ID: 1165824424

View in Genome Browser
Species Human (GRCh38)
Location 19:38697746-38697768
Sequence CCTCTTTTGTCCTCAGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 1, 2: 3, 3: 36, 4: 316}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165824419_1165824424 -8 Left 1165824419 19:38697731-38697753 CCCTCGGGGAACAGCCCTCTTTT 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1165824424 19:38697746-38697768 CCTCTTTTGTCCTCAGGCTGTGG 0: 1
1: 1
2: 3
3: 36
4: 316
1165824412_1165824424 20 Left 1165824412 19:38697703-38697725 CCTGGCAACACCAGAGCACGGGG 0: 1
1: 0
2: 2
3: 7
4: 128
Right 1165824424 19:38697746-38697768 CCTCTTTTGTCCTCAGGCTGTGG 0: 1
1: 1
2: 3
3: 36
4: 316
1165824420_1165824424 -9 Left 1165824420 19:38697732-38697754 CCTCGGGGAACAGCCCTCTTTTG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1165824424 19:38697746-38697768 CCTCTTTTGTCCTCAGGCTGTGG 0: 1
1: 1
2: 3
3: 36
4: 316
1165824418_1165824424 -3 Left 1165824418 19:38697726-38697748 CCTTGCCCTCGGGGAACAGCCCT No data
Right 1165824424 19:38697746-38697768 CCTCTTTTGTCCTCAGGCTGTGG 0: 1
1: 1
2: 3
3: 36
4: 316
1165824414_1165824424 10 Left 1165824414 19:38697713-38697735 CCAGAGCACGGGGCCTTGCCCTC 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1165824424 19:38697746-38697768 CCTCTTTTGTCCTCAGGCTGTGG 0: 1
1: 1
2: 3
3: 36
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165824424 Original CRISPR CCTCTTTTGTCCTCAGGCTG TGG Intronic
900205679 1:1431093-1431115 CCTCTTCTGTCCTGGGGGTGGGG - Intergenic
900210409 1:1452934-1452956 ACTCTTTTGTGCCCAGGCTCCGG + Intronic
900216382 1:1484056-1484078 GCTCTTTTGTGCCCAGGCTCTGG - Intronic
900228891 1:1546012-1546034 CCTCTGGGGTCCTCAGGGTGGGG + Intronic
900647546 1:3715743-3715765 CCTCTTATCTCCTCTGCCTGTGG + Intronic
900714018 1:4132668-4132690 CCTCTTTTGTTGTCAGGGTTCGG + Intergenic
901282651 1:8051195-8051217 CCTCTTCTGGCTTCTGGCTGTGG + Intergenic
902437553 1:16408266-16408288 TCTCTATTGTCCTCAGGAAGGGG - Intronic
905048960 1:35031965-35031987 CCTCTTTTCCCGTCAGGCTCCGG + Exonic
907563181 1:55410144-55410166 CATCACTTGTCCTAAGGCTGAGG - Intergenic
907830099 1:58056713-58056735 TCTCTTTTGTCCTCCGGTTGAGG + Intronic
907939369 1:59072697-59072719 GCTCTTTTGTCCTGATGCTTTGG - Intergenic
908956986 1:69643690-69643712 TCTCTTTACTCATCAGGCTGAGG + Intronic
909033332 1:70567486-70567508 CTTCTGTTGCCCTCAGGCTCAGG + Intergenic
910368986 1:86496342-86496364 CCTCTTTTCTCCTCCTGCTCAGG + Intronic
912614653 1:111085861-111085883 CCCCTTTTATCCTCAGGCTGGGG - Intergenic
915333988 1:155130056-155130078 CCTCTCTTTTCCCCAGGGTGGGG + Intronic
915528897 1:156492158-156492180 CCTCTTTAGTGCTAAGGTTGGGG + Intronic
915779086 1:158525659-158525681 GCTCTTTTGTCTTCCGGCTTTGG + Intergenic
916268938 1:162919589-162919611 CCACTGTTGCCCTCAGGCTCTGG - Intergenic
916738404 1:167628321-167628343 CCTCCTTTGTGCTCAGAATGGGG - Intergenic
917003741 1:170388641-170388663 CCCCTGCTGCCCTCAGGCTGAGG - Intergenic
917320856 1:173780067-173780089 TCTCTTTTATCCTCAGATTGTGG - Intronic
918010537 1:180582573-180582595 TCTCTTTCATCCTTAGGCTGAGG + Intergenic
918406378 1:184215202-184215224 CCTCATTTTTCTGCAGGCTGGGG - Intergenic
921388735 1:214598380-214598402 ACTCTTTTTTGCACAGGCTGGGG + Intergenic
921918250 1:220637814-220637836 TCTCTCCTGTCCACAGGCTGAGG - Intronic
922332978 1:224594190-224594212 GGTCACTTGTCCTCAGGCTGTGG - Intronic
922899491 1:229124964-229124986 CCGCTCTTGTGTTCAGGCTGGGG - Intergenic
922920628 1:229299873-229299895 CCTCCTCTATCCTCTGGCTGGGG - Intronic
923253148 1:232195584-232195606 CCTCTTTCCTCTCCAGGCTGTGG + Intergenic
923653215 1:235892830-235892852 CTTCCCTTGTCCTCAGGTTGTGG - Intergenic
924879355 1:248142864-248142886 CTTGTTTTGTCCTCAGGAGGAGG - Intergenic
1063177467 10:3564935-3564957 CATCTTCTGCCCTCAGACTGAGG - Intergenic
1064313866 10:14236637-14236659 CCTCTCTTGCCCTCAGGCAGTGG - Intronic
1064353198 10:14595787-14595809 GCTCTTTTGGCCTCAGCCTTTGG - Intronic
1065311340 10:24418376-24418398 CCTGTTTGGTCCTCAAGTTGGGG - Intronic
1065783640 10:29193230-29193252 GCTACTTTGCCCTCAGGCTGAGG + Intergenic
1067178980 10:43970802-43970824 CCTGCTTTGTCCTCAGGCCCTGG - Intergenic
1067462802 10:46470317-46470339 CCTCTGCAGTCCTCTGGCTGTGG - Intergenic
1067624392 10:47914320-47914342 CCTCTGCAGTCCTCTGGCTGTGG + Intergenic
1068887666 10:62114317-62114339 TCACTTTTGTGCCCAGGCTGGGG - Intergenic
1069581332 10:69569037-69569059 ACGCTTTTGTCCTCCGACTGAGG + Intergenic
1069946679 10:71991182-71991204 ACTCTTTTGCAGTCAGGCTGAGG - Intronic
1069992215 10:72322767-72322789 CCTGTGTTGTCCCCAGGTTGGGG - Intergenic
1070354488 10:75626486-75626508 TCTTCTTTGACCTCAGGCTGGGG + Intronic
1070522768 10:77268974-77268996 CCTCCTTTGGTCCCAGGCTGGGG - Intronic
1071023343 10:81083642-81083664 CCCCTACTGTCCTCAGGCTAGGG - Intergenic
1072437971 10:95430905-95430927 GCTTCTTTGTCCTTAGGCTGAGG - Intronic
1072618543 10:97065252-97065274 CCTCTTTGGCACTCAGGCTGAGG - Intronic
1073896800 10:108170514-108170536 ACTTTTTTGTCTTCAGTCTGAGG + Intergenic
1074460323 10:113630774-113630796 CCTCTTTTGTATTCAAGCTATGG + Intronic
1074696249 10:116052238-116052260 CCTCTTCTGTCTTCAGTCTGGGG - Intergenic
1074854796 10:117465584-117465606 CCTGCTTTGGCCTCAGGCTGGGG + Intergenic
1074989194 10:118687446-118687468 CCTCTCTTTTCCTCATTCTGGGG + Intronic
1075517243 10:123118859-123118881 CTTCTTTTGTCCTCAGAGTGGGG + Intergenic
1077092656 11:786745-786767 CCTCTTCTGCACTCAGGATGTGG + Intergenic
1077095593 11:797754-797776 TCTCCTTTGTCCTCTGGCCGAGG - Exonic
1078187447 11:9064432-9064454 ACTCTGTTGCCCCCAGGCTGGGG - Intronic
1079480737 11:20877030-20877052 CCTCTTTTGGCCTTATGCTAAGG - Intronic
1079694304 11:23459874-23459896 TCTCTTTTTTGCTCAGTCTGAGG - Intergenic
1083958187 11:65998487-65998509 CCTGCTTTGTCCTCATGCAGGGG + Exonic
1084388278 11:68858143-68858165 CCTCTGCTCTCCTCAGTCTGTGG + Intergenic
1084953526 11:72679445-72679467 CCTCTTTTGTCTTGTGGGTGGGG + Intergenic
1086875254 11:92087990-92088012 ACTCTGTTTTCCTGAGGCTGAGG - Intergenic
1087521127 11:99237647-99237669 CTTGTTTTGTCATCAGGCTGGGG - Intronic
1087952498 11:104240207-104240229 CGTCTTCTCTCCTCAGGCTCTGG + Intergenic
1088033458 11:105281025-105281047 CCTCTTTTTTCCCCAGTCTCAGG - Intergenic
1088346991 11:108837652-108837674 CTTGCTCTGTCCTCAGGCTGAGG + Intronic
1088471070 11:110187820-110187842 TCTCTTTTTTCCTCAGGCAATGG - Intronic
1088826280 11:113496903-113496925 CCGCTTTTGTCCACTGTCTGGGG + Intergenic
1089615681 11:119693451-119693473 CCTCTCTTGGCCCGAGGCTGAGG - Intronic
1090734921 11:129603909-129603931 TCTCTTTTGTCTTTATGCTGTGG - Intergenic
1091312842 11:134586722-134586744 CCTCTTTTGTCCTCAATGTGGGG + Intergenic
1092020320 12:5197006-5197028 CCTCCTTTGTTCTCACTCTGGGG + Intergenic
1092086562 12:5767813-5767835 CCTCTCTGGCCCACAGGCTGTGG + Intronic
1092754463 12:11750298-11750320 ACTCTTTTGTCAGCTGGCTGGGG + Intronic
1093710059 12:22320308-22320330 CCTATTTTGGCCTCAGGGTGGGG - Intronic
1093991043 12:25590646-25590668 CCTCTCCTCTCCTCAAGCTGAGG - Intronic
1095330427 12:40955151-40955173 CCTCTATAGTCTTCAAGCTGGGG - Intronic
1096046385 12:48566208-48566230 GATCTTCTGACCTCAGGCTGAGG + Intergenic
1096231192 12:49897770-49897792 CCTCTTTTCTCCCAATGCTGGGG - Intronic
1096755511 12:53796244-53796266 CCTCTTAGATCTTCAGGCTGCGG - Intergenic
1098632447 12:72740638-72740660 CCTCTGATGCCCTCAGTCTGGGG + Intergenic
1098701177 12:73629236-73629258 CCTCTTCTGTCCTCATGTTTTGG - Intergenic
1100120563 12:91364737-91364759 CCTCTTTCATCCTCAGCCTTGGG - Intergenic
1100433626 12:94552191-94552213 CCTCTTTACACTTCAGGCTGTGG - Intergenic
1100548030 12:95621870-95621892 CTCCTTTTGTCCTTAGGCTAAGG - Intergenic
1101333142 12:103773201-103773223 TGTATTTGGTCCTCAGGCTGTGG - Exonic
1101333591 12:103777184-103777206 ACCCTTTTGTCCTCAGTGTGTGG - Exonic
1101686650 12:107030501-107030523 CAGTTTTTGTCCTCAAGCTGAGG + Intronic
1102809999 12:115815937-115815959 CCTCTTTCCCCCTCAGGCTGCGG - Intergenic
1102958172 12:117073118-117073140 CCTCCTTGGTCCATAGGCTGAGG - Intronic
1103103448 12:118201397-118201419 CATCTTTTGTCCTCTGTATGAGG + Exonic
1104043174 12:125143764-125143786 ACTCTGCTGTCCTCAGGATGTGG + Intergenic
1104362643 12:128148578-128148600 CCTCTGCTCTCCTAAGGCTGCGG + Intergenic
1104734961 12:131131035-131131057 CCCCTAGTGTCCTCTGGCTGCGG - Intronic
1105831963 13:24170583-24170605 TCTCTGTTGTCCTCAGATTGAGG + Intronic
1108800804 13:54092556-54092578 CCCCTACTGCCCTCAGGCTGAGG - Intergenic
1110090882 13:71446296-71446318 CCTGTTTGTTCCTCATGCTGAGG + Intronic
1110343866 13:74423891-74423913 CACCTTTTGTCCCCAGCCTGTGG + Intergenic
1110485034 13:76029213-76029235 CTTCTTTTATCCTCAGGTTGTGG + Intergenic
1112972081 13:105273416-105273438 CCTCTGCTGCCCTCAGGCTAAGG - Intergenic
1115282332 14:31678039-31678061 CCTCTTCTTTCCACAGGCAGAGG + Intronic
1115997911 14:39212424-39212446 CCTCTCTTGTCCTGAGGGTTAGG + Intergenic
1117379737 14:55149423-55149445 CCTTTTTTGTGGTCAGGCTCTGG - Intronic
1117768556 14:59108276-59108298 CCTCTTTTTTCCTATGGATGTGG - Intergenic
1117795480 14:59388965-59388987 CCTCTCTTCTCCTCAAGCAGAGG + Intergenic
1117995592 14:61474774-61474796 CTTCTCTGGTCCTCTGGCTGGGG - Intronic
1118543600 14:66858912-66858934 CCTCTATTTTCCACAGGCAGAGG - Intronic
1119441209 14:74630001-74630023 CCTCCTTTTTCTTCAGGCTGAGG - Intergenic
1119458765 14:74780389-74780411 CCTCTTTTATCTTTAGTCTGAGG + Exonic
1120085063 14:80262860-80262882 TCGCTCTTGTCCCCAGGCTGGGG - Intronic
1120597941 14:86464459-86464481 CCTCATTTATCCTCAGGCAGTGG + Intergenic
1122693498 14:103542264-103542286 CCTCCTTTGTGCTCTGCCTGGGG + Intergenic
1123490012 15:20773506-20773528 CCTATCACGTCCTCAGGCTGTGG - Intergenic
1123546513 15:21342593-21342615 CCTATCACGTCCTCAGGCTGTGG - Intergenic
1123565811 15:21545839-21545861 CCTCTTCTTTCCACAGGCAGAGG + Intergenic
1123602073 15:21983126-21983148 CCTCTTCTTTCCACAGGCAGAGG + Intergenic
1125514433 15:40309720-40309742 TCCCTTTCCTCCTCAGGCTGAGG - Intergenic
1126639989 15:50814647-50814669 CCTCTCTGTTGCTCAGGCTGGGG + Intergenic
1127353604 15:58176484-58176506 CTTCTTTTTTGCCCAGGCTGAGG - Intronic
1127971588 15:63966331-63966353 CCTCTTTTCTCCTCAAGTGGAGG + Intronic
1129549386 15:76431128-76431150 CCTCTTTTTTTCTCAGCCTTGGG + Intronic
1130991305 15:88877583-88877605 CCTCTTCTTCCCCCAGGCTGAGG + Exonic
1131102440 15:89703522-89703544 GCTCTTTTTCCCTCAGCCTGAGG + Intronic
1131102442 15:89703532-89703554 CCTGGTTCATCCTCAGGCTGAGG - Intronic
1131996198 15:98135211-98135233 CCTGTATTGCCTTCAGGCTGGGG + Intergenic
1202974180 15_KI270727v1_random:272932-272954 CCTCTTCTTTCCACAGGCAGAGG + Intergenic
1132488792 16:213215-213237 GGTCTTTTGTGGTCAGGCTGAGG + Intronic
1132545817 16:532910-532932 CCTCTTTTGTGATCAGCATGAGG - Intronic
1136221140 16:28829805-28829827 CCTCTTTTGTCCCCTGGCACTGG + Intronic
1136415792 16:30102737-30102759 CGTCTTGTTTCCCCAGGCTGTGG - Intergenic
1136519666 16:30787277-30787299 CCCCTTTTTTCCCCAGGCTGCGG - Intergenic
1138181771 16:54945333-54945355 CTTCTTTTCTCCTCGGGTTGGGG + Intergenic
1138596773 16:58033262-58033284 CTCCTCTTGGCCTCAGGCTGGGG - Intronic
1140202433 16:72905379-72905401 ACTCAGTTGTCCTCTGGCTGGGG - Intronic
1140306760 16:73809996-73810018 CCTCTTTGGTGCAAAGGCTGAGG - Intergenic
1141302154 16:82827028-82827050 CCTATTTTATCATCAGGCAGAGG - Intronic
1141665646 16:85463862-85463884 CCACTGAGGTCCTCAGGCTGAGG + Intergenic
1142559265 17:800410-800432 ACTCTTGTGTTCTCAGGCAGGGG - Exonic
1143724577 17:8836459-8836481 CCTCTTTTGTCCTCCTGCCAGGG + Intronic
1146749969 17:35369368-35369390 CCTCCTTTTTCCACAGGCAGAGG - Intronic
1148048641 17:44758875-44758897 CCTCTTTTGTCCTGCCGCGGCGG + Intergenic
1148580802 17:48742448-48742470 CCTCACTTGTCCTCTGGCTGTGG + Intergenic
1148809193 17:50279477-50279499 CCTCTCTTGTCCTGAGGGTTAGG + Exonic
1148867675 17:50637367-50637389 CCTTTTTTGTAATTAGGCTGTGG - Intronic
1151597976 17:75089322-75089344 CCTCTTTTGTGCTCAGCCAGAGG + Intronic
1152682190 17:81674265-81674287 CCTCTTTGTTGCCCAGGCTGGGG + Intergenic
1153182569 18:2451746-2451768 CCTCCTTTGCCCCCAGGCTCTGG - Intergenic
1153681916 18:7509012-7509034 GTGCTTTTGTCCTCAGCCTGTGG + Intergenic
1155242126 18:23873508-23873530 ACTCTTTTGTTCTGAGGCTTGGG - Intronic
1158409091 18:57188567-57188589 GCTCTTGTGTCCACAGGATGAGG - Intergenic
1158743154 18:60166597-60166619 CCTCCTTTGTCCTCAGAGTGAGG + Intergenic
1159210634 18:65316813-65316835 TCCCTTTTGTGCTTAGGCTGAGG - Intergenic
1159339637 18:67118740-67118762 CCTCTCTTTTCCTCAAGCAGAGG + Intergenic
1159446250 18:68544925-68544947 CCTCTTCTCTCCTCAAGCAGAGG - Intergenic
1160750187 19:730311-730333 TCTGTCCTGTCCTCAGGCTGAGG + Intronic
1161078798 19:2300361-2300383 CCTCCCTTGTCCTCATGCTGTGG + Intronic
1161105844 19:2443586-2443608 CCTCGGATTTCCTCAGGCTGGGG - Intronic
1161414034 19:4134679-4134701 CCTCTCTTGCTCTCAGCCTGTGG + Intergenic
1163262415 19:16199231-16199253 CCTCTCTCATCCTCGGGCTGAGG - Intronic
1163462578 19:17448051-17448073 CCTCTTTTGGCCTCAGGCTGGGG - Intronic
1163797607 19:19346401-19346423 TCTCTTTTGGCCTCGGGGTGAGG - Intronic
1164624242 19:29715630-29715652 TCTCTTCTGTGCCCAGGCTGCGG - Intronic
1164677526 19:30111760-30111782 CCTCTTTTGCACTGAGGCTGAGG + Intergenic
1165451675 19:35887470-35887492 CCTCTTGTGTCGCCAGGGTGAGG + Intergenic
1165824424 19:38697746-38697768 CCTCTTTTGTCCTCAGGCTGTGG + Intronic
1166115786 19:40653328-40653350 CCACTTTTGTCCTCAGTTTTGGG + Intergenic
1168018904 19:53594764-53594786 CCACTGCTGCCCTCAGGCTGGGG - Intergenic
1168586629 19:57599369-57599391 CCTCTTTCGTCCTCCAGCTTCGG + Intergenic
925240574 2:2322512-2322534 TCACATTTGTTCTCAGGCTGTGG - Intronic
925417339 2:3679875-3679897 ACTGGTGTGTCCTCAGGCTGGGG + Exonic
925684769 2:6459231-6459253 CCACTCTTGCCCTCAGGCTGTGG - Intergenic
927575741 2:24200646-24200668 ACTCTTTTTCCCACAGGCTGGGG - Intronic
927646026 2:24877433-24877455 CCTCTTTGTTCTTCAGGCGGGGG - Intronic
928181600 2:29072172-29072194 CCTTGTTCGTCCTCAGGATGGGG + Exonic
929585249 2:43109745-43109767 CCTCTTTTGTTTTCAGGATGAGG + Intergenic
929693443 2:44093741-44093763 CCTATTATGTTCTCAGGCTTTGG + Intergenic
929930373 2:46251104-46251126 GCTCTGTTGTGCCCAGGCTGCGG + Intergenic
930220056 2:48737011-48737033 CTTCTGATGCCCTCAGGCTGAGG + Intronic
930641544 2:53859420-53859442 CCCACTCTGTCCTCAGGCTGGGG - Intronic
930838982 2:55825326-55825348 CTCCTGTTGCCCTCAGGCTGAGG + Intergenic
930839035 2:55825603-55825625 CCCTTATTGCCCTCAGGCTGGGG + Intergenic
931179629 2:59886563-59886585 TCTCTTGTTTCCTAAGGCTGTGG - Intergenic
931193475 2:60027871-60027893 CCTCTCTGGTCTTCAGCCTGAGG + Intergenic
932251576 2:70248827-70248849 ACTTTTTTGTCTTCTGGCTGCGG + Intergenic
932884931 2:75541106-75541128 CCTGTGTTGTCCTCAGGGAGGGG - Intronic
933080219 2:77976596-77976618 CAGCTGTTGTCCTCAGGCTCTGG + Intergenic
933574826 2:84055300-84055322 CTTCTGTTGCCCTCAGGCTCAGG + Intergenic
933727587 2:85435531-85435553 CCCCTTTTGCTCACAGGCTGTGG + Intronic
934021523 2:87959340-87959362 CTTCCTTTGTTCTTAGGCTGAGG - Intergenic
934615698 2:95769350-95769372 TCTCTTTTGTCCCCAGTATGGGG + Intergenic
935190206 2:100771572-100771594 CTTCTCCTGTCCTCAGGCTTTGG + Intergenic
935457685 2:103288995-103289017 CCTCGTTTGGCCTCAAGATGAGG + Intergenic
935596308 2:104880686-104880708 CCTCTTTTGTCCTAAAGGTCAGG + Intergenic
936616086 2:114049251-114049273 CCTCTGTTGTCCTCAGCCCAAGG + Intergenic
939245851 2:139622695-139622717 CCTCTTATGTTCTGAGCCTGTGG + Intergenic
942381566 2:175396854-175396876 CATCTTTTCTCCTCCTGCTGGGG - Intergenic
946445377 2:219735222-219735244 TCTGTTGTGTCATCAGGCTGAGG + Intergenic
948451800 2:238080352-238080374 CCTGGTTTTTCCTCAGGCTTGGG + Intronic
948850406 2:240702780-240702802 TGTCTTATGTCCTCAGGCTCAGG + Intergenic
948918676 2:241051487-241051509 CCTCTTTTCTGCCCAGGCTCTGG - Intronic
1171785308 20:29458507-29458529 CCTCCTTCATCCTCAGACTGTGG - Intergenic
1172022972 20:31927671-31927693 CCTCTTTTCTTCTGAGGCTCAGG - Intronic
1172278785 20:33695923-33695945 TCGCTCTTGTCCCCAGGCTGGGG + Intergenic
1172996623 20:39075298-39075320 CCTCTTTTGGCCTCTAGGTGGGG - Intergenic
1173493178 20:43499972-43499994 CCTGTTCTTTCCTCAGGCTCAGG + Intergenic
1174159273 20:48539274-48539296 CCTTTTTTCCCCTCAGACTGTGG + Intergenic
1174425272 20:50427767-50427789 TCTCTTTTGTCTTCAGTCAGGGG - Intergenic
1174822706 20:53741065-53741087 CCCATTTTGTCCTAAGGCTGGGG - Intergenic
1175868014 20:62191708-62191730 CATCTTTTGTAGTCAGGATGGGG + Intronic
1179097675 21:38330088-38330110 GCTCTCTTGTCCTCTGCCTGGGG - Intergenic
1179408977 21:41147600-41147622 CCTCTTCTGCCCCCAAGCTGAGG - Intergenic
1179999621 21:44989402-44989424 CCTCTTATGTCCTGATGCTCGGG + Intergenic
1180936654 22:19629897-19629919 CCTCTCTTGTCCTCAGTGAGGGG - Intergenic
1181359390 22:22323138-22323160 CCACTTTTGTCCTCAGAGTCAGG + Intergenic
1181369486 22:22404890-22404912 CCACTTTTGTCCTCAGAGTCAGG + Intergenic
1181817377 22:25448562-25448584 CATCTTTTTTCCTCCGTCTGAGG - Intergenic
1182786126 22:32909208-32909230 CCTCTGTTCTCTTCTGGCTGTGG + Intronic
1184370588 22:44079510-44079532 CCTCTGTCCTCCTCAGCCTGGGG - Intronic
1184417385 22:44360203-44360225 CTTCTTCTGTCGCCAGGCTGGGG - Intergenic
949384573 3:3486237-3486259 CGTCTTTTGTACTTAGGCTTGGG - Intergenic
949677690 3:6475775-6475797 CCTCTTTTCACCCCAGGCTTAGG - Intergenic
950476047 3:13215566-13215588 CCTCTTTGGTCCTGGGGCCGAGG + Intergenic
950500490 3:13360485-13360507 CCTCTTCTGTCCCCAGGCTGTGG - Exonic
952919184 3:38273278-38273300 CCTCTTGGTTTCTCAGGCTGTGG + Intronic
953103303 3:39851459-39851481 CCACTTTTTTCCTCAGGGTGTGG + Intronic
953201584 3:40782612-40782634 ACTCTTCTCTCCTCAGGCAGAGG + Intergenic
954557900 3:51532713-51532735 CCACTTTATTCCTCAGGATGTGG + Intergenic
954710962 3:52504889-52504911 CTCCTCTTGTCCCCAGGCTGAGG - Intronic
956846294 3:73186209-73186231 CCTCCTTTTTCCCCTGGCTGGGG + Intergenic
957669511 3:83281978-83282000 CCTCTTTTCTTCTCAGTCTCAGG - Intergenic
957878582 3:86181225-86181247 CCTATTTTCTTCTCAGGGTGAGG + Intergenic
959257226 3:104031069-104031091 GCACCTTTGTCCTCCGGCTGTGG - Intergenic
959262763 3:104102715-104102737 CCCCTGTTGTCTTCAAGCTGGGG - Intergenic
960967929 3:123118150-123118172 TCTCTTTTGACCTCATTCTGGGG + Intronic
961983330 3:131104455-131104477 CCCCTGCTGTCCTCAGGCTGGGG - Intronic
962084226 3:132173667-132173689 CCCCTGTTGCCCTCAGGTTGAGG + Intronic
962429828 3:135308718-135308740 TCCCTTTTGTGCTCATGCTGTGG - Intergenic
962438725 3:135392134-135392156 GCTTTTTTTTCCCCAGGCTGTGG - Intergenic
963045739 3:141101376-141101398 GCACTTTTGTCTTCAGCCTGGGG + Intronic
964112316 3:153100311-153100333 CCCCTTTTGTCCTTAGGCACTGG + Intergenic
965552557 3:169983562-169983584 CTTCTTTTCTCCTCTGTCTGAGG + Intronic
966620356 3:181956397-181956419 ACCCTTCTGCCCTCAGGCTGTGG + Intergenic
967124477 3:186411816-186411838 CCTCTTTGTTCCTCAGGCCTGGG - Intergenic
968207059 3:196812477-196812499 CCTCTTTTCACTTCAAGCTGAGG - Intronic
971819297 4:31530735-31530757 CCCCTACTGCCCTCAGGCTGGGG - Intergenic
975404084 4:73969117-73969139 TCTCTTCTGTTCACAGGCTGGGG + Intergenic
977706634 4:100079164-100079186 TCTCTTTTGTCCTCAGGGAGTGG + Intergenic
979184641 4:117772821-117772843 CCTCTACTTTCCTCAAGCTGAGG - Intergenic
980335711 4:131470001-131470023 CCTCTTTTCTTCCCAGCCTGGGG + Intergenic
980887709 4:138781282-138781304 CCTCTTATTTCCTCAAGCAGTGG + Intergenic
981854667 4:149273943-149273965 TCTCATTTGTCCTCAGGATTAGG - Intergenic
981875471 4:149538881-149538903 CATTTTTTTTCCCCAGGCTGTGG - Intergenic
982186878 4:152811661-152811683 TCTCTTTTGTTCTAAGGTTGAGG - Intronic
982600622 4:157444040-157444062 CCCCTGCTGCCCTCAGGCTGAGG - Intergenic
982719801 4:158847906-158847928 CCTCTCCTGTCCCCAGGCAGAGG - Intronic
982925674 4:161334594-161334616 CCTCTATAGTCCTCTGACTGGGG + Intergenic
985370403 4:189280390-189280412 CCTCCTTCATCCTCAGGCTGTGG - Intergenic
985370410 4:189280425-189280447 TCTCCTTCATCCTCAGGCTGTGG - Intergenic
985370416 4:189280460-189280482 CCTCCTTCATCCTCAGGCTGTGG - Intergenic
985370423 4:189280495-189280517 CCTCCTTCATCCTCAGGCTGTGG - Intergenic
985370430 4:189280530-189280552 CCTCCTTCATCCTCAGGCTGTGG - Intergenic
985370436 4:189280565-189280587 CCTTGTTCATCCTCAGGCTGTGG - Intergenic
985864586 5:2504444-2504466 CTTCTTTTATACTCAGTCTGTGG + Intergenic
986027124 5:3861322-3861344 TCTCTGCTGTCCCCAGGCTGTGG - Intergenic
986207638 5:5640440-5640462 CCTCTTTTGACCTGGGGCTCAGG + Intergenic
988846509 5:35133130-35133152 TCTCTCTTGTTCTCAGGCTTTGG + Intronic
989521723 5:42410292-42410314 CTTCATTTGTCCTCTGGCTGTGG + Intergenic
993876764 5:93316562-93316584 CCTCTTGTGTCTTCAGGCCTAGG + Intergenic
993920742 5:93798082-93798104 CTTCTTTTGTGCTCTGACTGTGG - Intronic
997700124 5:135891593-135891615 TCTATTTTACCCTCAGGCTGTGG + Intergenic
1001444183 5:171770436-171770458 CCTCCGTAGACCTCAGGCTGGGG + Intergenic
1001595536 5:172896488-172896510 CCTCTCTGGTTCTGAGGCTGAGG - Intronic
1002828960 6:801183-801205 CCTCTTTAGGCATCAGCCTGAGG + Intergenic
1007420029 6:41713661-41713683 CCACCTTACTCCTCAGGCTGTGG + Intronic
1007420031 6:41713671-41713693 CCTGTTTTGGCCACAGCCTGAGG - Intronic
1008084760 6:47232856-47232878 TCTAGTTTGTCCTCAGCCTGGGG + Exonic
1009039405 6:58158698-58158720 CCTCTCCTTTCCTCAGGCAGAGG + Intergenic
1009215299 6:60913541-60913563 CCTCTCCTTTCCTCAGGCAGAGG + Intergenic
1011797405 6:90971815-90971837 TCTATTTTGTCCTAAGGCAGCGG + Intergenic
1013064568 6:106671101-106671123 TCACTTTTTTGCTCAGGCTGAGG - Intergenic
1014321085 6:119928508-119928530 CGTCTTTTTTCCTAAGACTGTGG - Intergenic
1014605564 6:123469742-123469764 TCTCTCTTGTCCTCTGGCTCTGG - Intronic
1014717233 6:124880103-124880125 CCTTTATTGCCCTCAAGCTGGGG + Intergenic
1015822855 6:137281864-137281886 CCCCTTCTGGCCCCAGGCTGAGG + Intergenic
1016149946 6:140728359-140728381 CCTCTTTCTTCCTCATGCTCTGG - Intergenic
1017961514 6:159226064-159226086 CCTCTGCTTTCCTGAGGCTGAGG + Intronic
1018583625 6:165332489-165332511 CGACATTTGTCCTGAGGCTGTGG + Exonic
1019372667 7:671094-671116 CCTCCTTCTTCCTCAGGTTGAGG + Intronic
1022037024 7:26544310-26544332 ACTCCTTTGTCCTCATTCTGAGG - Intergenic
1023152686 7:37216559-37216581 CTTCTTTTGGCTTCAGTCTGTGG - Intronic
1023522740 7:41065101-41065123 CCTATGTTTTCCTCAGGGTGAGG + Intergenic
1026906711 7:74066890-74066912 CCTCGTGTGACCTGAGGCTGTGG - Intronic
1028157460 7:87447657-87447679 CCTCTATTGTCCACTGGGTGAGG + Intronic
1028861312 7:95654072-95654094 CCTCTTTTTTCCTACGGATGAGG + Intergenic
1029540078 7:101177684-101177706 CCTCCTTGCTCTTCAGGCTGGGG - Intronic
1030378180 7:108778416-108778438 ACTCTTTTGTCCTCAAAATGCGG + Intergenic
1030899068 7:115099730-115099752 GATCTTTAGTCCTCAGGTTGCGG + Intergenic
1031306209 7:120130724-120130746 CCTCTTCTCTCCTCAAGCAGAGG - Intergenic
1031440748 7:121791980-121792002 ATTCTCTGGTCCTCAGGCTGGGG - Intergenic
1032866901 7:135934936-135934958 CCTTTATTGTCCTCATTCTGAGG + Intronic
1034980921 7:155475712-155475734 CCTCCTTTGTCGTTAGGTTGAGG + Intronic
1037464856 8:19149918-19149940 TCTTGTTTGTCCTCAGGCTGTGG - Intergenic
1037703847 8:21298457-21298479 CTTCTTCTGTCCTTACGCTGGGG - Intergenic
1038519284 8:28215887-28215909 CCTTTTTTTTCCCCATGCTGGGG + Intergenic
1040484234 8:47854992-47855014 CCTCTGATGTCCCCACGCTGGGG - Intronic
1040839788 8:51772630-51772652 CTTATTTTGCCTTCAGGCTGGGG + Intronic
1040902297 8:52429131-52429153 CCTCGTTTGTCCTCAGACAGAGG - Intronic
1041320035 8:56603398-56603420 CCTCTGTTGTCCCGAGGCAGGGG + Intergenic
1042009036 8:64218830-64218852 CCTCTTTTGACCTCCAGATGAGG + Intergenic
1043923254 8:86008039-86008061 TTTCTCTTGACCTCAGGCTGTGG + Intronic
1044170870 8:89050117-89050139 CTCCTATTGTCCTCAGGCTCAGG - Intergenic
1044818220 8:96134644-96134666 CATCTTTTGTAGTCAGGTTGGGG + Intergenic
1046285908 8:112092599-112092621 CCCCTTCTGCCCTAAGGCTGAGG - Intergenic
1047623831 8:126635363-126635385 CTTCTTTTGTGCTCAGTCAGTGG - Intergenic
1047793487 8:128230612-128230634 CCCCTTTTTTTCTCAGGCTTAGG + Intergenic
1048610245 8:136014629-136014651 CCTCATTTGTCCCCAGCCTTGGG + Intergenic
1049311417 8:141935817-141935839 GCTCTGATGTCCTCAGGCCGCGG + Intergenic
1049793428 8:144484078-144484100 CCTCTGTTGTCCTAAGGCTGGGG + Intronic
1050817252 9:9831301-9831323 TCTCTTTTAGCCTCAGGCTGAGG + Intronic
1050957839 9:11687372-11687394 CCTCTATTATCTTCAAGCTGGGG - Intergenic
1055130904 9:72773357-72773379 CCTCTTAGACCCTCAGGCTGAGG - Intronic
1055170348 9:73250051-73250073 TCTCTTTTGTCCCCAGTTTGTGG - Intergenic
1056557441 9:87701650-87701672 CCGCATTTGTCCTCAGGCCTCGG - Intronic
1057854768 9:98593867-98593889 CCTCGCTTGTCCTCCAGCTGGGG + Intronic
1058233842 9:102464337-102464359 TCACTTTTGTTCCCAGGCTGGGG - Intergenic
1059657302 9:116368487-116368509 CCTCTGTAGTCATCTGGCTGGGG - Intronic
1060549060 9:124476663-124476685 GCCCCTCTGTCCTCAGGCTGTGG + Exonic
1060813125 9:126621066-126621088 CCGCCTTTGTCCTGAGGCTCTGG + Intronic
1061006111 9:127929301-127929323 CCTCTCTGGAGCTCAGGCTGAGG - Intronic
1061145331 9:128794341-128794363 CCTCTTGTGCTCTCAGGCTAGGG + Intronic
1061909705 9:133716153-133716175 CCGTCTGTGTCCTCAGGCTGTGG + Intronic
1062544347 9:137054862-137054884 CCTCTGTTCCCCTCAGGCCGAGG - Intergenic
1203446091 Un_GL000219v1:57738-57760 CCTCCTTCATCCTCAGACTGTGG - Intergenic
1203655272 Un_KI270752v1:18054-18076 CCTGCTTTGTCTTCAGTCTGTGG + Intergenic
1187008830 X:15259171-15259193 CCTCTTTTGTCCTTAGTTTGAGG - Intronic
1188043858 X:25402965-25402987 CCTCTCCTGACCTCAGTCTGTGG - Intergenic
1188482806 X:30652639-30652661 CCTCGTTTGGCCTCACTCTGCGG - Intergenic
1189305661 X:39984870-39984892 CCTCTTTTTTCCTGAGACTTGGG - Intergenic
1189446533 X:41085827-41085849 CCCCTTCTCCCCTCAGGCTGGGG - Exonic
1190189678 X:48266838-48266860 CCTCTTCTCGCCTCAGCCTGGGG + Exonic
1192310840 X:70012947-70012969 CCTCTAATGCCCTCAGGCTCAGG + Intronic
1193213845 X:78839675-78839697 CCTCTCCTCTCCTCAAGCTGAGG - Intergenic
1193399149 X:81021498-81021520 CTTCTACTGTCCTCAAGCTGGGG - Intergenic
1193425611 X:81337792-81337814 CTTCTGTTGCCCTCAGGCTTGGG - Intergenic
1194111145 X:89836354-89836376 CCTCTCTTGTCCTCAGTCCCTGG - Intergenic
1194403677 X:93468101-93468123 CCCCTGCTGTCTTCAGGCTGGGG + Intergenic
1195674181 X:107494824-107494846 ACTCTTTATTCCTTAGGCTGGGG + Intergenic
1195713281 X:107792761-107792783 TCTCTGTTGTCCCCAGGCTGAGG + Intronic
1196357405 X:114810177-114810199 CCTTTTCTCTCCTCAAGCTGAGG + Intronic
1197623825 X:128781131-128781153 CCCCTACTGCCCTCAGGCTGGGG + Intergenic
1197913821 X:131513826-131513848 CCCCTGTTGTCCTCAGTCTGGGG - Intergenic
1199123000 X:144079758-144079780 CTTCCTTTGTTCTTAGGCTGAGG + Intergenic
1199267529 X:145845763-145845785 AGTCTTTTGTGCTCAGGCAGGGG - Intergenic
1200463805 Y:3491088-3491110 CCTCTCTTGTCCTCAGTCCCTGG - Intergenic