ID: 1165824425

View in Genome Browser
Species Human (GRCh38)
Location 19:38697747-38697769
Sequence CTCTTTTGTCCTCAGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165824418_1165824425 -2 Left 1165824418 19:38697726-38697748 CCTTGCCCTCGGGGAACAGCCCT No data
Right 1165824425 19:38697747-38697769 CTCTTTTGTCCTCAGGCTGTGGG 0: 1
1: 0
2: 2
3: 19
4: 240
1165824420_1165824425 -8 Left 1165824420 19:38697732-38697754 CCTCGGGGAACAGCCCTCTTTTG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1165824425 19:38697747-38697769 CTCTTTTGTCCTCAGGCTGTGGG 0: 1
1: 0
2: 2
3: 19
4: 240
1165824419_1165824425 -7 Left 1165824419 19:38697731-38697753 CCCTCGGGGAACAGCCCTCTTTT 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1165824425 19:38697747-38697769 CTCTTTTGTCCTCAGGCTGTGGG 0: 1
1: 0
2: 2
3: 19
4: 240
1165824412_1165824425 21 Left 1165824412 19:38697703-38697725 CCTGGCAACACCAGAGCACGGGG 0: 1
1: 0
2: 2
3: 7
4: 128
Right 1165824425 19:38697747-38697769 CTCTTTTGTCCTCAGGCTGTGGG 0: 1
1: 0
2: 2
3: 19
4: 240
1165824414_1165824425 11 Left 1165824414 19:38697713-38697735 CCAGAGCACGGGGCCTTGCCCTC 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1165824425 19:38697747-38697769 CTCTTTTGTCCTCAGGCTGTGGG 0: 1
1: 0
2: 2
3: 19
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165824425 Original CRISPR CTCTTTTGTCCTCAGGCTGT GGG Intronic
900930056 1:5730816-5730838 CTCTTTTTCCCTGAGGCTGACGG + Intergenic
903742174 1:25564674-25564696 CGCTTTTCTGCTGAGGCTGTGGG + Intronic
904696207 1:32332957-32332979 CACTTTTGCCCTGAGGCTCTGGG + Intronic
907107730 1:51899452-51899474 CTCCTTTGCCCTCTGGCTTTTGG + Intergenic
908617458 1:65938141-65938163 CTCTTATCTTCTCAGGATGTGGG - Intronic
908956987 1:69643691-69643713 CTCTTTACTCATCAGGCTGAGGG + Intronic
909431260 1:75590167-75590189 CTCTTCTGTCCTCAAGCAGAAGG - Intronic
909666753 1:78142908-78142930 CACCTTTGTTCTCAGGCTTTAGG - Intergenic
910291322 1:85602897-85602919 CTCTTTTGTCCTGCTGCTGCTGG + Intergenic
912625655 1:111203399-111203421 CTCTTTGCTCCTCAGACAGTAGG + Intronic
913081487 1:115391577-115391599 CTCTCTGGTCCTCAGGCCTTTGG + Intergenic
914410180 1:147419815-147419837 CTCCTTGTTTCTCAGGCTGTAGG - Intergenic
915525583 1:156474099-156474121 CTGTCTCGTCCTCAGGCTGCAGG + Intronic
915535825 1:156534726-156534748 CTCCTTTGCCCTCAGGTGGTCGG - Exonic
916625813 1:166553715-166553737 TTCTTTTGTCCTTAGCCAGTTGG - Intergenic
919728947 1:200900818-200900840 CTCTTCTGTCCTCAGGGCTTAGG + Intronic
920698076 1:208196879-208196901 CTCTTTTGTCCTCTGTATCTGGG + Intronic
922637239 1:227186279-227186301 CTCTTTTCTCCTCCCTCTGTTGG - Intronic
923653214 1:235892829-235892851 TTCCCTTGTCCTCAGGTTGTGGG - Intergenic
924182167 1:241449815-241449837 TACTTTTGTCCTCAGGATGGAGG - Intergenic
924844356 1:247750195-247750217 CTCCTGTGTACTCAGGCTCTAGG + Intergenic
1064313865 10:14236636-14236658 CTCTCTTGCCCTCAGGCAGTGGG - Intronic
1064353197 10:14595786-14595808 CTCTTTTGGCCTCAGCCTTTGGG - Intronic
1065836148 10:29660200-29660222 ATCTTTCTTCCTCAGCCTGTTGG - Intronic
1066053638 10:31660421-31660443 GTCTTTTATCCGCAGGCTGGAGG + Intergenic
1067178979 10:43970801-43970823 CTGCTTTGTCCTCAGGCCCTGGG - Intergenic
1067841319 10:49681712-49681734 CTCTTTTGTCCTCACCTGGTGGG + Intronic
1068661302 10:59626073-59626095 CTCATTTCTTCTCAGGCTGAAGG + Intergenic
1070029042 10:72659251-72659273 CTCTTTTGTTCTCTGGTTTTAGG + Intergenic
1070358917 10:75668227-75668249 CTCTTTTCTTCTCAGACTGGAGG + Intronic
1070557475 10:77539668-77539690 CTGTTCTGTGCTCAGTCTGTGGG + Intronic
1070948290 10:80410870-80410892 CTCTTGTTTCCTCAAGCTGTAGG - Intronic
1071519197 10:86318553-86318575 TTCTCTTGTCCTCAGGCCCTGGG - Intronic
1071620022 10:87110627-87110649 CTCTTTTCTCTTAAGCCTGTAGG + Intronic
1072437970 10:95430904-95430926 CTTCTTTGTCCTTAGGCTGAGGG - Intronic
1074241517 10:111644003-111644025 CTCTTTTGTCTTCATGGTGCAGG + Intergenic
1074491435 10:113942893-113942915 CTCTTTGCTCCTCAGCCTGCAGG - Intergenic
1075848489 10:125566818-125566840 CTTTTTGGTCCTCAGGGAGTAGG - Intergenic
1076721254 10:132394330-132394352 GCCTTTGGTCCTCTGGCTGTAGG - Intergenic
1077092657 11:786746-786768 CTCTTCTGCACTCAGGATGTGGG + Intergenic
1077502686 11:2916480-2916502 CTCTTTAGGCCACAGACTGTGGG + Intronic
1079093479 11:17496298-17496320 GGCTTTTGTCCCCACGCTGTGGG - Intronic
1080200003 11:29657837-29657859 CTCCTTTGGCCCCAGGCAGTGGG + Intergenic
1080244346 11:30162992-30163014 CATTTCTTTCCTCAGGCTGTAGG - Intergenic
1080988929 11:37506646-37506668 TTATTTTGACCTCAGCCTGTTGG + Intergenic
1081365893 11:42234547-42234569 CTCTTCAGCCCTCAGGCTGCTGG - Intergenic
1082225564 11:49702834-49702856 CTCTCTTTTCCTCAAGCTGGAGG + Intergenic
1082650670 11:55787836-55787858 GTCTTTGTTCCTGAGGCTGTAGG - Intergenic
1083381525 11:62273376-62273398 CTCTGGAGTCCTCAGGCTCTGGG + Intergenic
1083698580 11:64458764-64458786 TTGCTTTGTCCTCAGTCTGTGGG - Intergenic
1084588391 11:70076756-70076778 CTATTTGGTTCTCAGGCTGGTGG - Intergenic
1084974777 11:72790728-72790750 CACTCTTGGCCTCAGGTTGTGGG + Intronic
1085201602 11:74705454-74705476 CTCTTGTGAGCTCAGGCTCTGGG - Intronic
1086331181 11:85755905-85755927 CTCTTTCTACCTCAGGATGTGGG - Intronic
1086623513 11:88916748-88916770 CTCTCTTTTCCTCAAGCTGGAGG - Intronic
1088471069 11:110187819-110187841 CTCTTTTTTCCTCAGGCAATGGG - Intronic
1089321748 11:117631169-117631191 CTCTTGTGTCCTCAGGCTATAGG - Intronic
1089762258 11:120736335-120736357 CTCTTCTGTCCTCAAGCAGAAGG + Intronic
1093264889 12:16991151-16991173 CTCATATGTCTTCTGGCTGTAGG - Intergenic
1096788220 12:54029898-54029920 CTCTTTTCCGCCCAGGCTGTCGG - Exonic
1097565604 12:61265136-61265158 CTTTTTTCTCCTCAGCCTCTGGG - Intergenic
1098677942 12:73315242-73315264 CTCTTTTTTCCTCGGGCACTGGG + Intergenic
1100433625 12:94552190-94552212 CTCTTTACACTTCAGGCTGTGGG - Intergenic
1100781205 12:98028533-98028555 CTCTCTAGTCCACAGGGTGTTGG + Intergenic
1101573198 12:105974137-105974159 CTCTTTTGGCCTTGGGCTCTTGG - Intergenic
1102791903 12:115653550-115653572 ATCTGTTGTCCTCAGGCCCTTGG - Intergenic
1102809998 12:115815936-115815958 CTCTTTCCCCCTCAGGCTGCGGG - Intergenic
1104158057 12:126152363-126152385 CTCTTTTCCCCGCTGGCTGTCGG - Intergenic
1104554977 12:129791326-129791348 CTCTTTTGTTGTCAGGCTGCAGG - Intronic
1105835560 13:24208125-24208147 TTCTTTTGTCAGCAGGCTGGAGG + Intronic
1106590398 13:31093583-31093605 TTCTTCTGTCCTCAGGCTAATGG + Intergenic
1107175533 13:37394621-37394643 CCCTGTTGCCCTCAGGCTCTCGG + Intergenic
1108147735 13:47497700-47497722 CTCTTCAGGCCTCAGGCTCTTGG - Intergenic
1108490765 13:50978877-50978899 CTGTTCTGTCTTCAGGCTCTAGG + Intergenic
1109627958 13:65002312-65002334 CTCTTTGGTTCTCAGGCCTTTGG + Intergenic
1110217151 13:73035800-73035822 CTGTTTTATCCTGAGGCTATTGG - Intergenic
1111620464 13:90718269-90718291 CTATTATGACCTCAGGCTATAGG + Intergenic
1116458500 14:45145228-45145250 CTCTTTTTTCCTCAAGCAGAAGG + Intronic
1116497126 14:45574730-45574752 CTCTCTTGTCCTCTGGCTCCTGG + Intergenic
1117379736 14:55149422-55149444 CTTTTTTGTGGTCAGGCTCTGGG - Intronic
1118691293 14:68342874-68342896 CTTTGTTGTCCTCTGGATGTTGG + Intronic
1119441208 14:74630000-74630022 CTCCTTTTTCTTCAGGCTGAGGG - Intergenic
1120328809 14:83061292-83061314 AGCTTTTGTCCTAAAGCTGTAGG + Intergenic
1125514431 15:40309719-40309741 CCCTTTCCTCCTCAGGCTGAGGG - Intergenic
1125921191 15:43526904-43526926 CTCTCTTGTCCTGGGGCTGAAGG - Exonic
1126438685 15:48663712-48663734 ATTTGTTGTCCTGAGGCTGTAGG - Intergenic
1126440486 15:48683244-48683266 CTCTCTTCTCCTCAGGCAGAAGG - Intergenic
1128625520 15:69198512-69198534 TTCATTTCTTCTCAGGCTGTTGG + Intronic
1131417782 15:92275969-92275991 CTTTTTTGCCCTCTGGCTATTGG + Intergenic
1132394538 15:101463185-101463207 CTCCTTTGCCCTCTGACTGTGGG + Intronic
1132913291 16:2326953-2326975 CTCTGTTGCCCCCAGGCTGGAGG - Intronic
1133501284 16:6369528-6369550 CTCTTTAGTCCTAAAGTTGTTGG + Intronic
1135851652 16:25969252-25969274 CTCTTTTGCTCTCATACTGTGGG + Intronic
1136221141 16:28829806-28829828 CTCTTTTGTCCCCTGGCACTGGG + Intronic
1136519664 16:30787276-30787298 CCCTTTTTTCCCCAGGCTGCGGG - Intergenic
1140202432 16:72905378-72905400 CTCAGTTGTCCTCTGGCTGGGGG - Intronic
1143172627 17:4938968-4938990 CCCTCTGCTCCTCAGGCTGTCGG - Exonic
1143870888 17:9956675-9956697 CTCCTTTTTCCCCAGGCTATGGG - Intronic
1144233985 17:13238950-13238972 CTCTCTTGTCCTCAGGTTTCTGG - Intergenic
1144576830 17:16434875-16434897 CTCTGTTGCCCTCAGGGTGGAGG + Exonic
1146372926 17:32276472-32276494 CCCTTTTGGGCTCTGGCTGTTGG + Intronic
1149194942 17:54108339-54108361 CTCTTTTGCCCTCACGCATTTGG - Intergenic
1149311746 17:55401190-55401212 CGCTCTGTTCCTCAGGCTGTAGG + Intronic
1151979899 17:77502566-77502588 CTCTTTTGGAATCAGGCTGCAGG - Intergenic
1152167161 17:78717200-78717222 CTCCATTGTGCTCAGGCTGCCGG - Intronic
1152299406 17:79486283-79486305 CCCTTTTGTCCCCAGGAAGTGGG - Intronic
1153029806 18:703121-703143 CTCTTTTGTGCTAAGGGTTTTGG - Intronic
1153397510 18:4641231-4641253 TTCTTGTGTCCTCAGGCAGCTGG - Intergenic
1153681917 18:7509013-7509035 TGCTTTTGTCCTCAGCCTGTGGG + Intergenic
1158045691 18:53152972-53152994 CTCTTTTCTCCTTAGGCTTCAGG - Intronic
1159078655 18:63710164-63710186 CCCTTCTGTTCTCAGGCAGTCGG + Exonic
1159751054 18:72303021-72303043 CTCTTTGGTGTTCAGCCTGTAGG - Intergenic
1160282228 18:77502025-77502047 ATGTTTTGGCCTCAGGCTATAGG + Intergenic
1160820565 19:1055900-1055922 CTTCTTAGTCTTCAGGCTGTGGG - Exonic
1162360992 19:10220389-10220411 CTCTTTTGTCTGCAGGCAGCCGG - Intronic
1163462577 19:17448050-17448072 CTCTTTTGGCCTCAGGCTGGGGG - Intronic
1164624241 19:29715629-29715651 CTCTTCTGTGCCCAGGCTGCGGG - Intronic
1164677527 19:30111761-30111783 CTCTTTTGCACTGAGGCTGAGGG + Intergenic
1164829293 19:31308461-31308483 CCCTTGTGTCCCCAAGCTGTGGG - Intronic
1165824425 19:38697747-38697769 CTCTTTTGTCCTCAGGCTGTGGG + Intronic
1166536187 19:43576405-43576427 CTCTTTTGGCCTCAGGCATAAGG - Intronic
1167216333 19:48167971-48167993 CTCCTTTGCCCTCAGGATTTTGG - Intronic
926005979 2:9373716-9373738 CGCATTTGTCCTCAGATTGTAGG + Intronic
927855115 2:26523000-26523022 CTCTATTGTGATCAGTCTGTGGG - Intronic
927923393 2:26991417-26991439 TTCTTTTGTGGTGAGGCTGTAGG - Intronic
928483226 2:31704699-31704721 CTCTGATGTCCTGAGGCTGCTGG + Intergenic
929457157 2:42074206-42074228 CACTTCTGCCCTCAGGCTGGAGG + Intergenic
931223680 2:60310701-60310723 CTCTTTTCTCCTTAGGCGGCTGG - Intergenic
933767298 2:85718939-85718961 CTCCTTCCTCCCCAGGCTGTGGG + Intergenic
934590640 2:95547027-95547049 GTCCTTTTTCCTCAGCCTGTTGG + Intergenic
935219788 2:101002462-101002484 CACTTTCTTCCTCAGGCTCTGGG - Intronic
938072676 2:128316907-128316929 CTCTTGGGTCCAGAGGCTGTAGG - Intronic
940927791 2:159386121-159386143 TTCTTTTTTCCTCTAGCTGTAGG - Intronic
944760431 2:202808360-202808382 CTCTTTTTTCCTCATGCGGAAGG - Intronic
944950560 2:204744247-204744269 ATCTTTTGTCCACAGTCTGTCGG - Intronic
945035550 2:205700913-205700935 CCCTTTTGTCCTTTGGCTGCAGG - Intronic
946414795 2:219534575-219534597 CTCCCTTGTCCTCTGGCTTTGGG - Intronic
946445378 2:219735223-219735245 CTGTTGTGTCATCAGGCTGAGGG + Intergenic
947228317 2:227860837-227860859 CTCTTTCTTTCTCAGACTGTTGG - Intergenic
948673726 2:239584866-239584888 CCCTTTTGTCTTCTGCCTGTGGG + Exonic
1171108617 20:22459802-22459824 CCCTGTTTGCCTCAGGCTGTGGG - Intergenic
1171162635 20:22941812-22941834 CTCCCTTTTCATCAGGCTGTAGG - Intergenic
1173367861 20:42403894-42403916 CTCTTTTCTCCTCATTCTATGGG + Intronic
1173667421 20:44772805-44772827 CTCTCTTGTCCTCTGGCAGGAGG - Intronic
1173864864 20:46307460-46307482 CTCTTTGGACGTTAGGCTGTCGG + Intronic
1174159274 20:48539275-48539297 CTTTTTTCCCCTCAGACTGTGGG + Intergenic
1176063981 20:63184744-63184766 CTGTTTGGTCCTTAGGCTCTTGG - Intergenic
1178755311 21:35344000-35344022 TTCTTTTCTCCTTAGGCTATTGG - Intronic
1179110636 21:38442360-38442382 CTCTTTTTTACCCAGGCTGCAGG - Intronic
1181161301 22:20961528-20961550 CTCTCCTGTCCCCAGGCTCTGGG - Intergenic
1181685212 22:24523332-24523354 TTCTGTTTTCCTTAGGCTGTGGG + Intronic
1182504747 22:30773698-30773720 CACTTTGGTCCACAGGCTCTGGG + Intronic
1185161860 22:49234759-49234781 CTCTGCTGGCCTCAGGCTGCTGG - Intergenic
951054762 3:18134979-18135001 TTCTTTTGTCCTTTGGCCGTGGG + Intronic
951085262 3:18505280-18505302 CTCATGTGTTCTTAGGCTGTAGG + Intergenic
951637307 3:24793837-24793859 CTCTTTTGTCCCTTGGCTCTAGG - Intergenic
951873174 3:27389703-27389725 CTTTTTAGTCCTTAGGCTATAGG - Intronic
952919185 3:38273279-38273301 CTCTTGGTTTCTCAGGCTGTGGG + Intronic
953103304 3:39851460-39851482 CACTTTTTTCCTCAGGGTGTGGG + Intronic
953201585 3:40782613-40782635 CTCTTCTCTCCTCAGGCAGAGGG + Intergenic
955878766 3:63521932-63521954 CTCTTTTGTCCTCTGGTTTCTGG - Intronic
957480935 3:80792816-80792838 CTATTTTGTGCTAAGCCTGTAGG - Intergenic
959981684 3:112524691-112524713 TTCTTTTTTCCTTAGCCTGTTGG - Intergenic
960160051 3:114340432-114340454 CTCCTTTGCTCTCAGCCTGTTGG + Intronic
961952238 3:130762216-130762238 CTCTTTTCTCCTCAAGCAGAAGG - Intergenic
962438724 3:135392133-135392155 CTTTTTTTTCCCCAGGCTGTGGG - Intergenic
963447995 3:145439727-145439749 CTCTCTTCTCCTCAGGCAGAAGG - Intergenic
963471381 3:145746623-145746645 CTCATTATTCCTCAGGCTGTAGG - Intergenic
963862465 3:150325221-150325243 CTCTTTTGTCCACCTGCTGCAGG + Intergenic
965881524 3:173394293-173394315 CTCTTGTATCCCAAGGCTGTGGG - Intergenic
966160829 3:176966531-176966553 ATCTTCTGTCCTGTGGCTGTCGG - Intergenic
966620358 3:181956398-181956420 CCCTTCTGCCCTCAGGCTGTGGG + Intergenic
968486736 4:866569-866591 CTCCTTTGTCTTCAGGCAGCCGG - Intronic
970537313 4:17042497-17042519 CTCTTTTGCCCCCAGGCTCCTGG - Intergenic
970934741 4:21556086-21556108 CCCTTTTGTCGAAAGGCTGTTGG - Intronic
971633380 4:29025217-29025239 CCCTTTTGTCCTCTGGCATTTGG + Intergenic
981339227 4:143601400-143601422 ATATTTTGTCCTGAGGCAGTAGG - Intronic
981908082 4:149945667-149945689 CTCTTTTGACTTCTGGCTATCGG - Intergenic
986509233 5:8485792-8485814 CTCTTTTATGCTCAAGTTGTGGG + Intergenic
987092937 5:14523478-14523500 CTCTCCTGTCCTCTGGCTTTTGG - Intronic
987390491 5:17370622-17370644 CTCTTAAGGCCTCAAGCTGTGGG + Intergenic
989536182 5:42566224-42566246 GTCTCTTGTTCTCAGGCTTTGGG + Intronic
989632105 5:43495955-43495977 CTCTTCTCTCTTCTGGCTGTAGG + Intronic
990986155 5:61642675-61642697 CTCTCTTATCCTGAAGCTGTTGG + Intronic
992747185 5:79831402-79831424 CTGCTTGGTCCTCAGCCTGTTGG - Intergenic
993496296 5:88613193-88613215 CTCTTTCATCCTCAGGATTTTGG - Intergenic
998210239 5:140191379-140191401 TGCTTTTTTCCTCAGGCAGTTGG + Intronic
998426933 5:142036797-142036819 CTCTTCTGAACTGAGGCTGTTGG + Intergenic
1000484657 5:161826081-161826103 CTCTTTTCTCCTTAGGATATTGG + Intergenic
1001954239 5:175837367-175837389 CCCTTTTGTCTTCAGGCTGCAGG + Intronic
1002948643 6:1786619-1786641 CTCTGTTGTGCTCAGTCTGTAGG - Intronic
1003840055 6:10111032-10111054 CTCCCTTGTCCTCTGGCTGCTGG + Intronic
1004360652 6:14967887-14967909 CTCTGTTTACCCCAGGCTGTTGG - Intergenic
1004579906 6:16940121-16940143 CTTTTAGGTCCTCAGCCTGTGGG - Intergenic
1006918047 6:37608681-37608703 CTCTTTTGTCTCAAGGCTGAAGG - Intergenic
1007724463 6:43906700-43906722 ATCTTTTTGCCTCAGGCTGCTGG + Intergenic
1007767872 6:44171701-44171723 TACTTTTGGCCTCAGGCTCTAGG - Intronic
1008415896 6:51239644-51239666 CTCTTATGTGCTCAGGCTCCAGG + Intergenic
1008764229 6:54891786-54891808 CACTTTTGTCATCAGGCACTGGG + Intronic
1013097352 6:106957709-106957731 CTCTTTTGGCCTCTGGCTACTGG - Intergenic
1014697622 6:124643371-124643393 GTCTTTTTTCCCCTGGCTGTGGG + Intronic
1017410811 6:154165902-154165924 CTCAGTTGCCCTCTGGCTGTTGG - Intronic
1017544612 6:155437683-155437705 CACTTTCATTCTCAGGCTGTAGG + Intronic
1017995022 6:159524917-159524939 GGCTTTTCTTCTCAGGCTGTTGG + Intergenic
1018527716 6:164732024-164732046 TTCTTTTGTCCTCATGTAGTTGG + Intergenic
1019079388 6:169419861-169419883 GTCTTTTGTGCTCAGGTTATGGG + Intergenic
1020086595 7:5313741-5313763 CTCGCTTGTCCACAGGCTCTGGG + Exonic
1022037023 7:26544309-26544331 CTCCTTTGTCCTCATTCTGAGGG - Intergenic
1022297726 7:29071897-29071919 CTTTTTTGTCCTCAGATTATAGG - Exonic
1025207718 7:57003397-57003419 CTCGCTTGTCCACAGGCTCTGGG - Intergenic
1025664218 7:63573475-63573497 CTCGCTTGTCCACAGGCTCTGGG + Intergenic
1026653013 7:72232054-72232076 CTCCTTTGGCCCCAGCCTGTAGG - Intronic
1026906710 7:74066889-74066911 CTCGTGTGACCTGAGGCTGTGGG - Intronic
1027571398 7:79871789-79871811 CTCTTTTGTTCTGAGACTTTGGG - Intergenic
1028127301 7:87128209-87128231 CTCTTTTGCACTTAGGTTGTGGG + Intergenic
1028628961 7:92912551-92912573 CTCTTTTGTAATCAGTCTGATGG + Intergenic
1029161247 7:98553736-98553758 CTCTTTTAAGCACAGGCTGTAGG + Intergenic
1030073965 7:105720947-105720969 CTCTTCAGACCTCGGGCTGTAGG + Intronic
1030136134 7:106251487-106251509 CTTTTTTTTCCTCAGGCTGAAGG + Intronic
1031123802 7:117750294-117750316 TTCATTTGTTCTCAGACTGTAGG + Intronic
1031216462 7:118899299-118899321 CTCTTTTTTCCTCAAGTTGGTGG + Intergenic
1031335270 7:120522171-120522193 CCCTTTTGTCCTCATCCTGTTGG + Intronic
1031638345 7:124130048-124130070 GTGTTTGGTCCTCTGGCTGTTGG + Intergenic
1033648268 7:143321472-143321494 CTCATCTCTCCCCAGGCTGTTGG + Exonic
1035388233 7:158488772-158488794 CGCATCTGTCCTCAGACTGTGGG - Intronic
1036819516 8:11929068-11929090 GTCCTTTTTCCTCAGCCTGTTGG - Intergenic
1036832688 8:12034117-12034139 GTCCTTTTTCCTCAGCCTGTTGG - Intergenic
1038770961 8:30479300-30479322 CTTTTTTTTTCTCAGCCTGTAGG + Exonic
1039520133 8:38163648-38163670 ATCTTTTGCCCAGAGGCTGTTGG - Exonic
1044520330 8:93192078-93192100 TTTTTTTTTCCTTAGGCTGTAGG - Intergenic
1046739002 8:117809010-117809032 CTCCCTGGTTCTCAGGCTGTAGG + Intronic
1047188253 8:122655135-122655157 TTTTTCTGTCCTCTGGCTGTAGG - Intergenic
1047623830 8:126635362-126635384 TTCTTTTGTGCTCAGTCAGTGGG - Intergenic
1049714223 8:144082383-144082405 CTCTGCTGTCCTCCGGCTGTAGG + Intergenic
1050572353 9:6954248-6954270 CTCTTTTCTCCTGAGACTCTTGG + Intronic
1053455577 9:38230935-38230957 CTCCTTTGCCCTCAGGCATTAGG + Intergenic
1054955251 9:70902329-70902351 CTCTGTTGTACTCAGGATTTGGG + Intronic
1055502616 9:76916633-76916655 CTCTTTTGTCATAGGGTTGTTGG + Intergenic
1055996772 9:82168549-82168571 TTCTTTTGTCCTAGGGTTGTTGG + Intergenic
1056330443 9:85516900-85516922 CTCTTTTTTTCTCAGTCTGTTGG + Intergenic
1056438776 9:86598928-86598950 CTTTTTTCTCCTCAGCCTTTTGG + Intergenic
1057104413 9:92398157-92398179 CTTTTTTGTCCTTAGCCTGAAGG + Intronic
1058837786 9:108874963-108874985 CTATTTTCTCCTCAGGTTCTAGG - Exonic
1059751984 9:117256251-117256273 CTCTTTTGTTCAGAGGCTGCTGG + Intronic
1060304432 9:122398129-122398151 CTCTTCTCTCCTCAAGCTGAAGG - Intergenic
1060391353 9:123280030-123280052 CTCTTTTGTCCTGACACTCTTGG - Intergenic
1061528793 9:131193417-131193439 CTCTTTTCTCCTTAGGCTGAAGG - Intronic
1061859082 9:133458984-133459006 CGCTGTGGTCCTCAAGCTGTGGG - Exonic
1062722468 9:138051571-138051593 CTCTTCTGTCTTCCCGCTGTCGG + Intronic
1186515257 X:10161928-10161950 CTCAGTTCTTCTCAGGCTGTTGG - Intronic
1186873087 X:13791712-13791734 ACCTTTTGTCCTCAGGCTTGTGG + Intronic
1189176076 X:38958770-38958792 CTCTTTGATCTTCAGGGTGTTGG + Intergenic
1189789483 X:44589689-44589711 CTCTCTGTTGCTCAGGCTGTAGG - Intergenic
1191204788 X:57822296-57822318 CCCTTGTGTCCTCAGGGTGCTGG - Intergenic
1193535515 X:82710428-82710450 CTCTTTTATCTACAAGCTGTTGG - Intergenic
1193961378 X:87928995-87929017 GTCTTTTGGGCACAGGCTGTAGG - Intergenic
1196746513 X:119075340-119075362 GTCTTTTGTCCTCTAGCTGCAGG + Intergenic
1197112863 X:122797360-122797382 CTCTCTTCTCCTCAAGCTGAAGG - Intergenic
1197176582 X:123492764-123492786 CCCTTTTGTCCTCACTCTGTTGG + Intergenic
1197211678 X:123833293-123833315 CTCCTTTGTCCTCAGCTTCTGGG - Intergenic
1197701644 X:129604522-129604544 CTCTCTTGTCTTCAGACTGCAGG - Intergenic
1199267528 X:145845762-145845784 GTCTTTTGTGCTCAGGCAGGGGG - Intergenic