AACAGACCAGTTTTGTCCCCGGG - Intergenic
904757251 1:32774729-32774751 GGCAGCCCTTCTTTGTCCTCTGG + Exonic
905337988 1:37258421-37258443 AACCTCCCTATTTTGTCCCCGGG - Intergenic
905849630 1:41264039-41264061 CTAAGCCCTCTTTTGTTCTCTGG + Intergenic
908827917 1:68151308-68151330 CACAGCCCTCTTTGTTTCTCTGG - Intronic
908924050 1:69231578-69231600 AACAGGCCTGCCTTGTCCTCTGG - Intergenic
910126218 1:83845421-83845443 AAGAGCCCTTTTTTGTACACTGG - Intergenic
911796563 1:102084213-102084235 AATAGCACTGTTTTGTCCTAGGG - Intergenic
916821801 1:168406202-168406224 ACCAGGCCGCTTTTGTCCTGGGG + Intergenic
918076887 1:181177351-181177373 AACAAAGCACTTTTGTCCTCAGG - Intergenic
918289229 1:183090632-183090654 AACCTCCCTCCCTTGTCCTCTGG - Intronic
918606776 1:186437148-186437170 AACAGGGTTCTCTTGTCCTCTGG + Intergenic
923364774 1:233248482-233248504 GACAGCCGTCTTTTGACCGCCGG + Intronic
924113190 1:240720373-240720395 AATACCCCTCATTTGTTCTCTGG + Intergenic
1063017708 10:2095081-2095103 GACATCTCTCTTTAGTCCTCAGG - Intergenic
1063815738 10:9769238-9769260 AACAGCACTGTTTTTGCCTCAGG + Intergenic
1065924613 10:30424652-30424674 AACAACCCTCTTTTGGGGTCTGG - Intergenic
1068491257 10:57727214-57727236 AACAGCCGCCTTATATCCTCAGG + Intergenic
1072625186 10:97106768-97106790 CACAGCCCTCTCTGGACCTCTGG - Intronic
1073120290 10:101118333-101118355 AAACTCCCACTTTTGTCCTCAGG - Intronic
1074643475 10:115417046-115417068 AACAACCCTCTTTGGGCCTTGGG - Intronic
1077638961 11:3863997-3864019 AGCAGCCCTCCTTTATTCTCGGG - Intronic
1078375952 11:10793145-10793167 AAAAGCCCTCTTTTTTCACCTGG - Intergenic
1079226803 11:18613942-18613964 GACAGGTCTCTTTAGTCCTCAGG + Intronic
1081848229 11:46256500-46256522 AACAGCCGTCTTGGGTCCTGAGG - Intergenic
1085080215 11:73627733-73627755 AACAGCCTTTTTTTTTGCTCAGG + Intergenic
1086178651 11:83923112-83923134 AACAGCTTTCTTATGACCTCAGG + Intronic
1086641751 11:89167254-89167276 AACATGCCTCTTTTATCCTATGG - Intergenic
1086927083 11:92652218-92652240 AACACCCCACTTTTATCCGCTGG + Intronic
1087185610 11:95190472-95190494 AATTGACCTCTTTTTTCCTCAGG + Intronic
1087475860 11:98633478-98633500 AAGAGCCCTCTTTTGGGGTCTGG + Intergenic
1087932765 11:103997820-103997842 AACAGCCCTCTCTTGACTTCAGG - Intronic
1088129460 11:106470101-106470123 AAAAGCCCTTTGTGGTCCTCAGG + Intergenic
1088138945 11:106592426-106592448 AACTACCATCTTTTCTCCTCTGG + Intergenic
1088471071 11:110187826-110187848 AGAAGCTCTCTTTTTTCCTCAGG - Intronic
1090923052 11:131224118-131224140 AACACTCTCCTTTTGTCCTCAGG - Intergenic
1091217888 11:133914655-133914677 CAGAGCCTTCTTTTGTCCTGTGG - Intronic
1091743770 12:2977873-2977895 AAGGGCCCTTTTTTGGCCTCCGG + Intronic
1091786938 12:3248852-3248874 AAAAGTCCTCCTTGGTCCTCTGG + Intronic
1097053560 12:56237590-56237612 ACCAGCCCTGCTTCGTCCTCCGG + Exonic
1097179579 12:57163699-57163721 AACACCATTCTTTTTTCCTCAGG + Intronic
1101376856 12:104178679-104178701 AACAGCACTCTTCTTTCCTATGG + Intergenic
1104349381 12:128031588-128031610 AACAGACCTCTTTCTTCCTTGGG + Intergenic
1107410460 13:40153279-40153301 CACAGCCCAATTTTGCCCTCCGG - Intergenic
1110412272 13:75217537-75217559 AACAGCATTCTGTTATCCTCAGG + Intergenic
1112094054 13:96112995-96113017 AACAGCTCTCTTCTGTCTTGGGG + Intronic
1112136257 13:96581577-96581599 ACCAGACAGCTTTTGTCCTCAGG + Intronic
1112654363 13:101434070-101434092 GCCAGCCCTCCTTTGTCCACTGG - Intergenic
1116986636 14:51226925-51226947 AGCATCACTCTTTTGTCCTGAGG + Intergenic
1118137385 14:63045161-63045183 ACCAGCCCTCTCTTGCCCCCCGG + Exonic
1121273599 14:92653139-92653161 CATAGGCCTCTTTTGTCCTAAGG - Intronic
1121572819 14:94960336-94960358 AACAGTCCTCTTCACTCCTCTGG + Intergenic
1122873643 14:104652771-104652793 CACTGCCCTGCTTTGTCCTCAGG - Intergenic
1126511781 15:49484471-49484493 AACAGCCCACTTTCTTCCTATGG + Exonic
1126957658 15:53952144-53952166 TACTGCCCTCTTTTCTTCTCAGG - Intergenic
1129154654 15:73710337-73710359 AACAGCCCTCTGGTGCCATCAGG - Intronic
1129952697 15:79606123-79606145 AACCGACCTCTTTTAGCCTCAGG + Intergenic
1132173464 15:99687987-99688009 AACAGGCCTCTTAAGTTCTCTGG - Intronic
1134406075 16:13959745-13959767 AACAGCCTTCTCCTGTCCTGTGG - Intergenic
1135965924 16:27034951-27034973 AACAGCCCTCTTTGGGCCAAAGG + Intergenic
1137594731 16:49716105-49716127 AACTGCCCTCCGCTGTCCTCAGG - Intronic
1139934165 16:70556076-70556098 AACAGCCCTCCTTCATTCTCTGG + Intronic
1141289185 16:82701944-82701966 AACAGCCCTCCAATTTCCTCGGG - Intronic
1144798717 17:17910960-17910982 ACCAGTCCTCTTTTGCCTTCTGG + Intronic
1145199634 17:20931656-20931678 AACAGCCCTCTGTCCTCTTCTGG + Intergenic
1146529833 17:33599245-33599267 AACAGGCCTATTTTGTGGTCTGG + Intronic
1147652582 17:42070958-42070980 AACAGCCCTCTTTAGTGGTGTGG + Intergenic
1148988696 17:51646738-51646760 CACAGCTCTCTTTTGTCCCTAGG - Intronic
1149415369 17:56454284-56454306 CAATGCTCTCTTTTGTCCTCTGG + Intronic
1150893997 17:69188214-69188236 AACAGGCCTCCTCTGTCATCTGG + Intronic
1151165364 17:72198665-72198687 AACAGACCAGTTTTGTCCTTAGG + Intergenic
1151322456 17:73360067-73360089 CACAGCCCTCTCCTGTCCCCAGG + Intronic
1153397512 18:4641238-4641260 AGCTGCCTTCTTGTGTCCTCAGG - Intergenic
1154052412 18:10973657-10973679 CACAGCCTTCTTCTCTCCTCGGG - Intronic
1156783569 18:40881556-40881578 AACAGTTCTCTTTTGTCTGCGGG + Intergenic
1157204665 18:45687965-45687987 TACAGCCCTCCTCTGACCTCAGG - Intergenic
1158306354 18:56110277-56110299 AGCCCCCCTCTTTTATCCTCTGG + Intergenic
1159041805 18:63331180-63331202 GACAGCCCTGTGTTGTGCTCAGG - Exonic
1160920789 19:1519410-1519432 CACCGTCCTCTCTTGTCCTCTGG - Intergenic
1165603700 19:37080348-37080370 AACAGCCATTCTTTCTCCTCTGG - Exonic
1165824421 19:38697740-38697762 AACAGCCCTCTTTTGTCCTCAGG + Intronic
1166865728 19:45835615-45835637 ACCTGGCCTCTTTTGTTCTCTGG - Intronic
930504205 2:52262180-52262202 AATAACCCTCTTTTCTCCTTTGG + Intergenic
930713802 2:54573934-54573956 ACCAGCCCTCCCTTCTCCTCTGG + Intronic
933850358 2:86361613-86361635 CACAGATCTCTTTTTTCCTCTGG + Intergenic
936233436 2:110724318-110724340 AACTGCCATCTTTTCTCCCCCGG - Intergenic
936889198 2:117349495-117349517 AACAGCCCTCTTAGTTCCTGTGG - Intergenic
940251978 2:151688572-151688594 CACAGTCCTCCTTTGTCCTTGGG + Intronic
940270039 2:151880534-151880556 GACAGACCTCTATGGTCCTCTGG - Intronic
941011643 2:160306967-160306989 AACAGGCCTCCTTTGTCCCTAGG + Intronic
941179679 2:162243860-162243882 AACTGCACTTTTTTTTCCTCTGG + Intronic
943896359 2:193366919-193366941 AACAGCCTTCATTTGTCAGCTGG - Intergenic
945008759 2:205439254-205439276 CACAGCCCTCTTATATTCTCTGG + Intronic
945619737 2:212120216-212120238 CACAGCCATCTTTTGTCTTGTGG - Intronic
948304994 2:236940202-236940224 AACAGCCTTCCTTTGTGTTCTGG + Intergenic
948717617 2:239875327-239875349 AACAACCCTCATCTGTGCTCTGG - Intergenic
1170322176 20:15112054-15112076 ACCACCCCTCTATTGTTCTCTGG + Intronic
1170434949 20:16316683-16316705 TCCAGCCCTCTTCTGTACTCTGG - Intronic
1173169070 20:40707971-40707993 ATCACTCCTCTATTGTCCTCAGG - Intergenic
1176793602 21:13350615-13350637 AACAGCCCACTTTGTTCCTATGG + Intergenic
1180610887 22:17097040-17097062 AACCACCCTCTTTTTTCCACAGG + Exonic
1180617847 22:17140270-17140292 GGCAGCCCTTTTTTGGCCTCAGG - Intronic
1181709430 22:24672617-24672639 GACAGCCCTTTGTTTTCCTCAGG + Intergenic
1183057486 22:35315799-35315821 AACTGCCCTCCTCTGTCCTCCGG + Intronic
1184284085 22:43457324-43457346 TACAGCTCTCTTTTGGCGTCTGG + Intronic
1184602310 22:45550880-45550902 CACAGCCCTCTTTTTTCCTAGGG + Intronic
1184784541 22:46665363-46665385 AGCCGCCCTCTTCTGTCCCCAGG + Intronic
952716583 3:36486192-36486214 AGCTGCCCTTCTTTGTCCTCTGG - Exonic
953814898 3:46147174-46147196 AAAAGCCCTGATTTGTCCACTGG + Intergenic
953882896 3:46700824-46700846 GACAGCCCACTTCTGTCCTGTGG + Intergenic
956291935 3:67669827-67669849 AACAGCACTCTTTTTCCTTCTGG - Intergenic
957506929 3:81134126-81134148 AACAGCCATATTTTGTGTTCTGG + Intergenic
958802235 3:98769610-98769632 ATCAGCAGTCTTTTGTCATCAGG + Intronic
963727659 3:148940069-148940091 ATCAAGCCTCTTTTGTCCTTAGG + Intergenic
966045380 3:175542478-175542500 GACAGCCCTCCATTGTCCTTGGG + Intronic
972598511 4:40551052-40551074 AACAGCCCACTTTTGTGCTCAGG - Intronic
972841094 4:42931041-42931063 AAAAGCTTTATTTTGTCCTCAGG - Intronic
973732541 4:53836908-53836930 ACCAGCCCTCTTTTTACCTCTGG - Intronic
973995752 4:56456810-56456832 AAAAGCTCTTTTTTGTTCTCTGG + Intronic
974336791 4:60558298-60558320 AACAACTCTGGTTTGTCCTCTGG + Intergenic
976893557 4:90080196-90080218 AACAGACCTCCTTTGTGCTGTGG - Intergenic
977047769 4:92089073-92089095 AAGAGCCCTCTTTTGGGGTCTGG - Intergenic
977706632 4:100079158-100079180 TATAACTCTCTTTTGTCCTCAGG + Intergenic
978338854 4:107699745-107699767 AACAGTACTCTATTGTCTTCTGG - Intronic
981123149 4:141075315-141075337 AACAGCCAGATTTGGTCCTCAGG + Intronic
982278130 4:153657858-153657880 AACAGCTTTTTTTTTTCCTCAGG + Intergenic
988420463 5:30999645-30999667 AACATCCAGCTTGTGTCCTCTGG - Intergenic
989309556 5:39998785-39998807 TACAGCACTATTTTGTCATCTGG - Intergenic
989547126 5:42687621-42687643 AACAGGCTTCTTTTTTCCTCTGG - Intronic
992679490 5:79139838-79139860 ATGAGCCATTTTTTGTCCTCTGG - Intronic
993410255 5:87565216-87565238 ACCAGCCCTCTTTGTACCTCTGG + Intergenic
994680106 5:102876241-102876263 AACAGCCATCTTTTCAACTCTGG + Intronic
996792782 5:127310913-127310935 AGCACCCTCCTTTTGTCCTCAGG + Intronic
997465533 5:134085475-134085497 AGAAGCCCTCCTTTGGCCTCAGG + Intergenic
998388946 5:141774555-141774577 CACAGCCCACTTTTTTCCTCGGG + Intergenic
999264037 5:150255040-150255062 CAAAGGCCTCCTTTGTCCTCTGG + Intronic
1004516050 6:16323213-16323235 TACAGCCCTCTTCTGTTCTTGGG - Intronic
1006497975 6:34437519-34437541 AGCAGCCCTCATTCATCCTCCGG - Intergenic
1010037602 6:71344185-71344207 AAGGACCCTCTTTTCTCCTCTGG - Intergenic
1011557947 6:88588725-88588747 TACAGCCTTCCTTTGCCCTCTGG + Intergenic
1011621788 6:89250332-89250354 GCCAGCCCTCTTCTGGCCTCCGG - Intergenic
1015632609 6:135246577-135246599 AACAACCCTCTCTTGGCATCTGG - Intergenic
1016392548 6:143589558-143589580 AACTGCCGTCTTGTATCCTCAGG + Intronic
1016509004 6:144818955-144818977 AACAACCCTTTTTTCTCCACAGG + Intronic
1018210045 6:161472172-161472194 AACCTCCCTCTGTTGTCCTGGGG - Intronic
1020472168 7:8550288-8550310 AACACCCCCCTTTTGCCCCCAGG - Intronic
1023844874 7:44114921-44114943 AACAGCACTGTCTGGTCCTCAGG + Exonic
1027682853 7:81241714-81241736 AACTGTCCACTTTTGTGCTCAGG - Intergenic
1032027651 7:128456169-128456191 GTCAGCCCTGTTTTGTCCTAAGG + Intronic
1033043065 7:137936301-137936323 AACAGGCCTCTTTTGTGCACAGG + Intronic
1033246988 7:139725962-139725984 ATCAGCCCTCATTTTTCCTTTGG - Intronic
1033279334 7:139994792-139994814 AACAGCTCTCTTTTCTCCGTGGG - Intronic
1040294818 8:46143723-46143745 AACAGCCCCCTGATTTCCTCAGG + Intergenic
1040828054 8:51645266-51645288 GACAGCCATCTGCTGTCCTCAGG + Intronic
1041774475 8:61509183-61509205 AAGAACCCTCTTTTGGGCTCTGG - Intronic
1044000267 8:86871010-86871032 AACATCCATCTTTTCTCCTTGGG - Intronic
1044574141 8:93750258-93750280 AAGAGCTCTCTTTTGTTTTCTGG - Intergenic
1047319049 8:123762294-123762316 ATCAGGCCTCTTTGGGCCTCAGG - Intergenic
1050157324 9:2681225-2681247 ATAAGCCCACTTTTGTACTCTGG + Intergenic
1050932494 9:11348231-11348253 ACCAGCTCTCTTTAGTCATCAGG + Intergenic
1053621031 9:39817546-39817568 AACAGCCCACTTTCTTCCTATGG - Intergenic
1053884069 9:42626782-42626804 AACAGCCCACTTTCTTCCTATGG + Intergenic
1053888599 9:42667512-42667534 AACAGCCCACTTTCTTCCTATGG - Intergenic
1054223089 9:62434228-62434250 AACAGCCCACTTTCTTCCTATGG + Intergenic
1054227621 9:62474959-62474981 AACAGCCCACTTTCTTCCTATGG - Intergenic
1054263131 9:62889896-62889918 AACAGCCCACTTTCTTCCTATGG + Intergenic
1054724544 9:68637233-68637255 AACAAGACTCTATTGTCCTCAGG - Intergenic
1056315138 9:85380917-85380939 CACAGCCCTGTTTTGTGCCCAGG - Intergenic
1056557444 9:87701656-87701678 ATCTGCCCGCATTTGTCCTCAGG - Intronic
1057185137 9:93053207-93053229 ACCAGCCCTCTGGTGGCCTCAGG - Intergenic
1058664939 9:107304681-107304703 AACAGCTACCTTTTGTCCTTGGG + Intronic
1061002729 9:127911454-127911476 AACAGCCCTCTTTGCTCACCAGG - Intronic
1061561442 9:131406497-131406519 AACAGCCCTGACTTGACCTCAGG + Intronic
1062134467 9:134917635-134917657 AACAGATCTGTTTTATCCTCAGG - Intronic
1062581131 9:137229725-137229747 CCCAGCCCTCTGTTGGCCTCAGG - Intergenic
1203776751 EBV:77559-77581 AACCGCCGTCTTTTGGCCACTGG + Intergenic
1186182444 X:6986300-6986322 AAGAGCCCTCTTTTGGGGTCTGG + Intergenic
1186728503 X:12382891-12382913 TACAGCCCTGTTTTGGGCTCTGG - Intronic
1189569260 X:42277690-42277712 TAAAGCCCTCTTTTCTCCTTTGG + Intergenic
1189758630 X:44298214-44298236 TACAGTCCTTTTTAGTCCTCTGG - Intronic
1193682072 X:84533865-84533887 AAAAGCTCTCTTTTGTTCTGAGG + Intergenic
1194642072 X:96414125-96414147 AAGAGGCCTCTTTTGTCACCGGG + Intergenic
1194889781 X:99364380-99364402 AACAGCCCCCTATTGTGCTGTGG - Intergenic
1195493974 X:105508165-105508187 AATAACTCTCTTTTGTGCTCAGG - Intronic
1196367490 X:114939841-114939863 ACCAGCCCTCTTTGTACCTCTGG + Intergenic
1197632019 X:128872219-128872241 ATCAGACCTCTTTTCCCCTCTGG - Intergenic
1199822937 X:151468653-151468675 AACATGTCTTTTTTGTCCTCTGG + Intergenic