ID: 1165824427

View in Genome Browser
Species Human (GRCh38)
Location 19:38697758-38697780
Sequence TCAGGCTGTGGGATGTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165824419_1165824427 4 Left 1165824419 19:38697731-38697753 CCCTCGGGGAACAGCCCTCTTTT 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1165824427 19:38697758-38697780 TCAGGCTGTGGGATGTGTCTTGG 0: 1
1: 0
2: 2
3: 18
4: 241
1165824418_1165824427 9 Left 1165824418 19:38697726-38697748 CCTTGCCCTCGGGGAACAGCCCT No data
Right 1165824427 19:38697758-38697780 TCAGGCTGTGGGATGTGTCTTGG 0: 1
1: 0
2: 2
3: 18
4: 241
1165824414_1165824427 22 Left 1165824414 19:38697713-38697735 CCAGAGCACGGGGCCTTGCCCTC 0: 1
1: 0
2: 0
3: 16
4: 188
Right 1165824427 19:38697758-38697780 TCAGGCTGTGGGATGTGTCTTGG 0: 1
1: 0
2: 2
3: 18
4: 241
1165824420_1165824427 3 Left 1165824420 19:38697732-38697754 CCTCGGGGAACAGCCCTCTTTTG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1165824427 19:38697758-38697780 TCAGGCTGTGGGATGTGTCTTGG 0: 1
1: 0
2: 2
3: 18
4: 241
1165824422_1165824427 -10 Left 1165824422 19:38697745-38697767 CCCTCTTTTGTCCTCAGGCTGTG 0: 1
1: 0
2: 1
3: 26
4: 283
Right 1165824427 19:38697758-38697780 TCAGGCTGTGGGATGTGTCTTGG 0: 1
1: 0
2: 2
3: 18
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165824427 Original CRISPR TCAGGCTGTGGGATGTGTCT TGG Intronic
900487335 1:2929452-2929474 CCATGCTGTGGGATTTGTTTTGG - Intergenic
901939640 1:12652202-12652224 TGAGGCTGTGGGAGGAGTCTGGG - Intronic
902426164 1:16323886-16323908 TCATGCTGTGGGATGACTGTGGG - Intronic
903318664 1:22528324-22528346 ACAAGCTGTGGGATGGGGCTTGG + Exonic
903646424 1:24898840-24898862 CCAGGCTCTGGGCTGTGTGTTGG + Intergenic
905272223 1:36794519-36794541 TCAGGGTCTGAGATGTGTCAGGG + Intergenic
905469229 1:38179383-38179405 TAACGCTGTGGGAGGTGTTTGGG - Intergenic
906777226 1:48540754-48540776 TCAAGATATGGGAGGTGTCTTGG - Intronic
908475103 1:64479572-64479594 TCAAGCTGGGGGCTGTTTCTTGG + Intronic
913177623 1:116289307-116289329 GCAGGCTGTGGGCTGGGTTTGGG - Intergenic
913229152 1:116727096-116727118 TCACTCTGTGGGAGGTGGCTTGG - Intergenic
913421788 1:118678213-118678235 TCAGGGTGTGAGATGTGTTTGGG - Intergenic
916520721 1:165561313-165561335 GGAGGGTCTGGGATGTGTCTAGG - Intronic
917719986 1:177778115-177778137 TCAGGCTGTTGGATGCATTTCGG + Intergenic
918046766 1:180946241-180946263 TCCGGCTGTGGAGTATGTCTGGG + Exonic
918235879 1:182580489-182580511 TGATGCTGTGGGATGTGTGCTGG - Intronic
919467950 1:197944945-197944967 ATACCCTGTGGGATGTGTCTAGG + Intergenic
920111398 1:203589825-203589847 TCAGTCAGTGGGATGTGTGAGGG - Intergenic
920387059 1:205576677-205576699 TCTGGCTCTGGGATGTGTCTGGG + Intronic
920542581 1:206790667-206790689 TAAGGCTCTGGCAGGTGTCTGGG + Intergenic
921502087 1:215916935-215916957 TCAGTCTGTCTGATGTTTCTTGG - Intronic
924433326 1:244016423-244016445 TGAGGCTTTGGGAGGTGACTAGG + Intergenic
1064133094 10:12727599-12727621 TCAGGCTGTGGTGTGTTTCCAGG - Intronic
1065566828 10:27019935-27019957 TCAGGCTTTGAGCTGTGTCCAGG - Intronic
1065955064 10:30686256-30686278 CAAGGCAGTGGGATGTCTCTGGG + Intergenic
1065962431 10:30744746-30744768 TCATGTTGTGGAATGTGTTTTGG - Intergenic
1066124592 10:32328431-32328453 TCAGGCTCTGGGTTGTTTGTTGG - Intronic
1067343732 10:45423435-45423457 GCAGGGTGTGGGATGGGTCCAGG - Intronic
1069964644 10:72104243-72104265 TCAGTCTTTGGGAGTTGTCTGGG - Intronic
1074286538 10:112103156-112103178 TCAGGGTTTGGTATGTGTGTTGG - Intergenic
1074297557 10:112204643-112204665 ACAGGCTGTGGGCTGTTTATAGG + Intronic
1075373743 10:121960611-121960633 TCAGGATGGAGGCTGTGTCTGGG - Intronic
1075680090 10:124325422-124325444 TCAGGCCTGGGGATGGGTCTGGG - Intergenic
1075788443 10:125066257-125066279 TTAGGATTTGGGATGTGGCTTGG - Intronic
1075798333 10:125136328-125136350 CCAGACAGGGGGATGTGTCTGGG - Intronic
1076675063 10:132143317-132143339 TGAGGCTCTGGGATGTCTCGGGG - Intronic
1077088169 11:765127-765149 CCAGGCGGTGGGTTGTGTCTGGG - Intergenic
1077502701 11:2916547-2916569 GCAGGTTGGGGGATGTGGCTGGG + Intronic
1078432781 11:11300660-11300682 TCAAGCTGTGGGCTGGATCTTGG + Intronic
1083103702 11:60336767-60336789 TATGGCTGTGGGATGTGCCCTGG + Intronic
1083294881 11:61709958-61709980 TCAGGCTGTGGGTTGGCCCTCGG - Intronic
1083963085 11:66025377-66025399 TCAGGCTCCGGGATGTGTGTGGG + Exonic
1084909838 11:72379579-72379601 AGAGGCTCTGGGATGAGTCTTGG - Intronic
1085076748 11:73598216-73598238 TGAGGCTGTGGGACGTGTCGCGG - Intergenic
1088504180 11:110513019-110513041 CCAGGCTGTAGGATGTGAGTGGG - Intergenic
1088637493 11:111837263-111837285 TTAGGCTGAGGGCTGGGTCTAGG - Intronic
1088917219 11:114236771-114236793 TCAGGCTGTGTACTGTGTGTTGG + Intronic
1089677424 11:120099155-120099177 ACAGACTGTGGTATGGGTCTAGG - Intergenic
1090061121 11:123464974-123464996 ACAGGCTGTGCGATGAGCCTAGG + Intergenic
1090258645 11:125303330-125303352 ACAGGCTGAGGAATGTGCCTGGG + Intronic
1091545131 12:1496472-1496494 TCCAGCTTTGGGATTTGTCTTGG + Intergenic
1091562025 12:1622051-1622073 TCAGGATGTGGGATTTGAGTAGG - Intronic
1093415405 12:18914684-18914706 ACAGGATGCGGGATGTGTCAGGG - Intergenic
1093679253 12:21981894-21981916 TTAGGGTGGGGGATGTGTCTTGG - Intergenic
1096154759 12:49335866-49335888 TCAGGTTGTGGGATGAGTGCAGG + Intronic
1096526297 12:52212240-52212262 TCAGGCTGTGGCACGGCTCTTGG - Intergenic
1096538352 12:52289427-52289449 GTTGGATGTGGGATGTGTCTGGG + Intronic
1096540425 12:52303937-52303959 GTTGGATGTGGGATGTGTCTGGG - Intronic
1096552916 12:52385323-52385345 GCTGGCTGTGGGATGGGTTTTGG - Exonic
1097191259 12:57220656-57220678 TCAGGCTGTGGGAGGGGGCCAGG - Intronic
1097314367 12:58156125-58156147 TCAGGCTTTGGGATTTGAATTGG - Intergenic
1101519770 12:105470857-105470879 TCAGGCTGTGGTGAGTGGCTGGG + Intergenic
1101734792 12:107454871-107454893 TCAGTCTTTGGTATGTGTCAAGG + Intronic
1102222504 12:111204029-111204051 CCAGGCTATGGGAGGTGCCTGGG - Intronic
1102871905 12:116420356-116420378 GGGGGCTCTGGGATGTGTCTGGG - Intergenic
1104809330 12:131611086-131611108 TCGGGCTGTGGGCTGTTTCTTGG + Intergenic
1107737182 13:43411980-43412002 CCAGGCTGTGGGATCTGTCACGG + Exonic
1107793156 13:44022978-44023000 TGAGTCTGTGGGAAATGTCTTGG - Intergenic
1110748777 13:79088395-79088417 TCAGGGTCTCAGATGTGTCTAGG + Intergenic
1115153204 14:30309148-30309170 TCAGGCTGGAGGGTGTGGCTGGG - Intergenic
1116581962 14:46653368-46653390 TGAGACTGTGGGATGAGGCTGGG + Intergenic
1118319846 14:64746691-64746713 TCTGGCTGTGGGAGGTGTGGAGG - Exonic
1121096342 14:91220443-91220465 TCAGGCTGGGGCAGGTGTCAGGG + Intronic
1122626559 14:103088081-103088103 GCAGGCTGTGGCAGGTGCCTGGG + Intergenic
1122954722 14:105065313-105065335 CCAGGCTCTGGGATGGGGCTGGG - Intronic
1125478349 15:40062897-40062919 TCAGGCTTCTGGAGGTGTCTAGG + Intergenic
1127956982 15:63862432-63862454 TGAGGCTGTGGGACCTTTCTGGG - Intergenic
1128606187 15:69038247-69038269 TGAGGCTGTGCTCTGTGTCTAGG + Intronic
1128795403 15:70462976-70462998 TCTGGCTGTGAGATGAGGCTGGG - Intergenic
1129324300 15:74791948-74791970 TTAGCCTGTGGGATGGGACTTGG + Intronic
1129536003 15:76314062-76314084 TGAGGCTTTGGGATGTATCAGGG + Intergenic
1130983345 15:88828120-88828142 TCAGGCTGGGGGAGGTTTCCAGG + Intronic
1132479653 16:160668-160690 ACAGGCTGTGAGAGGTGCCTGGG + Intronic
1133751647 16:8730542-8730564 TCCAGCTGTGGGATCTCTCTAGG + Intronic
1134078825 16:11310882-11310904 ACAGGCTCTGGGATATGTGTGGG + Intronic
1135182236 16:20285744-20285766 TCAGTCTTTGTGATGTGTCAAGG + Intergenic
1135617814 16:23927361-23927383 TCAGGGTAGGGGATGTGTTTAGG + Intronic
1136477448 16:30522310-30522332 TCAGGCAGAGGGAGCTGTCTGGG - Exonic
1137269599 16:46894533-46894555 CCTGGCTGTGGGATGAGTGTGGG + Intronic
1138763628 16:59573055-59573077 TTAGGGTGTGGGAGGAGTCTAGG + Intergenic
1139375460 16:66493876-66493898 TCAGGGCGTGGGATGCCTCTAGG - Intronic
1140178657 16:72691588-72691610 TCAAGTTGGGGAATGTGTCTAGG + Intergenic
1140312986 16:73867037-73867059 TCAGTCTATGGGATGCCTCTGGG - Intergenic
1141096673 16:81167972-81167994 TCAGGCTGTGGGCAGTGTGCTGG - Intergenic
1142225511 16:88875388-88875410 TCTGGCCCTGGGGTGTGTCTCGG - Exonic
1144585693 17:16486311-16486333 TGAGGCTGTGGGATGGGGTTGGG - Intronic
1144754278 17:17669815-17669837 CCAGGCTGTGGGATGGGGGTGGG - Intergenic
1145207959 17:20994720-20994742 TCAGGCTGGGGGATATGTGATGG - Intergenic
1145242028 17:21245733-21245755 TCAGGCAGAGGGAAGTGCCTAGG - Intronic
1145987368 17:29056058-29056080 TCTGGCTTTGGGATGTGACCAGG + Intronic
1146561270 17:33872295-33872317 TCAGGCTGTGTGTAGGGTCTTGG - Intronic
1148786109 17:50147066-50147088 ACAGGCTGTGAGGTGTGTTTTGG - Intronic
1148896660 17:50842930-50842952 ACAGGCTGTGGGGTGTGCCATGG - Intergenic
1150821250 17:68436088-68436110 TCAGGCTGTGGCATGGGACAGGG + Intronic
1151236081 17:72720576-72720598 TCTAGCTGTAGGATGTGTCATGG + Intronic
1151499640 17:74480590-74480612 TCAGACTGTGGGAAGTTGCTGGG - Intronic
1151661909 17:75523659-75523681 TCAGGCTGTTGGAGAAGTCTGGG + Exonic
1151692436 17:75694797-75694819 GCAGGCAGTGGAATGTGTGTGGG + Intronic
1156201024 18:34831830-34831852 TCAGGATTTGGGAAGTATCTGGG - Intronic
1156447727 18:37249561-37249583 TGAGGGTGTGTTATGTGTCTAGG - Intronic
1158762541 18:60407458-60407480 TCAGGTAGTGTGATGTTTCTGGG - Intergenic
1158845680 18:61440322-61440344 TCAGGCTGTGGGTAGGGTCCAGG - Intronic
1159877291 18:73826971-73826993 TGAGGCTGTGGCAGGAGTCTGGG + Intergenic
1160221241 18:76979568-76979590 TCCGGCTGTGGGCTGTGGTTTGG + Intronic
1160227942 18:77025832-77025854 TCAGGGTGTGGGGTGTGCCTGGG - Intronic
1160890935 19:1378452-1378474 CCATGCAGTGGGATGTGTTTGGG - Intergenic
1161785320 19:6321487-6321509 CCAGGCGGTGGGATGTGCCAAGG - Intronic
1162466895 19:10847814-10847836 TTAGGCTATGGTTTGTGTCTTGG + Intronic
1162474852 19:10893808-10893830 TCACCCTTTGGGATGTGTCAGGG + Intronic
1162831687 19:13288595-13288617 TGAGGCTGTGGGATCTCTCCTGG - Intronic
1163369505 19:16894076-16894098 TCAGGCTGTGGGAGCTGCCGTGG + Intronic
1163766184 19:19164768-19164790 TCAGACTGCGGGGTCTGTCTTGG - Intronic
1164744759 19:30603017-30603039 TCAGTCTGTGAGGTGTGTCCAGG + Intronic
1165126542 19:33601978-33602000 TCAGGGTCTGGGGTCTGTCTTGG - Intergenic
1165824427 19:38697758-38697780 TCAGGCTGTGGGATGTGTCTTGG + Intronic
1165922064 19:39305413-39305435 TGAGGCTGAGGGCTGTGGCTGGG - Intergenic
1166803707 19:45472802-45472824 TCAGGTTGGGGGGTGCGTCTTGG - Exonic
1167713906 19:51128546-51128568 TCATCCTGTGGGAGGTGTCCAGG - Intronic
1167803872 19:51765677-51765699 CCAGGCTGTGTGCTGTGTCGTGG - Intronic
1167807611 19:51799469-51799491 GCAGGCTTTTGGCTGTGTCTTGG + Intronic
1167809964 19:51821052-51821074 CCAGGCTGTGTGCTGTGTCATGG - Intronic
925881195 2:8354146-8354168 TCTGGCTGTGGGATGTTTTTAGG + Intergenic
926826308 2:16908397-16908419 TCAGTTTGTAGGATGTTTCTGGG - Intergenic
929120463 2:38480108-38480130 TCCTGCTTTTGGATGTGTCTCGG - Intergenic
931748292 2:65309539-65309561 GGAGGATGTGGGATGTGTATAGG + Intergenic
932135593 2:69226075-69226097 TGAGGCTGAGAGATGTGGCTGGG - Intronic
932369788 2:71177521-71177543 TCAGGCAGAGGGAGGTCTCTGGG - Intergenic
932447018 2:71787417-71787439 TCAGGCTGTGGGATGGGATGGGG - Intergenic
935202081 2:100865970-100865992 TCAGGCTGAGGGTTGGGTCCAGG - Intronic
938071357 2:128310151-128310173 TCAGGCCCTGGGCTGTGTGTTGG - Intronic
938341834 2:130541114-130541136 CCAGGCTGTGGGATGTGCTGAGG + Intronic
938347996 2:130579597-130579619 CCAGGCTGTGGGATGTGCTGAGG - Intronic
938716281 2:134024787-134024809 GCAGGCTGTGGGGACTGTCTTGG - Intergenic
938992278 2:136641831-136641853 TTGGGGTGTGGGAGGTGTCTAGG - Intergenic
943479821 2:188404593-188404615 TGAGGCTGAGGGATCTGTCCTGG - Intronic
944119047 2:196221048-196221070 CCAGCTTGTGGGATGTGCCTAGG - Intronic
946111341 2:217420600-217420622 TGAGGCTGGGGGTTGGGTCTGGG - Intronic
947797490 2:232904173-232904195 CCAGGCTGTGGGGTGTGGCTCGG - Intronic
948428163 2:237901718-237901740 CCAGGGTGTGGGATGTGGCCTGG + Intronic
1169276371 20:4236020-4236042 TGAGCCTGGGGGATGTGTGTAGG + Intronic
1169977569 20:11347413-11347435 TCAGGGAGCGGGATGTCTCTAGG - Intergenic
1170206373 20:13802963-13802985 TCAGGTTTAGGGATGTTTCTAGG - Intronic
1170433064 20:16294764-16294786 TCAGCCTGTGGGATGGAACTGGG + Intronic
1171517071 20:25746412-25746434 CCAGGCTGTGTGCTGTCTCTGGG + Intergenic
1173231917 20:41205130-41205152 GCAAGCAGTGGAATGTGTCTGGG - Intronic
1173811239 20:45957188-45957210 GCAGGCTGTAGGAGGTGTCCCGG + Intronic
1174304023 20:49602556-49602578 GCAGGCTTGGGAATGTGTCTGGG - Intergenic
1177755445 21:25341950-25341972 TGAGGCTTTGGGAGGTGACTAGG - Intergenic
1178485754 21:33019465-33019487 TCAGACTGGGGTCTGTGTCTGGG + Intergenic
1179954827 21:44732782-44732804 TCAGGCTGAGGGATGGGCCCAGG + Intergenic
1180995003 22:19961236-19961258 TCTGGCTGCGGGAGGGGTCTGGG - Exonic
1181162721 22:20967477-20967499 TCAGGCTGTGGGATTTGGAGAGG + Intronic
1181371981 22:22425936-22425958 ACAGGGTGTGGGAAGTGGCTCGG - Intergenic
1181486805 22:23236690-23236712 CCTGGGTGTGGGATGTGACTGGG + Intronic
1184408836 22:44315082-44315104 TCAGGCTGAGGGATGGGTCAAGG + Intergenic
1185172010 22:49299646-49299668 GCAGGATGTGGGTGGTGTCTGGG - Intergenic
1185339027 22:50283479-50283501 TCAGGGTGTGGGGTGGGTCGGGG - Intronic
1185372784 22:50468692-50468714 TCAGGCTGAAGGAGGTCTCTGGG - Intronic
952482728 3:33778269-33778291 TTAGGCTGTGGCTTCTGTCTGGG + Intergenic
954301910 3:49704771-49704793 GCAGGCGGTGGGATTTGTGTTGG + Intronic
955952869 3:64259838-64259860 TCAGGGTGTTGGCTGTCTCTGGG - Intronic
956322067 3:68008058-68008080 TGAGGCTGGGGGCTGTTTCTGGG + Intronic
959912033 3:111774229-111774251 TAAGGCTGTGAGAGGTATCTGGG + Intronic
960036295 3:113105861-113105883 CCAGGCTGTGGGAAGGGACTGGG - Intergenic
961506462 3:127373931-127373953 CCAGGCTGGGGGGTGGGTCTGGG - Intergenic
962327242 3:134446455-134446477 TCAGTCTGTGGGATGAGTCTAGG + Intergenic
962517997 3:136171500-136171522 TGAGGCTGTGAGACCTGTCTGGG - Intronic
964394572 3:156231935-156231957 TCAGGCTGAGGGCTGTGTCATGG + Intronic
964579542 3:158217667-158217689 CCAGGCACTGGGTTGTGTCTTGG + Intronic
966590656 3:181678953-181678975 TCAGGCTGTGTGATGCCTCCAGG + Intergenic
968755500 4:2413879-2413901 GAAGGCTGTGGGAGGGGTCTTGG - Intronic
968956993 4:3724541-3724563 TCCGGCTCTGGGATGAGGCTGGG + Intergenic
969049574 4:4363176-4363198 GCAAGCTGTGGTATGTGTCATGG + Intronic
969145007 4:5114903-5114925 TCAGGGTGTGGGAAGAGGCTTGG - Intronic
969322270 4:6419608-6419630 TTAGGGCCTGGGATGTGTCTGGG + Intronic
969593852 4:8137142-8137164 CCAGGCTGTGGTATTTGTCACGG + Intronic
972834881 4:42858151-42858173 ACAGCCTGTGGTATGTGTTTTGG - Intergenic
974228208 4:59076562-59076584 TCAGGCTATGTGTTTTGTCTGGG + Intergenic
974356070 4:60814440-60814462 TAAGGCTGTGGGAGGTCTCTTGG - Intergenic
981281117 4:142960159-142960181 TCAGGTTTTGGAGTGTGTCTTGG - Intergenic
983555564 4:169056227-169056249 TCCTAATGTGGGATGTGTCTAGG + Intergenic
985755132 5:1709354-1709376 CCAGGCTGTGGGCCGTGCCTGGG - Intergenic
985815690 5:2126141-2126163 TGAGGCTGTGGGATGGGACATGG + Intergenic
986437818 5:7751832-7751854 TGAGGCTGTGGGGTGGGTCCAGG - Intronic
986731411 5:10637390-10637412 ACACTCTGTGGGATGTGTGTGGG + Intronic
987669818 5:20991430-20991452 ACATACTGTGGGATGTGTATTGG - Intergenic
987886633 5:23821971-23821993 TCAGGCATTGAGATGTGACTCGG - Intergenic
989158953 5:38371742-38371764 TCAGCCTTTGGAATGTGTCTGGG - Intronic
992727485 5:79623454-79623476 TCAGGCAGTGTGATTTCTCTAGG - Exonic
994347199 5:98700839-98700861 TCAGGCTGTGGGCTGTATGGGGG + Intergenic
995838230 5:116419491-116419513 TCAAGCTGTGGGCTGGGTCCAGG - Intergenic
996073135 5:119157742-119157764 TCAGGTAGTGTGATGTCTCTAGG + Intronic
996979316 5:129471068-129471090 TCAGGCGGTGGGATGTATGGGGG + Intronic
999206027 5:149848611-149848633 TCAAGCCCTGGCATGTGTCTTGG + Exonic
999449917 5:151670170-151670192 TCAGCCTGTGGCTGGTGTCTGGG + Intronic
1001065343 5:168530907-168530929 TCAGGCTGGGTCATGTGACTTGG - Intergenic
1001735395 5:173994364-173994386 TTAGGCTTTGGGAAGTGTTTTGG + Intronic
1001862214 5:175067339-175067361 TCAAGCTGAGGGATGAGCCTGGG + Intergenic
1002090213 5:176800533-176800555 TCTGGGTGTGGGGTGTGTGTGGG + Intergenic
1005148960 6:22725744-22725766 TCAGCCTGGGTCATGTGTCTGGG + Intergenic
1008843942 6:55939017-55939039 ACTGGCTGTGTGATGTGTCCTGG - Intergenic
1014632596 6:123804173-123804195 TCTGGCTGTGGCAGGGGTCTCGG + Exonic
1017557191 6:155583942-155583964 GCAGCCTGTGGGATGGGTTTAGG + Intergenic
1017770229 6:157638906-157638928 TCAGGCTGTGGGCGCTGCCTGGG - Intronic
1017903015 6:158734526-158734548 CCTGGAGGTGGGATGTGTCTGGG - Intronic
1018060246 6:160084483-160084505 TCAGGTTGTGGGAGGCGTGTGGG + Intronic
1018860633 6:167708555-167708577 TGCGGCTGTGGGGTGTGCCTGGG - Intergenic
1018864559 6:167736803-167736825 ACAGGCTGTGGAATCAGTCTGGG - Intergenic
1019367927 7:644774-644796 GAAGGCTATGGGAGGTGTCTGGG - Intronic
1019731793 7:2632873-2632895 TCAGGCTGTGGGATGTACACAGG + Intronic
1020146764 7:5650418-5650440 GCAGGCTGTGAGATGTTTCTTGG - Intronic
1025847329 7:65212187-65212209 TCAGGGTTTGGTAGGTGTCTGGG + Intergenic
1025897573 7:65718077-65718099 TCAGGGTTTGGTAGGTGTCTGGG + Intergenic
1028475028 7:91244101-91244123 TCAGGCAGTAGGCAGTGTCTGGG - Intergenic
1029058989 7:97777529-97777551 GCAGGCAGTGGGATGGGGCTGGG + Intergenic
1029129539 7:98319387-98319409 TCAGGCTGTGGGTGGTGTGCGGG - Intronic
1029207291 7:98877657-98877679 GCAGGGTGTGAAATGTGTCTAGG + Intergenic
1032348157 7:131136007-131136029 TCAGGCAGTAGGGTGAGTCTAGG + Intronic
1034453104 7:151148418-151148440 TCAGGTTCTGGGAGGAGTCTGGG + Intergenic
1035637520 8:1157545-1157567 TCAGGCTGTGCTCTGTGTCCCGG + Intergenic
1036027638 8:4927991-4928013 TGAGGATGTGGGGTGTGACTCGG - Intronic
1037291023 8:17349546-17349568 TCAGCTTGTGTGATGTGTCAGGG - Intronic
1037521367 8:19683295-19683317 CCAGGCTGTGGGAGGTGGCGAGG - Intronic
1040585970 8:48741619-48741641 TCATGCTGTTGCATGTGTCATGG + Intergenic
1042499992 8:69498499-69498521 TCAGAGTGAGGGTTGTGTCTTGG - Intronic
1044015411 8:87044644-87044666 TACAGCTGTGGGATGTCTCTAGG + Intronic
1044139164 8:88627751-88627773 TCAGGCAGTGTGATGCCTCTAGG + Intergenic
1046097461 8:109578441-109578463 TCAAGCTGTTAGCTGTGTCTGGG - Intronic
1048658869 8:136573763-136573785 TCATGATGTGGGATATGTGTGGG - Intergenic
1049570979 8:143370187-143370209 TCAGGCTGGGGGCTGTGCCTGGG + Intronic
1051336755 9:16072559-16072581 TCTAGCTGTGGGATGAGTCCTGG + Intergenic
1051871349 9:21741175-21741197 TCAGCATGTGGGATGTTGCTTGG + Intergenic
1052500366 9:29281474-29281496 TGGGACTGTGGGCTGTGTCTAGG - Intergenic
1055627372 9:78187969-78187991 TCAGGCTGTGGGAAGAGGCCTGG + Intergenic
1056949354 9:91029653-91029675 CCAGGATGTCGGCTGTGTCTCGG + Intergenic
1057598476 9:96436909-96436931 GCAGGCTTTGGAGTGTGTCTGGG + Intergenic
1057871656 9:98722644-98722666 GCAAGAAGTGGGATGTGTCTGGG - Intergenic
1057871813 9:98723678-98723700 TCCTGCTGTGGGCTGTGTCATGG - Intergenic
1059461523 9:114433743-114433765 TCAGGGTATGGGCTGGGTCTGGG + Intronic
1059773020 9:117445612-117445634 TCAGGCAGTGGGGTCTGTTTAGG - Intergenic
1060942709 9:127552165-127552187 TCAGGCTGTGTGCTGGGACTGGG - Intronic
1061380397 9:130253190-130253212 TCAGGATTTGGGATGGGTTTGGG - Intergenic
1061840829 9:133357640-133357662 TCAGACTGGTGGCTGTGTCTTGG - Intronic
1062582622 9:137235205-137235227 TCAGACTGGGGGAAGTGTCCTGG - Intronic
1185535930 X:861660-861682 CCTGGCTGTGGGCTCTGTCTAGG - Intergenic
1186726522 X:12364542-12364564 TTGGGCTGTGGGCTGTGTATTGG + Intronic
1188251899 X:27906598-27906620 TCAGACTGTGGGCTGGGTCTAGG - Intergenic
1189772374 X:44439158-44439180 CCAGGCTGTGGGTTGGGTCCAGG + Intergenic
1194575497 X:95609164-95609186 TCTTGCCTTGGGATGTGTCTGGG + Intergenic
1195402561 X:104477122-104477144 TCAGGTTGTGGGTGGTGCCTGGG + Intergenic
1199287210 X:146066875-146066897 TCAGGCTGTGGGGTGCATTTTGG + Intergenic
1201366367 Y:13211221-13211243 TCCAGCTGTGGGATGTCTCCAGG + Intergenic